ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl38f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL118508.27|HSJ737E23 Human DNA sequence from clone RP4-737E... 46 0.095
2gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 42 1.5
3emb|CR855994.1| Wallaby DNA sequence from clone MEKBa-69G12, com... 42 1.5
4emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on ch... 42 1.5
5gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y... 42 1.5
6gb|AC140356.3| Mus musculus BAC clone RP23-216B19 from 6, comple... 42 1.5
7gb|AC158142.19| Mus musculus chromosome 15, clone RP24-342H15, c... 42 1.5
8gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons... 42 1.5
9ref|NM_195001.1| Oryza sativa (japonica cultivar-group) putative... 40 5.9
10gb|AC169506.1| Mus musculus BAC clone RP23-417L6 from chromosome... 40 5.9
11ref|XM_516255.1| PREDICTED: Pan troglodytes similar to caveolin ... 40 5.9
12gb|AC005751.1| Homo sapiens chromosome 16, BAC clone 375G12 (LAN... 40 5.9
13ref|XM_362231.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.9
14gb|AC103380.13| Mus musculus chromosome 1, clone RP24-263A16, co... 40 5.9
15gb|AC147478.2| Pan troglodytes BAC clone CH251-571L4 from Y, com... 40 5.9
16gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 40 5.9
17gb|AC147131.2| Pan troglodytes BAC clone CH251-403A11 from Y, co... 40 5.9
18gb|AC009135.12| Homo sapiens chromosome 16 clone RP11-509E10, co... 40 5.9
19gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome... 40 5.9
20emb|AJ301559.2|RFA301559 Rhodococcus fascians ORF1 (partial), OR... 40 5.9
21emb|AL354668.13| Human DNA sequence from clone RP11-506P24 on ch... 40 5.9
22emb|AL096814.26|HSDJ139D8 Human DNA sequence from clone RP1-139D... 40 5.9
23emb|AL035411.28|HS592A1 Human DNA sequence from clone RP4-592A1 ... 40 5.9
24ref|XM_971080.1| PREDICTED: Tribolium castaneum hypothetical pro... 40 5.9
25emb|CR860580.1| Pongo pygmaeus mRNA; cDNA DKFZp459J237 (from clo... 40 5.9
26gb|AC163387.2| Mus musculus chromosome 1, clone RP24-181G14, com... 40 5.9
27gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.9
28gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 5.9
29ref|NM_001038859.1| Drosophila melanogaster CG8585-RE, transcrip... 40 5.9
30ref|NM_001038858.1| Drosophila melanogaster CG8585-RB, transcrip... 40 5.9
31ref|NM_001038856.1| Drosophila melanogaster CG8585-RC, transcrip... 40 5.9
32gb|AY060342.1| Drosophila melanogaster GH23838 full length cDNA 40 5.9
33gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome... 40 5.9
34gb|AC078944.5|AC078944 Genomic Sequence for Oryza sativa, Nippon... 40 5.9
35gb|AF176315.2|AF176315 Homo sapiens chromosome 3 clone RP11-83M1... 40 5.9
36gb|AC008381.8|AC008381 Homo sapiens chromosome 5 clone CTC-216O1... 40 5.9
37gb|AC008229.3|AC008229 Drosophila melanogaster, chromosome 2R, r... 40 5.9
38dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
39gb|AC119873.38| Mus musculus chromosome 3, clone RP24-275F18, co... 40 5.9
40gb|AC154462.2| Mus musculus BAC clone RP24-165F12 from chromosom... 40 5.9
41gb|AC025752.8| Homo sapiens chromosome 5 clone CTC-430J12, compl... 40 5.9
42gb|AC008151.1| Homo sapiens 3 BAC CITB-243A6 (California Institu... 40 5.9
43gb|AF204690.1|AF204690 Homo sapiens caveolin-3 gene, partial cds 40 5.9
44gb|AY928072.1| Drosophila melanogaster hyperpolarization-activat... 40 5.9
45gb|AY928070.1| Drosophila melanogaster hyperpolarization-activat... 40 5.9
46gb|AY928069.1| Drosophila melanogaster hyperpolarization-activat... 40 5.9
47gb|AF124300.1|AF124300 Drosophila melanogaster putative voltage-... 40 5.9
48dbj|AK065306.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
49emb|CT010445.12| Mouse DNA sequence from clone RP23-285G1 on chr... 40 5.9
50gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35... 40 5.9
51gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
52gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complet... 40 5.9
53emb|AL626768.21| Mouse DNA sequence from clone RP23-347B4 on chr... 40 5.9
54emb|AL627445.21| Mouse DNA sequence from clone RP23-81D2 on chro... 40 5.9
55emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on ch... 40 5.9
56gb|AC068312.5| Homo sapiens chromosome 3 clone RP11-128A5 map 3p... 40 5.9

