Clone Name | bastl38b08 |
---|---|
Clone Library Name | barley_pub |
>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete sequence Length = 176646 Score = 42.1 bits (21), Expect = 0.88 Identities = 24/25 (96%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcaggt 230 ||||| ||||||||||||||||||| Sbjct: 135447 gcagcccaggatggccgcctcaggt 135471
>emb|AL596185.12| Mouse DNA sequence from clone RP23-172M21 on chromosome 11 Contains the 5' end of the Centb1 gene for centaurin beta 1, the gene for a novel protein similar to protein phosphatase 1 regulatory (inhibitor) subunit 2 Ppp1r2, a novel gene, the Gps2 gene for G protein pathway suppressor 2, the Eif5a gene for eukaryotic translation initiation factor 5A, the Ybx2 gene for Y box protein 2, the Slc2a4 gene for solute carrier family 2 (facilitated glucose transporter) member 4, a non-muscle cofilin 1 (Cfl1) pseudogene, the Cldn7 gene for claudin 7, the Rai12 gene for retinoic acid induced 12, the Dullard gene for Dullard homolog (Xenopus laevis) (novel NLI interacting factor-like phosphatase), the gene for novel PHD-finger protein JUNE1, the Dvl2 gene for dishevelled 2 dsh homolog (Drosophila), the Acadvl gene for acyl-Coenzyme A dehydrogenase very long chain, the Dlgh4 gene for discs large homolog 4 (Drosophila), the Asgr1 and Asgr2 genes for asialoglycoprotein receptor 1 and 2, a ribosomal protein L26 (Rpl26) pseudogene, the 5' end of the Mgl2 gene for macrophage galactose N-acetyl-galactosamine specific lectin 2 and nine CpG islands, complete sequence Length = 248203 Score = 42.1 bits (21), Expect = 0.88 Identities = 24/25 (96%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcaggt 230 ||||| ||||||||||||||||||| Sbjct: 142614 gcagcccaggatggccgcctcaggt 142638
>dbj|AP000907.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-708L7, complete sequence Length = 176273 Score = 42.1 bits (21), Expect = 0.88 Identities = 21/21 (100%) Strand = Plus / Plus Query: 161 ggtcaggggcaggggcagcgt 181 ||||||||||||||||||||| Sbjct: 161004 ggtcaggggcaggggcagcgt 161024
>dbj|AP002007.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-762O23, complete sequence Length = 168922 Score = 42.1 bits (21), Expect = 0.88 Identities = 21/21 (100%) Strand = Plus / Plus Query: 161 ggtcaggggcaggggcagcgt 181 ||||||||||||||||||||| Sbjct: 76483 ggtcaggggcaggggcagcgt 76503
>gb|AY207049.1|AY207048S2 Mus musculus postsynaptic density-95 gene, exons 2 through 8 and partial cds; alternatively spliced Length = 5804 Score = 42.1 bits (21), Expect = 0.88 Identities = 24/25 (96%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcaggt 230 ||||| ||||||||||||||||||| Sbjct: 4047 gcagcccaggatggccgcctcaggt 4071
>ref|NM_007864.1| Mus musculus discs, large homolog 4 (Drosophila) (Dlgh4), mRNA Length = 2338 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 370 gcagcccaggatggccgcctcagg 393
>ref|NM_019621.1| Rattus norvegicus discs, large homolog 4 (Drosophila) (Dlgh4), mRNA Length = 3083 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 370 gcagcccaggatggccgcctcagg 393
>gb|BC014807.1| Mus musculus discs, large homolog 4 (Drosophila), mRNA (cDNA clone MGC:25332 IMAGE:4501403), complete cds Length = 3076 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 364 gcagcccaggatggccgcctcagg 387
>gb|AY597281.1| Pseudomonas viridiflava strain ME3.1b pathogenicity island PAI-Region-2, partial sequence Length = 39776 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 tgccgcccagcggtcccagc 207 |||||||||||||||||||| Sbjct: 12471 tgccgcccagcggtcccagc 12452
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 ccagcggtcccagcagcgca 213 |||||||||||||||||||| Sbjct: 580878 ccagcggtcccagcagcgca 580897
>ref|XM_579440.1| PREDICTED: Rattus norvegicus hypothetical gene supported by NM_019621 (LOC497670), mRNA Length = 3070 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 370 gcagcccaggatggccgcctcagg 393
>emb|X66474.1|RNSAP90AM R.norvegicus mRNA for guanylate kinase Length = 2447 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 515 gcagcccaggatggccgcctcagg 538
>dbj|D50621.1|MUSPSD95SP Mus musculus mRNA for PSD-95/SAP90A, complete cds Length = 2338 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 370 gcagcccaggatggccgcctcagg 393
>gb|M96853.1|RATPSD95A Rat postsynaptic density protein (PSD-95), homologue of discs-large tumor supressor protein mRNA, complete cds Length = 3083 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 206 gcagcgcaggatggccgcctcagg 229 ||||| |||||||||||||||||| Sbjct: 370 gcagcccaggatggccgcctcagg 393 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 819,616 Number of Sequences: 3902068 Number of extensions: 819616 Number of successful extensions: 22977 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 22948 Number of HSP's gapped (non-prelim): 29 length of query: 269 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 247 effective length of database: 17,147,199,772 effective search space: 4235358343684 effective search space used: 4235358343684 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)