ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl39a08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC104964.12| Homo sapiens chromosome 8, clone RP11-981G7, com... 46 0.097
2emb|CR598413.1| full-length cDNA clone CS0DF032YJ23 of Fetal bra... 46 0.097
3dbj|AK055360.1| Homo sapiens cDNA FLJ30798 fis, clone FEBRA2001161 46 0.097
4gb|AC124552.3| Mus musculus BAC clone RP23-222M11 from chromosom... 42 1.5
5ref|XM_533120.2| PREDICTED: Canis familiaris hematological and n... 42 1.5
6ref|XM_844577.1| PREDICTED: Canis familiaris hematological and n... 42 1.5
7emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 42 1.5
8dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 1.5
9tpg|BK001558.1| TPA: TPA_inf: Canis familiaris HN1 mRNA, complet... 42 1.5
10gb|AY952935.1| Expression vector pFNK-101, complete sequence 42 1.5
11gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 1.5
12gb|DQ305103.1| RNAi cloning and transformation vector pFRiPE, co... 42 1.5
13gb|U16803.1|HSU16803 Human unidentified genomic sequence 42 1.5
14ref|XM_512008.1| PREDICTED: Pan troglodytes similar to hematolog... 40 6.0
15ref|NM_001003351.1| Canis familiaris laminin, gamma 2 (LAMC2), mRNA 40 6.0
16ref|NM_197067.1| Oryza sativa (japonica cultivar-group) hypothet... 40 6.0
17gb|AF266847.1| Homo sapiens androgen-regulated protein 2 (ARM2) ... 40 6.0
18gb|AF266846.1| Homo sapiens androgen-regulated protein 2 (ARM2) ... 40 6.0
19gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
20gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
21gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosom... 40 6.0
22gb|BC001420.2| Homo sapiens hematological and neurological expre... 40 6.0
23gb|AF086910.2| Homo sapiens Hn1 mRNA, complete cds 40 6.0
24emb|AJ251914.1|SSC251914 Sus scrofa MHC class I SLA genes, haplo... 40 6.0
25gb|AF236864.2| Canis familiaris laminin-5 gamma 2 mRNA, complete... 40 6.0
26gb|AY082802.1| Equus caballus laminin 5 gamma 2 subunit mRNA, co... 40 6.0
27ref|NM_001002032.1| Homo sapiens hematological and neurological ... 40 6.0
28ref|NM_001002033.1| Homo sapiens hematological and neurological ... 40 6.0
29ref|NM_016185.2| Homo sapiens hematological and neurological exp... 40 6.0
30emb|BX293535.3| Human DNA sequence from clone RP4-752I6 on chrom... 40 6.0
31gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 6.0
32emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on ch... 40 6.0
33gb|AY322170.1| Homo sapiens hematological and neurological expre... 40 6.0
34gb|AY322169.1| Homo sapiens hematological and neurological expre... 40 6.0
35emb|AL132868.24|HSA262P20 Human DNA sequence from clone RP11-262... 40 6.0
36gb|AF348672.2| Homo sapiens hematological and neurological expre... 40 6.0
37emb|AL034417.14|HS215D11 Human DNA sequence from clone CTA-215D1... 40 6.0
38emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 40 6.0
39emb|AL606684.3|OSJN00088 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
40emb|AL389891.1|NCB7F18 Neurospora crassa DNA linkage group I BAC... 40 6.0
41gb|AC051632.18| Oryza sativa chromosome 10 BAC OSJNBa0012L23 gen... 40 6.0
42emb|CR626175.1| full-length cDNA clone CS0DI056YL13 of Placenta ... 40 6.0
43emb|CR625805.1| full-length cDNA clone CS0DI027YD06 of Placenta ... 40 6.0
44emb|CR624118.1| full-length cDNA clone CS0DL003YE23 of B cells (... 40 6.0
45emb|CR623069.1| full-length cDNA clone CS0DI018YG02 of Placenta ... 40 6.0
46emb|CR620568.1| full-length cDNA clone CS0DF007YD20 of Fetal bra... 40 6.0
47emb|CR615505.1| full-length cDNA clone CS0DC025YH06 of Neuroblas... 40 6.0
48emb|CR615283.1| full-length cDNA clone CS0DC013YH07 of Neuroblas... 40 6.0
49emb|CR613024.1| full-length cDNA clone CS0DF015YA24 of Fetal bra... 40 6.0
50emb|CR610842.1| full-length cDNA clone CS0DL009YF05 of B cells (... 40 6.0
