ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl38f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC036978.1| Mus musculus kelch-like 15 (Drosophila), transcri... 46 0.093
2dbj|AK169500.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 46 0.093
3dbj|AK078112.1| Mus musculus adult male medulla oblongata cDNA, ... 46 0.093
4dbj|AK081546.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 46 0.093
5dbj|AK030432.1| Mus musculus adult male pituitary gland cDNA, RI... 46 0.093
6ref|NM_001039060.1| Mus musculus kelch-like 15 (Drosophila) (Klh... 46 0.093
7ref|NM_001039059.1| Mus musculus kelch-like 15 (Drosophila) (Klh... 46 0.093
8ref|NM_001039061.1| Mus musculus kelch-like 15 (Drosophila) (Klh... 46 0.093
9ref|NM_153165.2| Mus musculus kelch-like 15 (Drosophila) (Klhl15... 46 0.093
10emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chro... 46 0.093
11ref|XM_418796.1| PREDICTED: Gallus gallus similar to C-C chemoki... 42 1.5
12emb|AJ627213.1| Gallus gallus primary C-C chemokine receptor clu... 42 1.5
13ref|NM_001091.2| Homo sapiens amiloride binding protein 1 (amine... 40 5.7
14gb|AY771214.1| Zea mays RFLP probe umc6 (CBM 2.03) genomic sequence 40 5.7
15gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome... 40 5.7
16ref|XM_421132.1| PREDICTED: Gallus gallus similar to Delta-like ... 40 5.7
17gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, comp... 40 5.7
18ref|XM_754907.1| Ustilago maydis 521 hypothetical protein (UM038... 40 5.7
19emb|CR615931.1| full-length cDNA clone CS0DI041YG09 of Placenta ... 40 5.7
20gb|AE014175.1| Mus musculus piebald deletion region section 3 of... 40 5.7
21emb|CR626724.1| full-length cDNA clone CS0DI075YL04 of Placenta ... 40 5.7
22emb|CR625394.1| full-length cDNA clone CS0DI005YO13 of Placenta ... 40 5.7
23emb|CR624494.1| full-length cDNA clone CS0DI035YA04 of Placenta ... 40 5.7
24emb|CR621626.1| full-length cDNA clone CS0DI006YD24 of Placenta ... 40 5.7
25emb|CR622987.1| full-length cDNA clone CS0DI005YE14 of Placenta ... 40 5.7
26emb|CR618888.1| full-length cDNA clone CS0DI058YD07 of Placenta ... 40 5.7
27emb|CR617395.1| full-length cDNA clone CS0DI052YI22 of Placenta ... 40 5.7
28emb|CR617118.1| full-length cDNA clone CS0DI036YE20 of Placenta ... 40 5.7
29emb|CR615995.1| full-length cDNA clone CS0DI080YK12 of Placenta ... 40 5.7
30emb|CR611479.1| full-length cDNA clone CS0DI065YN24 of Placenta ... 40 5.7
31emb|CR610042.1| full-length cDNA clone CS0DI030YE17 of Placenta ... 40 5.7
32dbj|AK092514.1| Homo sapiens cDNA FLJ35195 fis, clone PLACE60176... 40 5.7
33emb|CR608165.1| full-length cDNA clone CS0DI002YL05 of Placenta ... 40 5.7
34emb|CR603421.1| full-length cDNA clone CS0DI022YB02 of Placenta ... 40 5.7
35emb|CR602032.1| full-length cDNA clone CS0DI042YL13 of Placenta ... 40 5.7
36emb|CR601090.1| full-length cDNA clone CS0DI070YI24 of Placenta ... 40 5.7
37emb|CR600605.1| full-length cDNA clone CS0DE005YL15 of Placenta ... 40 5.7
38emb|CR598361.1| full-length cDNA clone CS0DI066YC19 of Placenta ... 40 5.7
39emb|CR596790.1| full-length cDNA clone CS0DI061YD21 of Placenta ... 40 5.7
40emb|CR592378.1| full-length cDNA clone CS0DI022YL07 of Placenta ... 40 5.7
41gb|AC084621.1|CBRG44O14 Caenorhabditis briggsae cosmid G44O14, c... 40 5.7
42gb|AF218035.1|AF218035 Homo sapiens clone PP941 unknown mRNA 40 5.7
43gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, ... 40 5.7
44emb|BX648159.1|HSM808306 Homo sapiens mRNA; cDNA DKFZp686I2132 (... 40 5.7
45gb|AC154455.2| Mus musculus BAC clone RP23-185H13 from 14, compl... 40 5.7
46emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 5.7
47gb|AY110012.1| Zea mays CL907_1 mRNA sequence 40 5.7
48gb|AC114410.9| Mus musculus chromosome 14, clone RP23-151K8, com... 40 5.7
49gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map... 40 5.7
50gb|U11862.1|HSU11862 Human clone HP-DAO1 diamine oxidase, copper... 40 5.7
51emb|AL732404.7| Mouse DNA sequence from clone RP23-177D21 on chr... 40 5.7
52emb|X78212.1|HSDAO H.sapiens diamine oxidase gene 40 5.7 
>gb|BC036978.1| Mus musculus kelch-like 15 (Drosophila), transcript variant 4, mRNA
           (cDNA clone IMAGE:4947611), complete cds
          Length = 1238

