ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl39a11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC036978.1| Mus musculus kelch-like 15 (Drosophila), transcript variant 4, mRNA (cDNA clone IMAGE:4947611), complete cds Length = 1238 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 254 tcgggcgccgggatggaccgcga 232
>dbj|AK169500.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630052D17 product:hypothetical BTB/POZ/BTB domain profile containing protein, full insert sequence Length = 3945 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 260 tcgggcgccgggatggaccgcga 238
>dbj|AK078112.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330500C13 product:weakly similar to CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN [Homo sapiens], full insert sequence Length = 1581 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 353 tcgggcgccgggatggaccgcga 331
>dbj|AK081546.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130036K12 product:CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN homolog [Homo sapiens], full insert sequence Length = 1236 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 321 tcgggcgccgggatggaccgcga 299
>dbj|AK030432.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330411I24 product:unclassifiable, full insert sequence Length = 3334 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 353 tcgggcgccgggatggaccgcga 331
>ref|NM_001039060.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 2, mRNA Length = 4001 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>ref|NM_001039059.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 3, mRNA Length = 3137 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>ref|NM_001039061.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 1, mRNA Length = 2363 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 412 tcgggcgccgggatggaccgcga 390
>ref|NM_153165.2| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript variant 4, mRNA Length = 3188 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 317 tcgggcgccgggatggaccgcga 295
>emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chromosome X, complete sequence Length = 146105 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tcgggcgccgggatggaccgcga 139 ||||||||||||||||||||||| Sbjct: 27624 tcgggcgccgggatggaccgcga 27602
>ref|XM_418796.1| PREDICTED: Gallus gallus similar to C-C chemokine receptor 8 like (LOC420696), mRNA Length = 4461 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 330 caagctgctgctgcagagctc 350 ||||||||||||||||||||| Sbjct: 908 caagctgctgctgcagagctc 888
>emb|AJ627213.1| Gallus gallus primary C-C chemokine receptor cluster Length = 210954 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 330 caagctgctgctgcagagctc 350 ||||||||||||||||||||| Sbjct: 70636 caagctgctgctgcagagctc 70656
>ref|NM_001091.2| Homo sapiens amiloride binding protein 1 (amine oxidase (copper-containing)) (ABP1), mRNA Length = 2438 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1998 gctgctgctgcacagctccgactc 1975
>gb|AY771214.1| Zea mays RFLP probe umc6 (CBM 2.03) genomic sequence Length = 604 Score = 40.1 bits (20), Expect = 6.2 Identities = 32/36 (88%) Strand = Plus / Minus Query: 369 gctcaggctctcccttcagctcgtcagcgccaccgt 404 ||||| ||||||| | ||||| |||||||||||||| Sbjct: 572 gctcaagctctccatccagcttgtcagcgccaccgt 537
>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence Length = 227070 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 155 caggagcactggagcaccgg 174 |||||||||||||||||||| Sbjct: 160790 caggagcactggagcaccgg 160771
>ref|XM_421132.1| PREDICTED: Gallus gallus similar to Delta-like protein 4 precursor (Drosophila Delta homolog 4) (UNQ1895/PRO4341) (LOC423208), mRNA Length = 3061 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 ccagacctcgcccaccgcca 310 |||||||||||||||||||| Sbjct: 798 ccagacctcgcccaccgcca 779
>gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, complete sequence Length = 222210 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 155 caggagcactggagcaccgg 174 |||||||||||||||||||| Sbjct: 138961 caggagcactggagcaccgg 138942
>ref|XM_754907.1| Ustilago maydis 521 hypothetical protein (UM03853.1) partial mRNA Length = 4119 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 313 agcgctcgtgtcgagggcaa 332 |||||||||||||||||||| Sbjct: 2163 agcgctcgtgtcgagggcaa 2182
>emb|CR615931.1| full-length cDNA clone CS0DI041YG09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 848 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 420 gctgctgctgcacagctccgactc 397
>gb|AE014175.1| Mus musculus piebald deletion region section 3 of 11 of the complete sequence Length = 404829 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 332 agctgctgctgcagagctcc 351 |||||||||||||||||||| Sbjct: 245555 agctgctgctgcagagctcc 245536
>emb|CR626724.1| full-length cDNA clone CS0DI075YL04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 914 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 489 gctgctgctgcacagctccgactc 466
>emb|CR625394.1| full-length cDNA clone CS0DI005YO13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 979 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 579 gctgctgctgcacagctccgactc 556
>emb|CR624494.1| full-length cDNA clone CS0DI035YA04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1382 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1016 gctgctgctgcacagctccgactc 993
>emb|CR621626.1| full-length cDNA clone CS0DI006YD24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 856 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 428 gctgctgctgcacagctccgactc 405
>emb|CR622987.1| full-length cDNA clone CS0DI005YE14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 857 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 429 gctgctgctgcacagctccgactc 406
>emb|CR618888.1| full-length cDNA clone CS0DI058YD07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1846 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1432 gctgctgctgcacagctccgactc 1409