51emb|CR608874.1| full-length cDNA clone CS0DI019YD21 of Placenta ... 40 6.0
52emb|CR608252.1| full-length cDNA clone CS0DF005YG09 of Fetal bra... 40 6.0
53emb|CR604677.1| full-length cDNA clone CS0DC027YJ20 of Neuroblas... 40 6.0
54emb|CR605958.1| full-length cDNA clone CS0DI018YH02 of Placenta ... 40 6.0
55emb|CR605404.1| full-length cDNA clone CS0DF006YO14 of Fetal bra... 40 6.0
56emb|CR605576.1| full-length cDNA clone CS0DK003YF24 of HeLa cell... 40 6.0
57emb|CR602662.1| full-length cDNA clone CS0DF001YG03 of Fetal bra... 40 6.0
58emb|CR601210.1| full-length cDNA clone CS0DE013YF10 of Placenta ... 40 6.0
59emb|CR596640.1| full-length cDNA clone CS0DL005YJ11 of B cells (... 40 6.0
60emb|CR594573.1| full-length cDNA clone CS0DH003YJ12 of T cells (... 40 6.0
61emb|CR594240.1| full-length cDNA clone CS0DI082YL19 of Placenta ... 40 6.0
62emb|CR594206.1| full-length cDNA clone CS0DF028YI07 of Fetal bra... 40 6.0
63emb|CR592678.1| full-length cDNA clone CS0DD007YH16 of Neuroblas... 40 6.0
64emb|CR592277.1| full-length cDNA clone CS0DI037YO20 of Placenta ... 40 6.0
65emb|CR590585.1| full-length cDNA clone CS0DL006YA21 of B cells (... 40 6.0
66ref|NM_135320.2| Drosophila melanogaster CG7093-RA (CG7093), mRNA 40 6.0
67gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 gen... 40 6.0
68tpg|BK001554.1| TPA: TPA_inf: Pan troglodytes HN1 mRNA, complete... 40 6.0
69gb|AY051636.1| Drosophila melanogaster GH28569 full length cDNA 40 6.0
70gb|AC022211.5|AC022211 Homo sapiens BAC clone RP11-649A18 from 1... 40 6.0
71dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
72gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, r... 40 6.0
73dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
74dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
75gb|AC008306.3|AC008306 Drosophila melanogaster, chromosome 2R, r... 40 6.0
76gb|AC007836.5|AC007836 Drosophila melanogaster, chromosome 2R, r... 40 6.0
77emb|AL606452.2|OSJN00007 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
78gb|AC093915.2| Homo sapiens BAC clone RP11-785G17 from 2, comple... 40 6.0
79gb|AC145899.4| Pan troglodytes BAC clone RP43-19O5 from chromoso... 40 6.0
80dbj|AK223321.1| Homo sapiens mRNA for hematological and neurolog... 40 6.0
81dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.0
82dbj|AK120898.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
83dbj|AK119567.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
84dbj|AK060634.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
85gb|AF177862.1|AF177862 Homo sapiens HN1 protein mRNA, complete cds 40 6.0
86gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 6.0
87gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28... 40 6.0
88gb|AE003814.3| Drosophila melanogaster chromosome 2R, section 36... 40 6.0
89emb|CR974422.14| Mouse DNA sequence from clone RP23-123G8 on chr... 40 6.0
90gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
91emb|CT010508.10| Mouse DNA sequence from clone RP23-250G8 on chr... 40 6.0
92gb|U65939.1|AVU65939 Azotobacter vinelandii GTPase (ftsA) gene, ... 40 6.0
93emb|AL606592.2|OSJN00024 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
94gb|AF027865.1|MMMMH461 Mus musculus Major Histocompatibility Loc... 40 6.0
95emb|Z69638.1|HSL174G8A Human DNA sequence from clone LA04NC01-17... 40 6.0
96gb|DQ138817.1| Drosophila erecta voucher stock #14021-0224.0 CG7... 40 6.0
97gb|DQ138816.1| Drosophila yakuba strain T33 CG7093 gene, partial... 40 6.0
98gb|DQ138815.1| Drosophila yakuba strain Tai18 CG7093 gene, parti... 40 6.0
99gb|DQ138814.1| Drosophila simulans strain Ky-b CG7093 gene, part... 40 6.0
100gb|DQ138813.1| Drosophila simulans strain Ky-a CG7093 gene, part... 40 6.0
101gb|DQ138812.1| Drosophila melanogaster strain Ral1 CG7093 gene, ... 40 6.0
102dbj|AB045294.1| Homo sapiens DJ-1 gene, promoter and 5'UTR 40 6.0