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 254 tcgggcgccgggatggaccgcga 232
to top
>dbj|AK169500.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630052D17 product:hypothetical
           BTB/POZ/BTB domain profile containing protein, full
           insert sequence
          Length = 3945

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 260 tcgggcgccgggatggaccgcga 238
to top
>dbj|AK078112.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330500C13 product:weakly
           similar to CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY
           SIMILAR TO RING CANAL PROTEIN [Homo sapiens], full
           insert sequence
          Length = 1581

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 353 tcgggcgccgggatggaccgcga 331
to top
>dbj|AK081546.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130036K12 product:CDNA FLJ32736 FIS,
           CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN
           homolog [Homo sapiens], full insert sequence
          Length = 1236

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 321 tcgggcgccgggatggaccgcga 299
to top
>dbj|AK030432.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330411I24
           product:unclassifiable, full insert sequence
          Length = 3334

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 353 tcgggcgccgggatggaccgcga 331
to top
>ref|NM_001039060.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 2, mRNA
          Length = 4001

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295
to top
>ref|NM_001039059.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 3, mRNA
          Length = 3137

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295
to top
>ref|NM_001039061.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 1, mRNA
          Length = 2363

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 412 tcgggcgccgggatggaccgcga 390
to top
>ref|NM_153165.2| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 4, mRNA
          Length = 3188

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 118 tcgggcgccgggatggaccgcga 140
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295
to top
>emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chromosome X, complete
             sequence
          Length = 146105

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 118   tcgggcgccgggatggaccgcga 140
             |||||||||||||||||||||||
Sbjct: 27624 tcgggcgccgggatggaccgcga 27602
to top
>ref|XM_418796.1| PREDICTED: Gallus gallus similar to C-C chemokine receptor 8 like
           (LOC420696), mRNA
          Length = 4461

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 331 caagctgctgctgcagagctc 351
           |||||||||||||||||||||
Sbjct: 908 caagctgctgctgcagagctc 888
to top
>emb|AJ627213.1| Gallus gallus primary C-C chemokine receptor cluster
          Length = 210954

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 331   caagctgctgctgcagagctc 351
             |||||||||||||||||||||
Sbjct: 70636 caagctgctgctgcagagctc 70656
to top
>ref|NM_001091.2| Homo sapiens amiloride binding protein 1 (amine oxidase
            (copper-containing)) (ABP1), mRNA
          Length = 2438

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1998 gctgctgctgcacagctccgactc 1975
to top
>gb|AY771214.1| Zea mays RFLP probe umc6 (CBM 2.03) genomic sequence
          Length = 604

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 370 gctcaggctctcccttcagctcgtcagcgccaccgt 405
           ||||| ||||||| | ||||| ||||||||||||||
Sbjct: 572 gctcaagctctccatccagcttgtcagcgccaccgt 537
to top
>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence
          Length = 227070