>emb|AL118508.27|HSJ737E23 Human DNA sequence from clone RP4-737E23 on chromosome 20p11.1-11.23
              Contains the gene complement component C1q receptor (C1QR),
              a putative novel gene, ESTs, STSs and GSSs, complete
              sequence
          Length = 123832

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 176    tggggcttcccctcccccttctt 198
              |||||||||||||||||||||||
Sbjct: 101617 tggggcttcccctcccccttctt 101595



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 97      cggcggccgccgcttcggcac 117
               |||||||||||||||||||||
Sbjct: 2787904 cggcggccgccgcttcggcac 2787884



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 267     tcgccggccgccgtgcgcctcgcgtggg 294
               ||||||| ||||||||||||| ||||||
Sbjct: 3190319 tcgccggacgccgtgcgcctcacgtggg 3190292



to top

>emb|CR855994.1| Wallaby DNA sequence from clone MEKBa-69G12, complete sequence
          Length = 174698

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   gggcttcccctcccccttctt 198
             |||||||||||||||||||||
Sbjct: 99379 gggcttcccctcccccttctt 99399



to top

>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33
             Contains a discs, large homolog 7 (Drosophila) (DLG7)
             pseudogene, complete sequence
          Length = 177722

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 224   tcgggatctggatcgggacct 244
             |||||||||||||||||||||
Sbjct: 49039 tcgggatctggatcgggacct 49019



to top

>gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y, complete sequence
          Length = 148342

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 224   tcgggatctggatcgggacct 244
             |||||||||||||||||||||
Sbjct: 68575 tcgggatctggatcgggacct 68555



to top

>gb|AC140356.3| Mus musculus BAC clone RP23-216B19 from 6, complete sequence
          Length = 211504

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 181    cttcccctcccccttcttctg 201
              |||||||||||||||||||||
Sbjct: 116457 cttcccctcccccttcttctg 116437



to top

>gb|AC158142.19| Mus musculus chromosome 15, clone RP24-342H15, complete sequence
          Length = 195319

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 180   gcttcccctcccccttcttct 200
             |||||||||||||||||||||
Sbjct: 83268 gcttcccctcccccttcttct 83288



to top

>gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons 7-12
          Length = 1557

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 60  cgcgaccgccgcacccccgcc 80
           |||||||||||||||||||||
Sbjct: 642 cgcgaccgccgcacccccgcc 662



to top

>ref|NM_195001.1| Oryza sativa (japonica cultivar-group) putative cytochrome P-450
           (OSJNBa0089D15.20), mRNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 261 cccgcctcgccggccgccgtgcgc 284
           |||||||||| |||||||||||||
Sbjct: 941 cccgcctcgcgggccgccgtgcgc 918



to top

>gb|AC169506.1| Mus musculus BAC clone RP23-417L6 from chromosome 17, complete sequence
          Length = 202033

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   cttcccctcccccttcttct 200
             ||||||||||||||||||||
Sbjct: 49229 cttcccctcccccttcttct 49210



to top

>ref|XM_516255.1| PREDICTED: Pan troglodytes similar to caveolin 3; M-caveolin;
           caveolin-3 (LOC460143), mRNA
          Length = 853

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 166 gaagctgctgtggggcttcccctc 189
           ||||||||||||||||| ||||||
Sbjct: 26  gaagctgctgtggggctgcccctc 3



to top

>gb|AC005751.1| Homo sapiens chromosome 16, BAC clone 375G12 (LANL), complete sequence
          Length = 162822