>gb|AC104964.12| Homo sapiens chromosome 8, clone RP11-981G7, complete sequence
          Length = 212226

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 88     gctggcgctgctgctgcctgcat 110
              |||||||||||||||||||||||
Sbjct: 158031 gctggcgctgctgctgcctgcat 158053



to top

>emb|CR598413.1| full-length cDNA clone CS0DF032YJ23 of Fetal brain of Homo sapiens
            (human)
          Length = 2628

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 88   gctggcgctgctgctgcctgcat 110
            |||||||||||||||||||||||
Sbjct: 1699 gctggcgctgctgctgcctgcat 1677



to top

>dbj|AK055360.1| Homo sapiens cDNA FLJ30798 fis, clone FEBRA2001161
          Length = 2174

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 88   gctggcgctgctgctgcctgcat 110
            |||||||||||||||||||||||
Sbjct: 1205 gctggcgctgctgctgcctgcat 1183



to top

>gb|AC124552.3| Mus musculus BAC clone RP23-222M11 from chromosome 19, complete
             sequence
          Length = 237281

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 108   catctctatgccctgccctgc 128
             |||||||||||||||||||||
Sbjct: 78618 catctctatgccctgccctgc 78638



to top

>ref|XM_533120.2| PREDICTED: Canis familiaris hematological and neurological
           expressed 1, transcript variant 1 (HN1), mRNA
          Length = 697

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 358 gccgaggagcgaggcaggcaggcgc 382
           |||||||||||||| ||||||||||
Sbjct: 104 gccgaggagcgaggtaggcaggcgc 80



to top

>ref|XM_844577.1| PREDICTED: Canis familiaris hematological and neurological
           expressed 1, transcript variant 2 (HN1), mRNA
          Length = 1448

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 358 gccgaggagcgaggcaggcaggcgc 382
           |||||||||||||| ||||||||||
Sbjct: 104 gccgaggagcgaggtaggcaggcgc 80



to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 101    ctgcctgcatctctatgccct 121
              |||||||||||||||||||||
Sbjct: 404430 ctgcctgcatctctatgccct 404450



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 417     ggcgacgacctcgcgccgggc 437
               |||||||||||||||||||||
Sbjct: 3853784 ggcgacgacctcgcgccgggc 3853764



to top

>tpg|BK001558.1| TPA: TPA_inf: Canis familiaris HN1 mRNA, complete cds
          Length = 598

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 358 gccgaggagcgaggcaggcaggcgc 382
           |||||||||||||| ||||||||||
Sbjct: 106 gccgaggagcgaggtaggcaggcgc 82



to top

>gb|AY952935.1| Expression vector pFNK-101, complete sequence
          Length = 4099

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 192  gcgagggcgagggcgacggca 212
            |||||||||||||||||||||
Sbjct: 1500 gcgagggcgagggcgacggca 1520



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 417     ggcgacgacctcgcgccgggc 437
               |||||||||||||||||||||
Sbjct: 3854457 ggcgacgacctcgcgccgggc 3854437



to top

>gb|DQ305103.1| RNAi cloning and transformation vector pFRiPE, complete sequence
          Length = 15857

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 192  gcgagggcgagggcgacggca 212
            |||||||||||||||||||||
Sbjct: 1880 gcgagggcgagggcgacggca 1900



to top

>gb|U16803.1|HSU16803 Human unidentified genomic sequence
          Length = 1881

