Clone Name | bastl40b03 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AC098479.2| Homo sapiens chromosome 3 clone RP11-80H18, compl... | 40 | 3.8 | 2 | emb|BX935472.2| Gallus gallus finished cDNA, clone ChEST252d5 | 40 | 3.8 | 3 | emb|BX950429.1| Gallus gallus finished cDNA, clone ChEST1013h1 | 40 | 3.8 | 4 | gb|AC137936.3| Homo sapiens chromosome 3 clone RP11-456N14, comp... | 40 | 3.8 |
---|
>gb|AC098479.2| Homo sapiens chromosome 3 clone RP11-80H18, complete sequence Length = 178010 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 ccccttggtgaggtgaggtgtagc 46 ||||||||||||| |||||||||| Sbjct: 1387 ccccttggtgaggcgaggtgtagc 1364
>emb|BX935472.2| Gallus gallus finished cDNA, clone ChEST252d5 Length = 903 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 tgctgggggaggcgggtgag 182 |||||||||||||||||||| Sbjct: 89 tgctgggggaggcgggtgag 108
>emb|BX950429.1| Gallus gallus finished cDNA, clone ChEST1013h1 Length = 915 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 tgctgggggaggcgggtgag 182 |||||||||||||||||||| Sbjct: 101 tgctgggggaggcgggtgag 120
>gb|AC137936.3| Homo sapiens chromosome 3 clone RP11-456N14, complete sequence Length = 187869 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 ccccttggtgaggtgaggtgtagc 46 ||||||||||||| |||||||||| Sbjct: 135792 ccccttggtgaggcgaggtgtagc 135769 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,571,876 Number of Sequences: 3902068 Number of extensions: 1571876 Number of successful extensions: 24707 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24702 Number of HSP's gapped (non-prelim): 5 length of query: 291 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 269 effective length of database: 17,147,199,772 effective search space: 4612596738668 effective search space used: 4612596738668 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)