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 122202 cttcccctcccccttcttct 122221



to top

>ref|XM_362231.1| Magnaporthe grisea 70-15 hypothetical protein (MG04676.4) partial
           cds
          Length = 1512

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 198 tctgggcggcggcccctcgc 217
           ||||||||||||||||||||
Sbjct: 141 tctgggcggcggcccctcgc 160



to top

>gb|AC103380.13| Mus musculus chromosome 1, clone RP24-263A16, complete sequence
          Length = 173136

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 149465 cttcccctcccccttcttct 149446



to top

>gb|AC147478.2| Pan troglodytes BAC clone CH251-571L4 from Y, complete sequence
          Length = 188138

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcgaagctgctgtggggctt 183
              ||||||||||||||||||||
Sbjct: 123681 tcgaagctgctgtggggctt 123700



to top

>gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosome 5, complete sequence
          Length = 227388

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 177    ggggcttcccctcccccttcttct 200
              |||||| |||||||||||||||||
Sbjct: 146802 ggggctccccctcccccttcttct 146779



to top

>gb|AC147131.2| Pan troglodytes BAC clone CH251-403A11 from Y, complete sequence
          Length = 168159

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcgaagctgctgtggggctt 183
              ||||||||||||||||||||
Sbjct: 155968 tcgaagctgctgtggggctt 155987



to top

>gb|AC009135.12| Homo sapiens chromosome 16 clone RP11-509E10, complete sequence
          Length = 221640

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 130611 cttcccctcccccttcttct 130592



to top

>gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome 17, complete sequence
          Length = 171820

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   cttcccctcccccttcttct 200
             ||||||||||||||||||||
Sbjct: 54182 cttcccctcccccttcttct 54163



to top

>emb|AJ301559.2|RFA301559 Rhodococcus fascians ORF1 (partial), ORF2, ORF3, vicA gene and ORF5
            (partial)
          Length = 18560

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  ccgcttcggcaccgctggcc 125
            ||||||||||||||||||||
Sbjct: 1882 ccgcttcggcaccgctggcc 1863



to top

>emb|AL354668.13| Human DNA sequence from clone RP11-506P24 on chromosome 13 Contains the
              SPRY2 gene for sprouty homolog 2 (Drosophila) and a CpG
              island, complete sequence
          Length = 191652

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 171838 cttcccctcccccttcttct 171857



to top

>emb|AL096814.26|HSDJ139D8 Human DNA sequence from clone RP1-139D8 on chromosome 6p12.1-21.1
             Contains genes for GUCA1A (guanylate cyclase activator 1A)
             and GUCA1B (guanylate cyclase activator 1B) both from
             retina, the 3' end of the TReP-132 gene for zinc finger
             transcription regulating protein, the MRPS10 gene for
             mitochondrial ribosomal protein S10, the 5' end the gene
             for a novel protein, the gene for a novel protein and two
             CpG Islands, complete sequence
          Length = 167078

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   cactccttcctttccccgcc 266
             ||||||||||||||||||||
Sbjct: 19456 cactccttcctttccccgcc 19475



to top

>emb|AL035411.28|HS592A1 Human DNA sequence from clone RP4-592A1 on chromosome 1p31.2-32.3
              Contains the 3' end of a novel gene (KIAA1915), an
              adenylate kinase 2 (AK2) pseudogene, the TACSTD2 gene for
              tumor-associated calcium signal transducer 2 and a CpG
              island, complete sequence
          Length = 146112

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 243    ctgccactccttcctttccc 262
              ||||||||||||||||||||
Sbjct: 143202 ctgccactccttcctttccc 143221



to top

>ref|XM_971080.1| PREDICTED: Tribolium castaneum hypothetical protein LOC656182
           (LOC656182), mRNA
          Length = 1812

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 302 tcgttccgaaaacaccacca 321
           ||||||||||||||||||||
Sbjct: 126 tcgttccgaaaacaccacca 145



to top

>emb|CR860580.1| Pongo pygmaeus mRNA; cDNA DKFZp459J237 (from clone DKFZp459J237)
          Length = 3022