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 363  ggagcgaggcaggcaggcgcc 383
            |||||||||||||||||||||
Sbjct: 1802 ggagcgaggcaggcaggcgcc 1822



to top

>ref|XM_512008.1| PREDICTED: Pan troglodytes similar to hematological and
           neurological expressed 1 isoform 1; androgen-regulated
           protein 2 (LOC455274), mRNA
          Length = 443

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 110 gccgaggagcgaggtaggctggcgccgg 83



to top

>ref|NM_001003351.1| Canis familiaris laminin, gamma 2 (LAMC2), mRNA
          Length = 3974

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 89  ctggcgctgctgctgcctgc 108
           ||||||||||||||||||||
Sbjct: 169 ctggcgctgctgctgcctgc 188



to top

>ref|NM_197067.1| Oryza sativa (japonica cultivar-group) hypothetical protein
           (OSJNBa0012L23.61), mRNA
          Length = 684

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 192 gcgagggcgagggcgacggc 211
           ||||||||||||||||||||
Sbjct: 368 gcgagggcgagggcgacggc 387



to top

>gb|AF266847.1| Homo sapiens androgen-regulated protein 2 (ARM2) gene, complete cds
          Length = 19296

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 152 gccgaggagcgaggtaggctggcgccgg 125



to top

>gb|AF266846.1| Homo sapiens androgen-regulated protein 2 (ARM2) mRNA, complete cds
          Length = 1461

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 112 gccgaggagcgaggtaggctggcgccgg 85



to top

>gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0020H14,
              complete sequence
          Length = 185623

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    gcgagggcgagggcgacggc 211
              ||||||||||||||||||||
Sbjct: 106459 gcgagggcgagggcgacggc 106478



to top

>gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1110B01,
              complete sequence
          Length = 160142

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    gcgagggcgagggcgacggc 211
              ||||||||||||||||||||
Sbjct: 145686 gcgagggcgagggcgacggc 145705



to top

>gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosome 9, complete sequence
          Length = 190608

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   acggcatctctctatatagc 226
             ||||||||||||||||||||
Sbjct: 57776 acggcatctctctatatagc 57795



to top

>gb|BC001420.2| Homo sapiens hematological and neurological expressed 1, mRNA (cDNA
           clone MGC:696 IMAGE:3140086), complete cds
          Length = 704

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 101 gccgaggagcgaggtaggctggcgccgg 74



to top

>gb|AF086910.2| Homo sapiens Hn1 mRNA, complete cds
          Length = 1621

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 283 gccgaggagcgaggtaggctggcgccgg 256



to top

>emb|AJ251914.1|SSC251914 Sus scrofa MHC class I SLA genes, haplotype H01, clone BAC 493A6
          Length = 158063

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 116    tgccctgccctgctgccgcttctt 139
              ||||||||||| ||||||||||||
Sbjct: 132193 tgccctgcccttctgccgcttctt 132170



to top

>gb|AF236864.2| Canis familiaris laminin-5 gamma 2 mRNA, complete cds
          Length = 3974

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 89  ctggcgctgctgctgcctgc 108
           ||||||||||||||||||||
Sbjct: 169 ctggcgctgctgctgcctgc 188



to top

>gb|AY082802.1| Equus caballus laminin 5 gamma 2 subunit mRNA, complete cds
          Length = 3991

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 89  ctggcgctgctgctgcctgc 108
           ||||||||||||||||||||
Sbjct: 233 ctggcgctgctgctgcctgc 252



to top

>ref|NM_001002032.1| Homo sapiens hematological and neurological expressed 1 (HN1),
           transcript variant 2, mRNA
          Length = 1582

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 279 gccgaggagcgaggtaggctggcgccgg 252



to top

>ref|NM_001002033.1| Homo sapiens hematological and neurological expressed 1 (HN1),
           transcript variant 3, mRNA
          Length = 1696

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 279 gccgaggagcgaggtaggctggcgccgg 252



to top

>ref|NM_016185.2| Homo sapiens hematological and neurological expressed 1 (HN1),
           transcript variant 1, mRNA
          Length = 1602

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 280 gccgaggagcgaggtaggctggcgccgg 253



to top

>emb|BX293535.3| Human DNA sequence from clone RP4-752I6 on chromosome 1 Contains the 5'
             end of the WASF2 gene for WAS protein family, member 2 and
             a novel gene, complete sequence
          Length = 71971