>emb|CR617395.1| full-length cDNA clone CS0DI052YI22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1358 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 962 gctgctgctgcacagctccgactc 939
>emb|CR617118.1| full-length cDNA clone CS0DI036YE20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1213 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 818 gctgctgctgcacagctccgactc 795
>emb|CR615995.1| full-length cDNA clone CS0DI080YK12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1232 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 806 gctgctgctgcacagctccgactc 783
>emb|CR611479.1| full-length cDNA clone CS0DI065YN24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 857 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 429 gctgctgctgcacagctccgactc 406
>emb|CR610042.1| full-length cDNA clone CS0DI030YE17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1712 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1311 gctgctgctgcacagctccgactc 1288
>dbj|AK092514.1| Homo sapiens cDNA FLJ35195 fis, clone PLACE6017626, highly similar to AMILORIDE-SENSITIVE AMINE OXIDASE Length = 2249 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1821 gctgctgctgcacagctccgactc 1798
>emb|CR608165.1| full-length cDNA clone CS0DI002YL05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1806 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1389 gctgctgctgcacagctccgactc 1366
>emb|CR603421.1| full-length cDNA clone CS0DI022YB02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2382 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1957 gctgctgctgcacagctccgactc 1934
>emb|CR602032.1| full-length cDNA clone CS0DI042YL13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 619 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 191 gctgctgctgcacagctccgactc 168
>emb|CR601090.1| full-length cDNA clone CS0DI070YI24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1251 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 860 gctgctgctgcacagctccgactc 837
>emb|CR600605.1| full-length cDNA clone CS0DE005YL15 of Placenta of Homo sapiens (human) Length = 911 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 485 gctgctgctgcacagctccgactc 462
>emb|CR598361.1| full-length cDNA clone CS0DI066YC19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1058 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 641 gctgctgctgcacagctccgactc 618
>emb|CR596790.1| full-length cDNA clone CS0DI061YD21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1462 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1049 gctgctgctgcacagctccgactc 1026
>emb|CR592378.1| full-length cDNA clone CS0DI022YL07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 769 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 341 gctgctgctgcacagctccgactc 318
>gb|AC084621.1|CBRG44O14 Caenorhabditis briggsae cosmid G44O14, complete sequence Length = 42064 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tggagcaccgggatggacca 183 |||||||||||||||||||| Sbjct: 3958 tggagcaccgggatggacca 3977
>gb|AF218035.1|AF218035 Homo sapiens clone PP941 unknown mRNA Length = 1721 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 1274 gctgctgctgcacagctccgactc 1251
>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence Length = 124877 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 106058 gctgctgctgcacagctccgactc 106081
>emb|BX648159.1|HSM808306 Homo sapiens mRNA; cDNA DKFZp686I2132 (from clone DKFZp686I2132) Length = 6573 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 6129 gctgctgctgcacagctccgactc 6106
>gb|AC154455.2| Mus musculus BAC clone RP23-185H13 from 14, complete sequence Length = 215308 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 tcacccaacaacaccaagca 22 |||||||||||||||||||| Sbjct: 125742 tcacccaacaacaccaagca 125761
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 attctccgtccgtcacgggc 114 |||||||||||||||||||| Sbjct: 4134240 attctccgtccgtcacgggc 4134259
>gb|AY110012.1| Zea mays CL907_1 mRNA sequence Length = 2928 Score = 40.1 bits (20), Expect = 6.2 Identities = 32/36 (88%) Strand = Plus / Plus Query: 369 gctcaggctctcccttcagctcgtcagcgccaccgt 404 ||||| ||||||| | ||||| |||||||||||||| Sbjct: 354 gctcaagctctccatccagcttgtcagcgccaccgt 389
>gb|AC114410.9| Mus musculus chromosome 14, clone RP23-151K8, complete sequence Length = 201783 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 332 agctgctgctgcagagctcc 351 |||||||||||||||||||| Sbjct: 117300 agctgctgctgcagagctcc 117281
>gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map 3, complete sequence Length = 193174 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 155 caggagcactggagcaccgg 174 |||||||||||||||||||| Sbjct: 151111 caggagcactggagcaccgg 151092
>gb|U11862.1|HSU11862 Human clone HP-DAO1 diamine oxidase, copper/topa quinone-containing mRNA, complete cds Length = 2441 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 2006 gctgctgctgcacagctccgactc 1983
>emb|AL732404.7| Mouse DNA sequence from clone RP23-177D21 on chromosome 2, complete sequence Length = 220275 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 329 gcaagctgctgctgcagagctccg 352 ||||||||||||||| |||||||| Sbjct: 9886 gcaagctgctgctgctgagctccg 9909
>emb|X78212.1|HSDAO H.sapiens diamine oxidase gene Length = 9903 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 gctgctgctgcagagctccgactc 356 |||||||||||| ||||||||||| Sbjct: 8931 gctgctgctgcacagctccgactc 8908 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,253,313 Number of Sequences: 3902068 Number of extensions: 3253313 Number of successful extensions: 64570 Number of sequences better than 10.0: 52 Number of HSP's better than 10.0 without gapping: 52 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 64438 Number of HSP's gapped (non-prelim): 132 length of query: 462 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 440 effective length of database: 17,147,199,772 effective search space: 7544767899680 effective search space used: 7544767899680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
