ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl38f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC079444.28| Mus musculus strain C57BL/6J chromosome 10 clone... 42 0.87
2gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone... 42 0.87
3gb|AF355886.1| uncultured archaeon 33-FL38A99 16S ribosomal RNA ... 40 3.5
4gb|AF030881.2| Takifugu rubripes sushi-ichi retrotransposon, com... 40 3.5
5dbj|AB095120.1| Uncultured archaeon gene for 16S rRNA, partial s... 40 3.5
6gb|AF108421.1|FRIGVH1 Fugu rubripes immunoglobulin heavy chain g... 40 3.5
7dbj|AB100884.1| Methanotorris formicicus rrn gene for small subu... 40 3.5
8gb|AF220345.1|AF220345 Archaeal str. vp183 16S ribosomal RNA gen... 40 3.5
9emb|AJ969479.1| Uncultured Methanococcus sp. partial 16S rRNA ge... 40 3.5
10emb|AJ969475.1| Uncultured Methanococcus sp. partial 16S rRNA ge... 40 3.5
11dbj|AB095167.1| Methanotorris sp. Mc-S-70 gene for 16S rRNA, par... 40 3.5
12dbj|AB095160.1| Methanocaldococcus sp. Mc-1-85 gene for 16S rRNA... 40 3.5

>gb|AC079444.28| Mus musculus strain C57BL/6J chromosome 10 clone rp23-395k5, complete
              sequence
          Length = 171451

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 246    atcacaaaaaggcatctagaa 266
              |||||||||||||||||||||
Sbjct: 134365 atcacaaaaaggcatctagaa 134385



to top

>gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone rp23-310n21, complete
             sequence
          Length = 216807

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 246   atcacaaaaaggcatctagaa 266
             |||||||||||||||||||||
Sbjct: 79810 atcacaaaaaggcatctagaa 79830



to top

>gb|AF355886.1| uncultured archaeon 33-FL38A99 16S ribosomal RNA gene, partial
           sequence
          Length = 676

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 72  cccatggcggacggctcagt 91



to top

>gb|AF030881.2| Takifugu rubripes sushi-ichi retrotransposon, complete sequence
          Length = 5645

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 113 gggcaaggggttcctccacc 132
           ||||||||||||||||||||
Sbjct: 942 gggcaaggggttcctccacc 961



to top

>dbj|AB095120.1| Uncultured archaeon gene for 16S rRNA, partial sequence,
           clone:pCIRA-J
          Length = 1050

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 51  cccatggcggacggctcagt 70



to top

>gb|AF108421.1|FRIGVH1 Fugu rubripes immunoglobulin heavy chain gene cluster, partial sequence
          Length = 40406

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   gggcaaggggttcctccacc 132
             ||||||||||||||||||||
Sbjct: 18646 gggcaaggggttcctccacc 18665



to top

>dbj|AB100884.1| Methanotorris formicicus rrn gene for small subunit ribosomal RNA,
           partial sequence
          Length = 1374

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 63  cccatggcggacggctcagt 82



to top

>gb|AF220345.1|AF220345 Archaeal str. vp183 16S ribosomal RNA gene, partial sequence
          Length = 834

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 48  cccatggcggacggctcagt 67



to top

>emb|AJ969479.1| Uncultured Methanococcus sp. partial 16S rRNA gene, clone ATOS
           Iris7 Rainbow 8A
          Length = 972

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 150 cccatggcggacggctcagt 169



to top

>emb|AJ969475.1| Uncultured Methanococcus sp. partial 16S rRNA gene, clone PICO pp37
           Rainbow 63A
          Length = 1411

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 45  cccatggcggacggctcagt 64



to top

>dbj|AB095167.1| Methanotorris sp. Mc-S-70 gene for 16S rRNA, partial sequence
          Length = 1171

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 51  cccatggcggacggctcagt 70



to top

>dbj|AB095160.1| Methanocaldococcus sp. Mc-1-85 gene for 16S rRNA, partial sequence
          Length = 968

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cccatggcggacggctcagt 204
           ||||||||||||||||||||
Sbjct: 49  cccatggcggacggctcagt 68


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,845,704
Number of Sequences: 3902068
Number of extensions: 1845704
Number of successful extensions: 34622
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34607
Number of HSP's gapped (non-prelim): 15
length of query: 266
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 244
effective length of database: 17,147,199,772
effective search space: 4183916744368
effective search space used: 4183916744368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top