ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl33d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
2dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
3ref|XM_790907.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.005
4ref|NM_105452.1| Arabidopsis thaliana ATP binding AT1G67840 tran... 48 0.018
5ref|NM_202372.1| Arabidopsis thaliana ATP binding AT1G67840 tran... 48 0.018
6gb|BC107439.1| Rattus norvegicus RAB2, member RAS oncogene famil... 48 0.018
7ref|NM_212547.1| Rattus norvegicus RAB2, member RAS oncogene fam... 48 0.018
8gb|AY049244.1| Arabidopsis thaliana At1g67840/F12A21_3 mRNA, com... 48 0.018
9emb|BX814127.1|CNS0ABZM Arabidopsis thaliana Full-length cDNA Co... 48 0.018
10gb|AC008113.4|AC008113 Genomic sequence for Arabidopsis thaliana... 48 0.018
11gb|AF115498.2| Xenopus laevis Smad1 antagonistic effector (SANE)... 46 0.071
12ref|NM_004761.2| Homo sapiens ral guanine nucleotide dissociatio... 46 0.071
13gb|AC117662.13| Mus musculus chromosome 16, clone RP23-351D19, c... 46 0.071
14ref|XM_499980.1| Yarrowia lipolytica CLIB122, YALI0A11407g predi... 46 0.071
15emb|Y14366.1|DMLIPASE1 Drosophila melanogaster mRNA for lipase 1 46 0.071
16emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone... 46 0.071
17gb|BC040989.1| Homo sapiens ral guanine nucleotide dissociation ... 46 0.071
18emb|AL050259.1|HSM800260 Homo sapiens mRNA; cDNA DKFZp564D0782 (... 46 0.071
19gb|BC032681.1| Homo sapiens ral guanine nucleotide dissociation ... 46 0.071
20dbj|AB218279.1| Gallus gallus NR5A2 gene for liver receptor homo... 46 0.071
21tpg|BK004062.1| TPA: TPA_inf: Gallus gallus RTN4-B2 (RTN4) mRNA,... 46 0.071
22tpg|BK004061.1| TPA: TPA_inf: Gallus gallus RTN4-B1 (RTN4) mRNA,... 46 0.071
23ref|NM_078816.2| Drosophila melanogaster Lipase 1 CG7279-RA (Lip... 46 0.071
24gb|AC159633.2| Mus musculus BAC clone RP24-159L15 from chromosom... 46 0.071
25gb|AC074229.53| Mus musculus strain C57BL/6J clone rp23-242n21 m... 46 0.071
26dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.071
27gb|AY075506.1| Drosophila melanogaster RE54405 full insert cDNA 46 0.071
28gb|AC007300.6|AC007300 Drosophila melanogaster, chromosome 2L, r... 46 0.071
29dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.071
30gb|AE003629.2| Drosophila melanogaster chromosome 2L, section 38... 46 0.071
31emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 46 0.071
32emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chr... 46 0.071
33gb|AC138221.23| Mus musculus chromosome 15, clone RP23-204C16, c... 46 0.071
34dbj|AB012295.1| Homo sapiens HKE1.5 mRNA for GDS-related protein... 46 0.071
35gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, co... 44 0.28
36gb|AC123726.11| Mus musculus chromosome 3, clone RP23-436F15, co... 44 0.28
37gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb... 44 0.28
38gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, comp... 44 0.28
39gb|AC102324.9| Mus musculus chromosome 1, clone RP24-476A18, com... 44 0.28
40gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, com... 44 0.28
41gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cance... 44 0.28
42gb|AC113013.15| Mus musculus chromosome 7, clone RP23-174K7, com... 44 0.28
43gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, co... 44 0.28
44gb|AC102616.7| Mus musculus chromosome 18, clone RP23-425L21, co... 44 0.28
45gb|BC085153.1| Mus musculus expressed sequence AI480556, mRNA (c... 44 0.28
46gb|BC109074.1| Homo sapiens death-associated protein 6, mRNA (cD... 44 0.28
47gb|BC109073.1| Homo sapiens death-associated protein 6, mRNA (cD... 44 0.28