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 259 tccccgcctcgccggccgcc 278
           ||||||||||||||||||||
Sbjct: 87  tccccgcctcgccggccgcc 106



to top

>gb|AC163387.2| Mus musculus chromosome 1, clone RP24-181G14, complete sequence
          Length = 194188

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 187806 cttcccctcccccttcttct 187825



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 263     cgcctcgccggccgccgtgc 282
               ||||||||||||||||||||
Sbjct: 5266601 cgcctcgccggccgccgtgc 5266620



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 164     tcgaagctgctgtggggctt 183
               ||||||||||||||||||||
Sbjct: 5756950 tcgaagctgctgtggggctt 5756969



to top

>ref|NM_001038859.1| Drosophila melanogaster CG8585-RE, transcript variant E (Ih), mRNA
          Length = 4435

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1417 gatcgggatctggatcggga 1436



to top

>ref|NM_001038858.1| Drosophila melanogaster CG8585-RB, transcript variant B (Ih), mRNA
          Length = 4324

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1417 gatcgggatctggatcggga 1436



to top

>ref|NM_001038856.1| Drosophila melanogaster CG8585-RC, transcript variant C (Ih), mRNA
          Length = 4486

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1579 gatcgggatctggatcggga 1598



to top

>gb|AY060342.1| Drosophila melanogaster GH23838 full length cDNA
          Length = 2828

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 gatcgggatctggatcggga 241
           ||||||||||||||||||||
Sbjct: 824 gatcgggatctggatcggga 843



to top

>gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome 17, complete sequence
          Length = 146960

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    cttcccctcccccttcttct 200
              ||||||||||||||||||||
Sbjct: 115079 cttcccctcccccttcttct 115060



to top

>gb|AC078944.5|AC078944 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0089D15, from Chromosome 10, complete sequence
          Length = 164679

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 261   cccgcctcgccggccgccgtgcgc 284
             |||||||||| |||||||||||||
Sbjct: 94368 cccgcctcgcgggccgccgtgcgc 94345



to top

>gb|AF176315.2|AF176315 Homo sapiens chromosome 3 clone RP11-83M12 map 3p, complete sequence
          Length = 170755

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 166   gaagctgctgtggggcttcccctc 189
             ||||||||||||||||| ||||||
Sbjct: 67223 gaagctgctgtggggctgcccctc 67246



to top

>gb|AC008381.8|AC008381 Homo sapiens chromosome 5 clone CTC-216O13, complete sequence
          Length = 101303

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   ctgccactccttcctttccc 262
             ||||||||||||||||||||
Sbjct: 78474 ctgccactccttcctttccc 78455



to top

>gb|AC008229.3|AC008229 Drosophila melanogaster, chromosome 2R, region 51E-51F, BAC clone
             BACR16C17, complete sequence
          Length = 180425

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   gatcgggatctggatcggga 241
             ||||||||||||||||||||
Sbjct: 54883 gatcgggatctggatcggga 54902



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 261     cccgcctcgccggccgccgtgcgc 284
               |||||||||| |||||||||||||
Sbjct: 4097539 cccgcctcgcgggccgccgtgcgc 4097516



to top

>gb|AC119873.38| Mus musculus chromosome 3, clone RP24-275F18, complete sequence
          Length = 183408

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   cttcccctcccccttcttct 200
             ||||||||||||||||||||
Sbjct: 92272 cttcccctcccccttcttct 92291



to top

>gb|AC154462.2| Mus musculus BAC clone RP24-165F12 from chromosome 14, complete sequence
          Length = 164631

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    ttcccctcccccttcttctg 201
              ||||||||||||||||||||
Sbjct: 129340 ttcccctcccccttcttctg 129359



to top

>gb|AC025752.8| Homo sapiens chromosome 5 clone CTC-430J12, complete sequence
          Length = 189154

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   ctgccactccttcctttccc 262
             ||||||||||||||||||||
Sbjct: 40770 ctgccactccttcctttccc 40751



to top

>gb|AC008151.1| Homo sapiens 3 BAC CITB-243A6 (California Institute of Technology BAC
            Library) complete sequence
          Length = 178242