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   gcgagggcgagggcgacggc 211
             ||||||||||||||||||||
Sbjct: 68654 gcgagggcgagggcgacggc 68635



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 86      ccgctggcgctgctgctgcc 105
               ||||||||||||||||||||
Sbjct: 1579701 ccgctggcgctgctgctgcc 1579720



to top

>emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on chromosome 13q21.1-21.3,
             complete sequence
          Length = 160015

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    ggcctcctgagctggatgca 29
             ||||||||||||||||||||
Sbjct: 52912 ggcctcctgagctggatgca 52931



to top

>gb|AY322170.1| Homo sapiens hematological and neurological expressed protein 1C
           (HN1) mRNA, complete cds; alternatively spliced
          Length = 1633

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 275 gccgaggagcgaggtaggctggcgccgg 248



to top

>gb|AY322169.1| Homo sapiens hematological and neurological expressed protein 1B
           (HN1) mRNA, complete cds; alternatively spliced
          Length = 1519

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 275 gccgaggagcgaggtaggctggcgccgg 248



to top

>emb|AL132868.24|HSA262P20 Human DNA sequence from clone RP11-262P20 on chromosome 4, complete
            sequence
          Length = 193444

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 359  ccgaggagcgaggcaggcaggcgccggg 386
            |||||| || ||||||||||||||||||
Sbjct: 2315 ccgaggggccaggcaggcaggcgccggg 2342



to top

>gb|AF348672.2| Homo sapiens hematological and neurological expressed gene 1-like
           protein (HN1A) gene, complete cds; alternatively spliced
          Length = 19394

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 200 gccgaggagcgaggtaggctggcgccgg 173



to top

>emb|AL034417.14|HS215D11 Human DNA sequence from clone CTA-215D11 on chromosome 1p36.12-36.33
             Contains the PARK7 gene for Parkinson disease (autosomal
             recessive, early onset) 7, a novel gene, gene 33/Mig-6
             (MIG-6), a ribosomal protein L7a (RPL7A) pseudogene, the
             5' end of a novel gene (FLJ26758) and two CpG islands,
             complete sequence
          Length = 122279

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 78    ccgcgcccccgctggcgctg 97
             ||||||||||||||||||||
Sbjct: 10659 ccgcgcccccgctggcgctg 10640



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   gcgagggcgagggcgacggc 211
             ||||||||||||||||||||
Sbjct: 12265 gcgagggcgagggcgacggc 12246



to top

>emb|AL606684.3|OSJN00088 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0085I10,
              complete sequence
          Length = 150551

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 260    ctagcaccaccaccgctcgt 279
              ||||||||||||||||||||
Sbjct: 105538 ctagcaccaccaccgctcgt 105519



to top

>emb|AL389891.1|NCB7F18 Neurospora crassa DNA linkage group I BAC clone B7F18
          Length = 71088

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    cccgctggcgctgctgctgc 104
             ||||||||||||||||||||
Sbjct: 30688 cccgctggcgctgctgctgc 30669



to top

>gb|AC051632.18| Oryza sativa chromosome 10 BAC OSJNBa0012L23 genomic sequence, complete
              sequence
          Length = 153182

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    gcgagggcgagggcgacggc 211
              ||||||||||||||||||||
Sbjct: 145590 gcgagggcgagggcgacggc 145609



to top

>emb|CR626175.1| full-length cDNA clone CS0DI056YL13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1377

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 80  gccgaggagcgaggtaggctggcgccgg 53



to top

>emb|CR625805.1| full-length cDNA clone CS0DI027YD06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1403

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR624118.1| full-length cDNA clone CS0DL003YE23 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1382

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 95  gccgaggagcgaggtaggctggcgccgg 68



to top

>emb|CR623069.1| full-length cDNA clone CS0DI018YG02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1402

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR620568.1| full-length cDNA clone CS0DF007YD20 of Fetal brain of Homo sapiens
           (human)
          Length = 1417

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 95  gccgaggagcgaggtaggctggcgccgg 68



to top

>emb|CR615505.1| full-length cDNA clone CS0DC025YH06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1397