48ref|NM_001036342.1| Arabidopsis thaliana catalytic/ ubiquitin-pr... 44 0.28
49ref|NM_128159.2| Arabidopsis thaliana catalytic/ ubiquitin-prote... 44 0.28
50gb|BC052920.1| Mus musculus cell division cycle 2-like 1, mRNA (... 44 0.28
51gb|BC051012.1| Mus musculus cell division cycle 2-like 1, mRNA (... 44 0.28
52gb|AC139218.10| Mus musculus chromosome 15, clone RP23-456O10, c... 44 0.28
53gb|AC093339.17| Mus musculus chromosome 19, clone RP23-5G6, comp... 44 0.28
54gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, com... 44 0.28
55gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, co... 44 0.28
56gb|AC110909.10| Mus musculus chromosome 7, clone RP24-186G5, com... 44 0.28
57gb|AC153727.6| Mus musculus BAC clone RP23-354L15 from chromosom... 44 0.28
58gb|AC120437.7| Mus musculus chromosome 5, clone RP24-571K14, com... 44 0.28
59gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 44 0.28
60ref|XM_632216.1| Dictyostelium discoideum hypothetical protein (... 44 0.28
61gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome... 44 0.28
62gb|AC165418.6| Mus musculus chromosome 7, clone RP23-148M16, com... 44 0.28
63gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, com... 44 0.28
64ref|XM_642008.1| Dictyostelium discoideum hypothetical protein (... 44 0.28
65gb|AC110512.13| Mus musculus chromosome 15, clone RP24-134E9, co... 44 0.28
66ref|XM_637292.1| Dictyostelium discoideum SMAD/FHA domain-contai... 44 0.28
67ref|XM_630260.1| Dictyostelium discoideum hypothetical protein (... 44 0.28
68ref|XM_634880.1| Dictyostelium discoideum hypothetical protein (... 44 0.28
69ref|XM_631434.1| Dictyostelium discoideum hypothetical protein (... 44 0.28
70gb|AC152418.5| Mus musculus BAC clone RP23-7L11 from chromosome ... 44 0.28
71gb|AC161119.3| Mus musculus BAC clone RP23-32J13 from chromosome... 44 0.28
72gb|AC163104.2| Mus musculus BAC clone RP23-332A4 from chromosome... 44 0.28
73gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome ... 44 0.28
74gb|AC165948.2| Mus musculus BAC clone RP24-430M9 from chromosome... 44 0.28
75gb|AC132617.4| Mus musculus BAC clone RP23-230A6 from chromosome... 44 0.28
76gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, com... 44 0.28
77gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, com... 44 0.28
78ref|XM_482656.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.28
79gb|DQ216074.1| Taeniopygia guttata clone 0058P0014G04 translocas... 44 0.28
80gb|DQ216073.1| Taeniopygia guttata clone 0063P0009F01 translocas... 44 0.28
81gb|DQ216072.1| Taeniopygia guttata clone 0058P0002C04 translocas... 44 0.28
82gb|DQ216070.1| Taeniopygia guttata clone 0058P0022G10 translocas... 44 0.28
83gb|DQ216069.1| Taeniopygia guttata clone 0063P0013D08 translocas... 44 0.28
84ref|XM_464318.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.28
85gb|DQ022604.1| Zea mays subsp. huehuetenangensis cultivar CIMMYT... 44 0.28
86gb|DQ022600.1| Zea mays subsp. mexicana cultivar CIMMYT_8771 Opa... 44 0.28
87gb|DQ022589.1| Zea mays cultivar mays Coest6 Opaque-2 (O2) gene,... 44 0.28
88gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 44 0.28
89gb|AC163325.7| Mus musculus chromosome 1, clone RP23-76L21, comp... 44 0.28
90gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, com... 44 0.28
91gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, com... 44 0.28
92ref|XM_470393.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.28
93gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Ca... 44 0.28
94gb|AC105948.9| Mus musculus chromosome 8, clone RP24-96N12, comp... 44 0.28
95gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 44 0.28
