>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete
              sequence
          Length = 176646

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 206    gcagcgcaggatggccgcctcaggt 230
              ||||| |||||||||||||||||||
Sbjct: 135447 gcagcccaggatggccgcctcaggt 135471

>emb|AL596185.12| Mouse DNA sequence from clone RP23-172M21 on chromosome 11 Contains the
              5' end of the Centb1 gene for centaurin beta 1, the gene
              for a novel protein similar to protein phosphatase 1
              regulatory (inhibitor) subunit 2 Ppp1r2, a novel gene, the
              Gps2 gene for G protein pathway suppressor 2, the Eif5a
              gene for eukaryotic translation initiation factor 5A, the
              Ybx2 gene for Y box protein 2, the Slc2a4 gene for solute
              carrier family 2 (facilitated glucose transporter) member
              4, a non-muscle cofilin 1 (Cfl1) pseudogene, the Cldn7 gene
              for claudin 7, the Rai12 gene for retinoic acid induced 12,
              the Dullard gene for Dullard homolog (Xenopus laevis)
              (novel NLI interacting factor-like phosphatase), the gene
              for novel PHD-finger protein JUNE1, the Dvl2 gene for
              dishevelled 2 dsh homolog (Drosophila), the Acadvl gene for
              acyl-Coenzyme A dehydrogenase very long chain, the Dlgh4
              gene for discs large homolog 4 (Drosophila), the Asgr1 and
              Asgr2 genes for asialoglycoprotein receptor 1 and 2, a
              ribosomal protein L26 (Rpl26) pseudogene, the 5' end of the
              Mgl2 gene for macrophage galactose N-acetyl-galactosamine
              specific lectin 2 and nine CpG islands, complete sequence
          Length = 248203

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 206    gcagcgcaggatggccgcctcaggt 230
              ||||| |||||||||||||||||||
Sbjct: 142614 gcagcccaggatggccgcctcaggt 142638

>dbj|AP000907.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-708L7, complete
              sequence
          Length = 176273

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 161    ggtcaggggcaggggcagcgt 181
              |||||||||||||||||||||
Sbjct: 161004 ggtcaggggcaggggcagcgt 161024

>dbj|AP002007.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-762O23, complete
             sequence
          Length = 168922

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 161   ggtcaggggcaggggcagcgt 181
             |||||||||||||||||||||
Sbjct: 76483 ggtcaggggcaggggcagcgt 76503

>gb|AY207049.1|AY207048S2 Mus musculus postsynaptic density-95 gene, exons 2 through 8 and
            partial cds; alternatively spliced
          Length = 5804

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 206  gcagcgcaggatggccgcctcaggt 230
            ||||| |||||||||||||||||||
Sbjct: 4047 gcagcccaggatggccgcctcaggt 4071

>ref|NM_007864.1| Mus musculus discs, large homolog 4 (Drosophila) (Dlgh4), mRNA
          Length = 2338

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 370 gcagcccaggatggccgcctcagg 393

>ref|NM_019621.1| Rattus norvegicus discs, large homolog 4 (Drosophila) (Dlgh4), mRNA
          Length = 3083

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 370 gcagcccaggatggccgcctcagg 393

>gb|BC014807.1| Mus musculus discs, large homolog 4 (Drosophila), mRNA (cDNA clone
           MGC:25332 IMAGE:4501403), complete cds
          Length = 3076

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 364 gcagcccaggatggccgcctcagg 387

>gb|AY597281.1| Pseudomonas viridiflava strain ME3.1b pathogenicity island
             PAI-Region-2, partial sequence
          Length = 39776

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   tgccgcccagcggtcccagc 207
             ||||||||||||||||||||
Sbjct: 12471 tgccgcccagcggtcccagc 12452

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 194    ccagcggtcccagcagcgca 213
              ||||||||||||||||||||
Sbjct: 580878 ccagcggtcccagcagcgca 580897

>ref|XM_579440.1| PREDICTED: Rattus norvegicus hypothetical gene supported by
           NM_019621 (LOC497670), mRNA
          Length = 3070

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 370 gcagcccaggatggccgcctcagg 393

>emb|X66474.1|RNSAP90AM R.norvegicus mRNA for guanylate kinase
          Length = 2447

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 515 gcagcccaggatggccgcctcagg 538

>dbj|D50621.1|MUSPSD95SP Mus musculus mRNA for PSD-95/SAP90A, complete cds
          Length = 2338

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 370 gcagcccaggatggccgcctcagg 393

>gb|M96853.1|RATPSD95A Rat postsynaptic density protein (PSD-95), homologue of discs-large
           tumor supressor protein mRNA, complete cds
          Length = 3083

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 206 gcagcgcaggatggccgcctcagg 229
           ||||| ||||||||||||||||||
Sbjct: 370 gcagcccaggatggccgcctcagg 393


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 819,616
Number of Sequences: 3902068
Number of extensions: 819616
Number of successful extensions: 22977
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22948
Number of HSP's gapped (non-prelim): 29
length of query: 269
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 247
effective length of database: 17,147,199,772
effective search space: 4235358343684
effective search space used: 4235358343684
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)