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 100 gccgaggagcgaggtaggctggcgccgg 73



to top

>emb|CR615283.1| full-length cDNA clone CS0DC013YH07 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1402

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR613024.1| full-length cDNA clone CS0DF015YA24 of Fetal brain of Homo sapiens
           (human)
          Length = 959

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 106 gccgaggagcgaggtaggctggcgccgg 79



to top

>emb|CR610842.1| full-length cDNA clone CS0DL009YF05 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1379

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 87  gccgaggagcgaggtaggctggcgccgg 60



to top

>emb|CR608874.1| full-length cDNA clone CS0DI019YD21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1379

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR608252.1| full-length cDNA clone CS0DF005YG09 of Fetal brain of Homo sapiens
           (human)
          Length = 1416

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR604677.1| full-length cDNA clone CS0DC027YJ20 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1396

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 98  gccgaggagcgaggtaggctggcgccgg 71



to top

>emb|CR605958.1| full-length cDNA clone CS0DI018YH02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1399

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 104 gccgaggagcgaggtaggctggcgccgg 77



to top

>emb|CR605404.1| full-length cDNA clone CS0DF006YO14 of Fetal brain of Homo sapiens
           (human)
          Length = 1396

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 85  gccgaggagcgaggtaggctggcgccgg 58



to top

>emb|CR605576.1| full-length cDNA clone CS0DK003YF24 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1426

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 100 gccgaggagcgaggtaggctggcgccgg 73



to top

>emb|CR602662.1| full-length cDNA clone CS0DF001YG03 of Fetal brain of Homo sapiens
           (human)
          Length = 1112

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 95  gccgaggagcgaggtaggctggcgccgg 68



to top

>emb|CR601210.1| full-length cDNA clone CS0DE013YF10 of Placenta of Homo sapiens
           (human)
          Length = 844

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 283 gccgaggagcgaggtaggctggcgccgg 256



to top

>emb|CR596640.1| full-length cDNA clone CS0DL005YJ11 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1322

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 29  gccgaggagcgaggtaggctggcgccgg 2



to top

>emb|CR594573.1| full-length cDNA clone CS0DH003YJ12 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1404

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 80  gccgaggagcgaggtaggctggcgccgg 53



to top

>emb|CR594240.1| full-length cDNA clone CS0DI082YL19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1396

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 95  gccgaggagcgaggtaggctggcgccgg 68



to top

>emb|CR594206.1| full-length cDNA clone CS0DF028YI07 of Fetal brain of Homo sapiens
           (human)
          Length = 1406

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 101 gccgaggagcgaggtaggctggcgccgg 74



to top

>emb|CR592678.1| full-length cDNA clone CS0DD007YH16 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1500

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 98  gccgaggagcgaggtaggctggcgccgg 71



to top

>emb|CR592277.1| full-length cDNA clone CS0DI037YO20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1396

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 98  gccgaggagcgaggtaggctggcgccgg 71



to top

>emb|CR590585.1| full-length cDNA clone CS0DL006YA21 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1388

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 98  gccgaggagcgaggtaggctggcgccgg 71



to top

>ref|NM_135320.2| Drosophila melanogaster CG7093-RA (CG7093), mRNA
          Length = 3336

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2479 cccgctggcgctgctgctgc 2460



to top

>gb|AC087182.12| Oryza sativa chromosome 10 BAC OSJNBa0029C15 genomic sequence, complete
              sequence
          Length = 148816

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    gcgagggcgagggcgacggc 211
              ||||||||||||||||||||
Sbjct: 141571 gcgagggcgagggcgacggc 141552



to top

>tpg|BK001554.1| TPA: TPA_inf: Pan troglodytes HN1 mRNA, complete cds
          Length = 598

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 110 gccgaggagcgaggtaggctggcgccgg 83



to top

>gb|AY051636.1| Drosophila melanogaster GH28569 full length cDNA
          Length = 1657

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 85  cccgctggcgctgctgctgc 104
           ||||||||||||||||||||
Sbjct: 800 cccgctggcgctgctgctgc 781



to top

>gb|AC022211.5|AC022211 Homo sapiens BAC clone RP11-649A18 from 17, complete sequence
          Length = 191155