96gb|BT019628.1| Synthetic construct Homo sapiens troponin T1, ske... 44 0.28
97gb|AC102220.8| Mus musculus chromosome 7, clone RP24-117E17, com... 44 0.28
98gb|AC102410.5| Mus musculus chromosome 18, clone RP24-369O1, com... 44 0.28
99gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 44 0.28
100gb|AC112997.10| Mus musculus chromosome 8, clone RP24-484I6, com... 44 0.28
101gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, c... 44 0.28
102gb|AC104743.28| Mus musculus chromosome 6, clone RP23-27D8, comp... 44 0.28
103gb|AC162169.4| Mus musculus chromosome 1, clone RP24-268D20, com... 44 0.28
104gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 44 0.28
105gb|AE001393.1| Plasmodium falciparum 3D7 chromosome 2 section 30... 44 0.28
106gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section ... 44 0.28
107gb|AF393505.1| Mus musculus potential meiotic DNA repair locus 44 0.28
108gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 44 0.28
109gb|L08135.1|PFAPS230X Plasmodium falciparum transmission blockin... 44 0.28
110gb|L22219.1|PFAPFS230A Plasmodium falciparum transmission-blocki... 44 0.28
111gb|AC004632.1| Homo sapiens chromosome 5, BAC clone 18f2 (LBNL H... 44 0.28
112gb|AC104488.4| Trypanosoma brucei chromosome 5 clone RPCI93-26K5... 44 0.28
113gb|AC111097.10| Mus musculus chromosome 3, clone RP23-174G7, com... 44 0.28
114gb|BT015905.1| Arabidopsis thaliana At2g26000 gene, complete cds 44 0.28
115gb|AC138210.10| Mus musculus chromosome 1, clone RP23-346B12, co... 44 0.28
116gb|AC102017.15| Mus musculus chromosome 5, clone RP24-571N6, com... 44 0.28
117gb|AC102873.10| Mus musculus chromosome 17, clone RP24-536C15, c... 44 0.28
118gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 44 0.28
119gb|AC116781.9| Mus musculus chromosome 16, clone RP24-134G20, co... 44 0.28
120gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, c... 44 0.28
121gb|AC158114.7| Mus musculus chromosome 5, clone RP23-371A16, com... 44 0.28
122gb|AC160136.2| Mus musculus BAC clone RP23-125E11 from chromosom... 44 0.28
123gb|AC159817.2| Mus musculus BAC clone RP23-228E8 from chromosome... 44 0.28
124gb|AC161050.2| Mus musculus BAC clone RP23-477C12 from chromosom... 44 0.28
125gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosom... 44 0.28
126gb|AC161226.7| Mus musculus chromosome 3, clone RP23-298B8, comp... 44 0.28
127gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome... 44 0.28
128gb|AC102354.14| Mus musculus chromosome 17, clone RP23-80J17, co... 44 0.28
129gb|AC079357.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.28
130gb|BC077321.1| Xenopus laevis MGC80275 protein, mRNA (cDNA clone... 44 0.28
131gb|AC115724.10| Mus musculus chromosome 3, clone RP23-20L18, com... 44 0.28
132gb|AC133608.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.28
133gb|AC151468.2| Xenopus tropicalis BAC clone ISB-42G17 containing... 44 0.28
134gb|AC119190.7| Mus musculus chromosome 8, clone RP24-178B9, comp... 44 0.28
135gb|AC123597.9| Mus musculus chromosome 8, clone RP23-134A7, comp... 44 0.28
136gb|AC163333.6| Mus musculus chromosome 1, clone RP24-98O21, comp... 44 0.28
137gb|AC159376.12| Mus musculus 10 BAC RP23-114N21 (Roswell Park Ca... 44 0.28
138gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, comp... 44 0.28
139gb|AC135569.6| Oryza sativa (japonica cultivar-group) chromosome... 44 0.28
140gb|AC148086.6| Mus musculus chromosome 17, clone RP24-147C6, com... 44 0.28
141ref|XM_874456.1| PREDICTED: Bos taurus hypothetical protein LOC6... 44 0.28
142gb|AC118628.11| Mus musculus chromosome 19, clone RP24-92P15, co... 44 0.28
143gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's ... 44 0.28
144gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 44 0.28
145gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's ... 44 0.28
146gb|AC120237.5| Rattus norvegicus 1 BAC CH230-453N3 (Children's H... 44 0.28
147gb|AC116075.5| Rattus norvegicus 6 BAC CH230-139H23 (Children's ... 44 0.28
148gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's H... 44 0.28
149gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 44 0.28
150gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's ... 44 0.28
151gb|AC120877.15| Mus musculus chromosome 6, clone RP24-548D19, co... 44 0.28
152gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, co... 44 0.28
153gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence 44 0.28
154gb|AY519474.1| Xenopus laevis aristaless-related homeobox 2 (Arx... 44 0.28
155gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, comp... 44 0.28
156ref|XM_615480.2| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
157ref|XM_880839.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
158ref|XM_880818.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
159ref|XM_880799.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
160ref|XM_880782.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
161ref|XM_880765.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
162ref|XM_880749.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
163ref|XM_880727.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
164ref|XM_867653.1| PREDICTED: Bos taurus similar to Histone acetyl... 44 0.28
165ref|XM_879800.1| PREDICTED: Bos taurus hypothetical protein LOC6... 44 0.28
166ref|XM_591851.2| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
167ref|XM_882445.1| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
168ref|XM_882432.1| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
169ref|XM_882425.1| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
170ref|XM_882418.1| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
171ref|XM_869170.1| PREDICTED: Bos taurus similar to HLA-B associat... 44 0.28
172ref|XM_369127.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 44 0.28
173ref|XM_421438.1| PREDICTED: Gallus gallus similar to RIKEN cDNA ... 44 0.28
174ref|XM_418829.1| PREDICTED: Gallus gallus similar to MLN64 N-ter... 44 0.28
175gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, com... 44 0.28
176gb|AC121500.6| Mus musculus chromosome 5, clone RP23-471H10, com... 44 0.28
177gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 44 0.28
178gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, co... 44 0.28
179gb|BC075691.1| Mus musculus apoptotic chromatin condensation ind... 44 0.28
180gb|AC137969.9| Mus musculus chromosome 7, clone RP23-267N11, com... 44 0.28
181gb|AC133156.7| Mus musculus chromosome 15, clone RP24-291M22, co... 44 0.28
182gb|BT015082.1| Arabidopsis thaliana At2g26000 gene, complete cds 44 0.28
183gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map q... 44 0.28
184gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map q... 44 0.28
185gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map q... 44 0.28
186gb|AC142211.3| Mus musculus BAC clone RP24-501B23 from chromosom... 44 0.28
187gb|AC147225.3| Mus musculus BAC clone RP23-105L19 from chromosom... 44 0.28
188gb|AC147992.3| Mus musculus BAC clone RP24-384K8 from chromosome... 44 0.28
189gb|AC130528.4| Mus musculus BAC clone RP23-122M14 from chromosom... 44 0.28
190gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosom... 44 0.28
191gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome... 44 0.28
192gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 44 0.28
193gb|AC142145.3| Mus musculus BAC clone RP24-69D13 from chromosome... 44 0.28
194gb|AC129593.4| Mus musculus BAC clone RP24-142E6 from chromosome... 44 0.28
195gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosom... 44 0.28
196gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosom... 44 0.28
197gb|AC145554.2| Mus musculus BAC clone RP23-217E22 from chromosom... 44 0.28
198gb|BC058412.1| Mus musculus serine/threonine kinase 32B, mRNA (c... 44 0.28
199gb|AC091309.13| Mus musculus chromosome 17, clone RP23-127L4, co... 44 0.28
200gb|AC109627.8| Mus musculus chromosome 16, clone RP24-226M22, co... 44 0.28
201gb|BC056396.1| Mus musculus serine/threonine kinase 32B, mRNA (c... 44 0.28
202gb|BC052404.1| Mus musculus serine/threonine kinase 32B, mRNA (c... 44 0.28
203ref|XM_322409.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.28
204ref|XM_952702.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.28
205gb|AC116516.7| Mus musculus chromosome 1, clone RP24-336H7, comp... 44 0.28
206gb|AC100212.8| Mus musculus chromosome 18, clone RP23-60D22, com... 44 0.28
207gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 44 0.28
208ref|XM_581028.2| PREDICTED: Bos taurus similar to cyclin I, tran... 44 0.28
209ref|XM_873106.1| PREDICTED: Bos taurus similar to cyclin I, tran... 44 0.28
210ref|XM_864393.1| PREDICTED: Bos taurus similar to cyclin I, tran... 44 0.28
211ref|XM_872917.1| PREDICTED: Bos taurus similar to cyclin I, tran... 44 0.28
212gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, comp... 44 0.28
213gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, co... 44 0.28
214gb|AC168278.2| Mus musculus BAC RP24-83C9 (Roswell Park Cancer ... 44 0.28
215ref|NM_182996.2| Mus musculus zinc finger protein 692 (Zfp692), ... 44 0.28
216gb|AC140331.2| Mus musculus BAC clone RP23-406J20 from chromosom... 44 0.28
217gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome... 44 0.28
218gb|AC140478.2| Mus musculus BAC clone RP24-149A3 from chromosome... 44 0.28
219gb|AC100730.8| Mus musculus chromosome 15, clone RP24-288B1, com... 44 0.28
220ref|NM_001030661.1| Gallus gallus SET domain containing 1B (SETD... 44 0.28
221gb|AC149133.1| Pan troglodytes chromosome X clone RP43-010O16 ma... 44 0.28
222gb|AC108947.5| Mus musculus BAC clone RP23-140A11 from chromosom... 44 0.28
223gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome... 44 0.28
224gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome... 44 0.28
225gb|AC144794.2| Mus musculus BAC clone RP24-463B6 from chromosome... 44 0.28
226gb|AC134826.4| Mus musculus BAC clone RP24-459P6 from chromosome... 44 0.28
227gb|AC147369.3| Mus musculus BAC clone RP24-392B5 from chromosome... 44 0.28
228gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosom... 44 0.28
229ref|NM_022416.1| Mus musculus serine/threonine kinase 32B (Stk32... 44 0.28
230ref|NM_001040391.1| Danio rerio zgc:136898 (zgc:136898), mRNA 44 0.28
231ref|XM_652943.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 0.28
232gb|AC157901.4| Mus musculus chromosome 18, clone RP23-189P21, co... 44 0.28
233gb|AC183831.2| Pan troglodytes BAC clone CH251-280E18 from chrom... 44 0.28
234ref|NM_014424.3| Homo sapiens heat shock 27kDa protein family, m... 44 0.28
235gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, comp... 44 0.28
236gb|AC161000.5| Mus musculus BAC clone RP23-51A9 from chromosome ... 44 0.28
237gb|AC138737.10| Mus musculus chromosome 5, clone RP23-307F20, co... 44 0.28
238gb|AC024914.48| Mus musculus BAC Clone 262c6 RPCI-23, complete s... 44 0.28
239gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's ... 44 0.28
240gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, c... 44 0.28
241gb|AC121533.6| Mus musculus chromosome 9, clone RP24-555P22, com... 44 0.28
242gb|AC023174.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.28
243gb|AC112675.12| Mus musculus chromosome 1, clone RP23-138J12, co... 44 0.28
244gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.28
245gb|AC163393.6| Mus musculus chromosome 15, clone RP24-224P8, com... 44 0.28
246gb|AC166178.10| Mus musculus 6 BAC RP24-414G20 (Roswell Park Can... 44 0.28
247ref|NM_001017842.1| Danio rerio zgc:110175 (zgc:110175), mRNA 44 0.28
248gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome... 44 0.28
249gb|AC163346.3| Mus musculus BAC clone RP23-370A2 from chromosome... 44 0.28
250gb|AC164637.3| Mus musculus BAC clone RP23-128I20 from chromosom... 44 0.28
251gb|AC159829.10| Mus musculus 10 BAC RP23-269H11 (Roswell Park Ca... 44 0.28
252gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 44 0.28
253gb|AC137871.18| Mus musculus chromosome 15, clone RP23-41B9, com... 44 0.28
254gb|AC158527.2| Mus musculus BAC clone RP23-266E16 from chromosom... 44 0.28
255gb|AC122541.3| Mus musculus BAC clone RP24-567D4 from chromosome... 44 0.28
256gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome... 44 0.28
257ref|XR_002668.1| PREDICTED: Mus musculus hypothetical protein LO... 44 0.28
258ref|XM_892831.1| PREDICTED: Mus musculus similar to protein phos... 44 0.28
259ref|XR_002282.1| PREDICTED: Mus musculus hypothetical protein LO... 44 0.28
260ref|XR_002924.1| PREDICTED: Mus musculus similar to High mobilit... 44 0.28
261gb|AC010976.6| Homo sapiens BAC clone RP11-286H15 from 2, comple... 44 0.28
262gb|AC112794.4| Mus musculus chromosome 12 clone RP24-121O24, com... 44 0.28
263gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome ... 44 0.28
264gb|AC146618.2| Mus musculus BAC clone RP23-5P3 from chromosome 1... 44 0.28
265gb|AC124604.4| Mus musculus BAC clone RP23-81K14 from chromosome... 44 0.28
266gb|AC123554.3| Mus musculus BAC clone RP23-135A9 from chromosome... 44 0.28
267gb|AC140347.3| Mus musculus BAC clone RP23-233K3 from chromosome... 44 0.28
268gb|AC124348.5| Mus musculus BAC clone RP24-462O9 from chromosome... 44 0.28
269gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome... 44 0.28
270gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome... 44 0.28
271gb|BC060405.1| Xenopus laevis hypothetical protein MGC68575, mRN... 44 0.28
272gb|AC102087.12| Mus musculus chromosome 13, clone RP23-166D15, c... 44 0.28
273gb|AC092852.6| Oryza sativa chromosome 3 BAC OSJNBa0032G11 genom... 44 0.28
274gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, comp... 44 0.28
275gb|AC115039.7| Mus musculus chromosome 6, clone RP24-279C2, comp... 44 0.28
276gb|AC111117.15| Mus musculus chromosome 1, clone RP23-214P23, co... 44 0.28
277ref|XR_003410.1| PREDICTED: Mus musculus hypothetical protein LO... 44 0.28
278gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's... 44 0.28
279gb|AC120922.4| Rattus norvegicus 9 BAC CH230-104J1 (Children's H... 44 0.28
280gb|AC117058.19| Rattus norvegicus 16 BAC CH230-318I9 (Children's... 44 0.28
281ref|XM_987851.1| PREDICTED: Mus musculus protein phosphatase 1, ... 44 0.28
282gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosom... 44 0.28
283gb|AC123950.3| Mus musculus BAC clone RP23-162I9 from chromosome... 44 0.28
284gb|AC147101.2| Mus musculus BAC clone RP23-455H16 from chromosom... 44 0.28
285gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosom... 44 0.28
286gb|AC134447.2| Mus musculus BAC clone RP24-186D1 from chromosome... 44 0.28