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 166  gaagctgctgtggggcttcccctc 189
            ||||||||||||||||| ||||||
Sbjct: 8054 gaagctgctgtggggctgcccctc 8031



to top

>gb|AF204690.1|AF204690 Homo sapiens caveolin-3 gene, partial cds
          Length = 1297

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 166 gaagctgctgtggggcttcccctc 189
           ||||||||||||||||| ||||||
Sbjct: 564 gaagctgctgtggggctgcccctc 541



to top

>gb|AY928072.1| Drosophila melanogaster hyperpolarization-activated ion channel
            variant DMIH-A1B2C2 mRNA, complete cds, alternatively
            spliced
          Length = 4411

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1393 gatcgggatctggatcggga 1412



to top

>gb|AY928070.1| Drosophila melanogaster hyperpolarization-activated ion channel
            variant DMIH-A2B1C1 mRNA, complete cds, alternatively
            spliced
          Length = 4462

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1555 gatcgggatctggatcggga 1574



to top

>gb|AY928069.1| Drosophila melanogaster hyperpolarization-activated ion channel
            variant DMIH-A1B1C1 mRNA, complete cds, alternatively
            spliced
          Length = 4300

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  gatcgggatctggatcggga 241
            ||||||||||||||||||||
Sbjct: 1393 gatcgggatctggatcggga 1412



to top

>gb|AF124300.1|AF124300 Drosophila melanogaster putative voltage- and cyclic
           nucleotide-gated ion channel mRNA, complete cds
          Length = 3262

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 gatcgggatctggatcggga 241
           ||||||||||||||||||||
Sbjct: 340 gatcgggatctggatcggga 359



to top

>dbj|AK065306.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002O07,
          full insert sequence
          Length = 1113

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 65 ccgccgcacccccgccaccg 84
          ||||||||||||||||||||
Sbjct: 81 ccgccgcacccccgccaccg 62



to top

>emb|CT010445.12| Mouse DNA sequence from clone RP23-285G1 on chromosome 17, complete
             sequence
          Length = 123987

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   cttcccctcccccttcttct 200
             ||||||||||||||||||||
Sbjct: 52361 cttcccctcccccttcttct 52380



to top

>gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35 of 73 of the complete
              sequence
          Length = 229685

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    gatcgggatctggatcggga 241
              ||||||||||||||||||||
Sbjct: 139945 gatcgggatctggatcggga 139964



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 261     cccgcctcgccggccgccgtgcgc 284
               |||||||||| |||||||||||||
Sbjct: 4098360 cccgcctcgcgggccgccgtgcgc 4098337



to top

>gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complete sequence
          Length = 153492

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 177    ggggcttcccctcccccttcttct 200
              |||||| |||||||||||||||||
Sbjct: 102405 ggggctccccctcccccttcttct 102428



to top

>emb|AL626768.21| Mouse DNA sequence from clone RP23-347B4 on chromosome 4, complete
              sequence
          Length = 227165

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 184    cccctcccccttcttctggg 203
              ||||||||||||||||||||
Sbjct: 210630 cccctcccccttcttctggg 210649



to top

>emb|AL627445.21| Mouse DNA sequence from clone RP23-81D2 on chromosome 11, complete
              sequence
          Length = 216303

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    ttcccctcccccttcttctg 201
              ||||||||||||||||||||
Sbjct: 198335 ttcccctcccccttcttctg 198354



to top

>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete
             sequence
          Length = 220242

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   cttcccctcccccttcttct 200
             ||||||||||||||||||||
Sbjct: 93699 cttcccctcccccttcttct 93718



to top

>gb|AC068312.5| Homo sapiens chromosome 3 clone RP11-128A5 map 3p, complete sequence
          Length = 170350

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 166   gaagctgctgtggggcttcccctc 189
             ||||||||||||||||| ||||||
Sbjct: 62910 gaagctgctgtggggctgcccctc 62887


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,465,620
Number of Sequences: 3902068
Number of extensions: 3465620
Number of successful extensions: 82567
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82254
Number of HSP's gapped (non-prelim): 313
length of query: 436
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 414
effective length of database: 17,147,199,772
effective search space: 7098940705608
effective search space used: 7098940705608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top