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 358   gccgaggagcgaggcaggcaggcgccgg 385
             |||||||||||||| |||| ||||||||
Sbjct: 44062 gccgaggagcgaggtaggctggcgccgg 44089



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 260      ctagcaccaccaccgctcgt 279
                ||||||||||||||||||||
Sbjct: 31008165 ctagcaccaccaccgctcgt 31008146



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 116      tgccctgccctgctgccgct 135
                ||||||||||||||||||||
Sbjct: 21826798 tgccctgccctgctgccgct 21826779



to top

>gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, region 28C-28D, BAC clone
              BACR31D05, complete sequence
          Length = 172633

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     cccgctggcgctgctgctgc 104
              ||||||||||||||||||||
Sbjct: 102751 cccgctggcgctgctgctgc 102770



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 192      gcgagggcgagggcgacggc 211
                ||||||||||||||||||||
Sbjct: 17790470 gcgagggcgagggcgacggc 17790489



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 192      gcgagggcgagggcgacggc 211
                ||||||||||||||||||||
Sbjct: 21552603 gcgagggcgagggcgacggc 21552622



to top

>gb|AC008306.3|AC008306 Drosophila melanogaster, chromosome 2R, region 51B-51B, BAC clone
             BACR27M04, complete sequence
          Length = 169689

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   gggattgggatttgggattg 318
             ||||||||||||||||||||
Sbjct: 87980 gggattgggatttgggattg 87961



to top

>gb|AC007836.5|AC007836 Drosophila melanogaster, chromosome 2R, region 50F-51C, BAC clone
              BACR06D02, complete sequence
          Length = 172791

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 299    gggattgggatttgggattg 318
              ||||||||||||||||||||
Sbjct: 156398 gggattgggatttgggattg 156379



to top

>emb|AL606452.2|OSJN00007 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01,
             complete sequence
          Length = 127713

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tgccctgccctgctgccgct 135
             ||||||||||||||||||||
Sbjct: 11399 tgccctgccctgctgccgct 11380



to top

>gb|AC093915.2| Homo sapiens BAC clone RP11-785G17 from 2, complete sequence
          Length = 120416

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    gctgctgctgcctgcatctc 113
             ||||||||||||||||||||
Sbjct: 16216 gctgctgctgcctgcatctc 16197



to top

>gb|AC145899.4| Pan troglodytes BAC clone RP43-19O5 from chromosome 7, complete
             sequence
          Length = 176118

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cctgcatctctatgccctgc 123
             ||||||||||||||||||||
Sbjct: 37903 cctgcatctctatgccctgc 37922



to top

>dbj|AK223321.1| Homo sapiens mRNA for hematological and neurological expressed 1
           isoform 1 variant, clone: TMS07112
          Length = 1447

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 112 gccgaggagcgaggtaggctggcgccgg 85



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 176     gcatagcaggcgccacgcga 195
               ||||||||||||||||||||
Sbjct: 4894068 gcatagcaggcgccacgcga 4894087



to top

>dbj|AK120898.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030I02, full
           insert sequence
          Length = 2788

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 260 ctagcaccaccaccgctcgt 279
           ||||||||||||||||||||
Sbjct: 91  ctagcaccaccaccgctcgt 72



to top

>dbj|AK119567.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-A06, full
           insert sequence
          Length = 2871

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 303 ttgggatttgggattgcgcg 322
           ||||||||||||||||||||
Sbjct: 99  ttgggatttgggattgcgcg 80



to top

>dbj|AK060634.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-B10, full
            insert sequence
          Length = 1380

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 116  tgccctgccctgctgccgct 135
            ||||||||||||||||||||
Sbjct: 1106 tgccctgccctgctgccgct 1125



to top

>gb|AF177862.1|AF177862 Homo sapiens HN1 protein mRNA, complete cds
          Length = 704

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 358 gccgaggagcgaggcaggcaggcgccgg 385
           |||||||||||||| |||| ||||||||
Sbjct: 100 gccgaggagcgaggtaggctggcgccgg 73



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    gcgagggcgagggcgacggc 211
              ||||||||||||||||||||
Sbjct: 801586 gcgagggcgagggcgacggc 801605



to top

>gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28 of 83 of the complete
             sequence
          Length = 289516