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    caggagcactggagcaccgg 175
              ||||||||||||||||||||
Sbjct: 160790 caggagcactggagcaccgg 160771
to top
>ref|XM_421132.1| PREDICTED: Gallus gallus similar to Delta-like protein 4 precursor
           (Drosophila Delta homolog 4) (UNQ1895/PRO4341)
           (LOC423208), mRNA
          Length = 3061

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 292 ccagacctcgcccaccgcca 311
           ||||||||||||||||||||
Sbjct: 798 ccagacctcgcccaccgcca 779
to top
>gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, complete sequence
          Length = 222210

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    caggagcactggagcaccgg 175
              ||||||||||||||||||||
Sbjct: 138961 caggagcactggagcaccgg 138942
to top
>ref|XM_754907.1| Ustilago maydis 521 hypothetical protein (UM03853.1) partial mRNA
          Length = 4119

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 314  agcgctcgtgtcgagggcaa 333
            ||||||||||||||||||||
Sbjct: 2163 agcgctcgtgtcgagggcaa 2182
to top
>emb|CR615931.1| full-length cDNA clone CS0DI041YG09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 848

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 420 gctgctgctgcacagctccgactc 397
to top
>gb|AE014175.1| Mus musculus piebald deletion region section 3 of 11 of the complete
              sequence
          Length = 404829

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    agctgctgctgcagagctcc 352
              ||||||||||||||||||||
Sbjct: 245555 agctgctgctgcagagctcc 245536
to top
>emb|CR626724.1| full-length cDNA clone CS0DI075YL04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 914

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 489 gctgctgctgcacagctccgactc 466
to top
>emb|CR625394.1| full-length cDNA clone CS0DI005YO13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 979

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 579 gctgctgctgcacagctccgactc 556
to top
>emb|CR624494.1| full-length cDNA clone CS0DI035YA04 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1382

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1016 gctgctgctgcacagctccgactc 993
to top
>emb|CR621626.1| full-length cDNA clone CS0DI006YD24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 856

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 428 gctgctgctgcacagctccgactc 405
to top
>emb|CR622987.1| full-length cDNA clone CS0DI005YE14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 857

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 429 gctgctgctgcacagctccgactc 406
to top
>emb|CR618888.1| full-length cDNA clone CS0DI058YD07 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1846

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1432 gctgctgctgcacagctccgactc 1409
to top
>emb|CR617395.1| full-length cDNA clone CS0DI052YI22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1358

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 962 gctgctgctgcacagctccgactc 939
to top
>emb|CR617118.1| full-length cDNA clone CS0DI036YE20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1213

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 818 gctgctgctgcacagctccgactc 795
to top
>emb|CR615995.1| full-length cDNA clone CS0DI080YK12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1232

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 806 gctgctgctgcacagctccgactc 783
to top
>emb|CR611479.1| full-length cDNA clone CS0DI065YN24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 857

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 429 gctgctgctgcacagctccgactc 406
to top
>emb|CR610042.1| full-length cDNA clone CS0DI030YE17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1712

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1311 gctgctgctgcacagctccgactc 1288
to top
>dbj|AK092514.1| Homo sapiens cDNA FLJ35195 fis, clone PLACE6017626, highly similar to
            AMILORIDE-SENSITIVE AMINE OXIDASE
          Length = 2249

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1821 gctgctgctgcacagctccgactc 1798
to top
>emb|CR608165.1| full-length cDNA clone CS0DI002YL05 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1806

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1389 gctgctgctgcacagctccgactc 1366
to top
>emb|CR603421.1| full-length cDNA clone CS0DI022YB02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2382

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1957 gctgctgctgcacagctccgactc 1934
to top
>emb|CR602032.1| full-length cDNA clone CS0DI042YL13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 619

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 191 gctgctgctgcacagctccgactc 168
to top
>emb|CR601090.1| full-length cDNA clone CS0DI070YI24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1251