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    cccgctggcgctgctgctgc 104
             ||||||||||||||||||||
Sbjct: 73141 cccgctggcgctgctgctgc 73160



to top

>gb|AE003814.3| Drosophila melanogaster chromosome 2R, section 36 of 73 of the complete
              sequence
          Length = 254438

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 299    gggattgggatttgggattg 318
              ||||||||||||||||||||
Sbjct: 192254 gggattgggatttgggattg 192235



to top

>emb|CR974422.14| Mouse DNA sequence from clone RP23-123G8 on chromosome 17, complete
              sequence
          Length = 189049

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 95     ctgctgctgcctgcatctct 114
              ||||||||||||||||||||
Sbjct: 126563 ctgctgctgcctgcatctct 126544



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 192      gcgagggcgagggcgacggc 211
                ||||||||||||||||||||
Sbjct: 17799723 gcgagggcgagggcgacggc 17799742



to top

>emb|CT010508.10| Mouse DNA sequence from clone RP23-250G8 on chromosome 9, complete
             sequence
          Length = 223547

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   acggcatctctctatatagc 226
             ||||||||||||||||||||
Sbjct: 62008 acggcatctctctatatagc 61989



to top

>gb|U65939.1|AVU65939 Azotobacter vinelandii GTPase (ftsA) gene, partial cds, and ATP
            binding protein (ftsZ) gene, complete cds
          Length = 1645

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 1325 cccgctggcgctgctgctgc 1344



to top

>emb|AL606592.2|OSJN00024 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0006B20,
              complete sequence
          Length = 141915

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tgccctgccctgctgccgct 135
              ||||||||||||||||||||
Sbjct: 138415 tgccctgccctgctgccgct 138396



to top

>gb|AF027865.1|MMMMH461 Mus musculus Major Histocompatibility Locus class II region
          Length = 138187

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 95    ctgctgctgcctgcatctct 114
             ||||||||||||||||||||
Sbjct: 94297 ctgctgctgcctgcatctct 94278



to top

>emb|Z69638.1|HSL174G8A Human DNA sequence from clone LA04NC01-174G8 on chromosome 4, complete
             sequence
          Length = 27974

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 359   ccgaggagcgaggcaggcaggcgccggg 386
             |||||| || ||||||||||||||||||
Sbjct: 18472 ccgaggggccaggcaggcaggcgccggg 18499



to top

>gb|DQ138817.1| Drosophila erecta voucher stock #14021-0224.0 CG7093 gene, partial
            cds
          Length = 2625

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2440 cccgctggcgctgctgctgc 2421



to top

>gb|DQ138816.1| Drosophila yakuba strain T33 CG7093 gene, partial cds
          Length = 2640

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2476 cccgctggcgctgctgctgc 2457



to top

>gb|DQ138815.1| Drosophila yakuba strain Tai18 CG7093 gene, partial cds
          Length = 2637

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2473 cccgctggcgctgctgctgc 2454



to top

>gb|DQ138814.1| Drosophila simulans strain Ky-b CG7093 gene, partial cds
          Length = 2595

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2434 cccgctggcgctgctgctgc 2415



to top

>gb|DQ138813.1| Drosophila simulans strain Ky-a CG7093 gene, partial cds
          Length = 2592

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2431 cccgctggcgctgctgctgc 2412



to top

>gb|DQ138812.1| Drosophila melanogaster strain Ral1 CG7093 gene, partial cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 85   cccgctggcgctgctgctgc 104
            ||||||||||||||||||||
Sbjct: 2437 cccgctggcgctgctgctgc 2418



to top

>dbj|AB045294.1| Homo sapiens DJ-1 gene, promoter and  5'UTR
          Length = 2119

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 78   ccgcgcccccgctggcgctg 97
            ||||||||||||||||||||
Sbjct: 1130 ccgcgcccccgctggcgctg 1111


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,921,279
Number of Sequences: 3902068
Number of extensions: 3921279
Number of successful extensions: 79718
Number of sequences better than 10.0: 102
Number of HSP's better than 10.0 without gapping: 103
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79043
Number of HSP's gapped (non-prelim): 675
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top