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 860 gctgctgctgcacagctccgactc 837
to top
>emb|CR600605.1| full-length cDNA clone CS0DE005YL15 of Placenta of Homo sapiens
           (human)
          Length = 911

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 485 gctgctgctgcacagctccgactc 462
to top
>emb|CR598361.1| full-length cDNA clone CS0DI066YC19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1058

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 641 gctgctgctgcacagctccgactc 618
to top
>emb|CR596790.1| full-length cDNA clone CS0DI061YD21 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1462

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1049 gctgctgctgcacagctccgactc 1026
to top
>emb|CR592378.1| full-length cDNA clone CS0DI022YL07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 769

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 334 gctgctgctgcagagctccgactc 357
           |||||||||||| |||||||||||
Sbjct: 341 gctgctgctgcacagctccgactc 318
to top
>gb|AC084621.1|CBRG44O14 Caenorhabditis briggsae cosmid G44O14, complete sequence
          Length = 42064

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 165  tggagcaccgggatggacca 184
            ||||||||||||||||||||
Sbjct: 3958 tggagcaccgggatggacca 3977
to top
>gb|AF218035.1|AF218035 Homo sapiens clone PP941 unknown mRNA
          Length = 1721

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 1274 gctgctgctgcacagctccgactc 1251
to top
>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence
          Length = 124877

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 334    gctgctgctgcagagctccgactc 357
              |||||||||||| |||||||||||
Sbjct: 106058 gctgctgctgcacagctccgactc 106081
to top
>emb|BX648159.1|HSM808306 Homo sapiens mRNA; cDNA DKFZp686I2132 (from clone DKFZp686I2132)
          Length = 6573

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 6129 gctgctgctgcacagctccgactc 6106
to top
>gb|AC154455.2| Mus musculus BAC clone RP23-185H13 from 14, complete sequence
          Length = 215308

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      tcacccaacaacaccaagca 23
              ||||||||||||||||||||
Sbjct: 125742 tcacccaacaacaccaagca 125761
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 96      attctccgtccgtcacgggc 115
               ||||||||||||||||||||
Sbjct: 4134240 attctccgtccgtcacgggc 4134259
to top
>gb|AY110012.1| Zea mays CL907_1 mRNA sequence
          Length = 2928

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 370 gctcaggctctcccttcagctcgtcagcgccaccgt 405
           ||||| ||||||| | ||||| ||||||||||||||
Sbjct: 354 gctcaagctctccatccagcttgtcagcgccaccgt 389
to top
>gb|AC114410.9| Mus musculus chromosome 14, clone RP23-151K8, complete sequence
          Length = 201783

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    agctgctgctgcagagctcc 352
              ||||||||||||||||||||
Sbjct: 117300 agctgctgctgcagagctcc 117281
to top
>gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map 3, complete sequence
          Length = 193174

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    caggagcactggagcaccgg 175
              ||||||||||||||||||||
Sbjct: 151111 caggagcactggagcaccgg 151092
to top
>gb|U11862.1|HSU11862 Human clone HP-DAO1 diamine oxidase, copper/topa quinone-containing
            mRNA, complete cds
          Length = 2441

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 2006 gctgctgctgcacagctccgactc 1983
to top
>emb|AL732404.7| Mouse DNA sequence from clone RP23-177D21 on chromosome 2, complete
            sequence
          Length = 220275

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 330  gcaagctgctgctgcagagctccg 353
            ||||||||||||||| ||||||||
Sbjct: 9886 gcaagctgctgctgctgagctccg 9909
to top
>emb|X78212.1|HSDAO H.sapiens diamine oxidase gene
          Length = 9903

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 334  gctgctgctgcagagctccgactc 357
            |||||||||||| |||||||||||
Sbjct: 8931 gctgctgctgcacagctccgactc 8908


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,937,879
Number of Sequences: 3902068
Number of extensions: 2937879
Number of successful extensions: 55207
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55096
Number of HSP's gapped (non-prelim): 111
length of query: 428
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 406
effective length of database: 17,147,199,772
effective search space: 6961763107432
effective search space used: 6961763107432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top