287gb|AC132340.3| Mus musculus BAC clone RP24-166O10 from chromosom... 44 0.28
288gb|AC132358.3| Mus musculus BAC clone RP24-133O24 from chromosom... 44 0.28
289gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosom... 44 0.28
290gb|AC132582.3| Mus musculus BAC clone RP24-319N10 from chromosom... 44 0.28
291gb|AC136023.5| Mus musculus BAC clone RP24-501J4 from chromosome... 44 0.28
292gb|AC140245.3| Mus musculus BAC clone RP23-293J3 from chromosome... 44 0.28
293gb|BC023628.2| Homo sapiens serine arginine-rich pre-mRNA splici... 44 0.28
294ref|XM_820429.1| Trypanosoma brucei TREU927 clone RPCI93-26K5 hy... 44 0.28
295emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 44 0.28
296emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chro... 44 0.28
297ref|XM_747906.1| Aspergillus fumigatus Af293 hypothetical protei... 44 0.28
298emb|BX649356.19| Zebrafish DNA sequence from clone CH211-209H5 i... 44 0.28
299emb|CR956650.4| Pig DNA sequence from clone CH242-171I16 on chro... 44 0.28
300gb|AC113203.10| Mus musculus chromosome 5, clone RP23-276C23, co... 44 0.28
301gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, co... 44 0.28
302gb|AC124432.5| Mus musculus BAC clone RP24-243L15 from chromosom... 44 0.28
303gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome ... 44 0.28
304gb|AC135081.3| Mus musculus BAC clone RP24-131A24 from chromosom... 44 0.28
305gb|AC126257.4| Mus musculus BAC clone RP24-247A8 from chromosome... 44 0.28
306gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosom... 44 0.28
307gb|AC126668.3| Mus musculus BAC clone RP24-370N20 from chromosom... 44 0.28
308gb|AC122050.3| Mus musculus BAC clone RP24-457L7 from chromosome... 44 0.28
309ref|XM_532084.2| PREDICTED: Canis familiaris similar to HLA-B as... 44 0.28
310gb|AC129019.4| Mus musculus BAC clone RP24-541L1 from chromosome... 44 0.28
311gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome... 44 0.28
312gb|AC127586.4| Mus musculus BAC clone RP24-142A16 from chromosom... 44 0.28
313gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome... 44 0.28
314gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome... 44 0.28
315gb|AC132141.3| Mus musculus BAC clone RP23-55P19 from chromosome... 44 0.28
316gb|AC122889.3| Mus musculus BAC clone RP23-93M3 from chromosome ... 44 0.28
317gb|AC126940.4| Mus musculus BAC clone RP23-77E4 from chromosome ... 44 0.28
318gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome... 44 0.28
319gb|AC133646.4| Mus musculus BAC clone RP23-254F11 from chromosom... 44 0.28
320gb|AC127324.4| Mus musculus BAC clone RP23-244I2 from chromosome... 44 0.28
321gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome... 44 0.28
322gb|AC122334.4| Mus musculus BAC clone RP23-349H2 from chromosome... 44 0.28
323gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosom... 44 0.28
324gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosom... 44 0.28
325gb|AC132413.3| Mus musculus BAC clone RP23-375I11 from chromosom... 44 0.28
326gb|AC132455.3| Mus musculus BAC clone RP23-129K10 from chromosom... 44 0.28
327gb|AC110234.11| Mus musculus chromosome 5, clone RP23-76J15, com... 44 0.28
328gb|BC043138.1| Mus musculus expressed sequence AI480556, mRNA (c... 44 0.28
329gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, com... 44 0.28
330gb|AC125397.5| Mus musculus BAC clone RP24-206J16 from chromosom... 44 0.28
331gb|AC126256.4| Mus musculus BAC clone RP24-235B15 from chromosom... 44 0.28
332gb|AC125112.3| Mus musculus BAC clone RP24-239I23 from chromosom... 44 0.28
333gb|AC116596.3| Mus musculus BAC clone RP24-335P21 from chromosom... 44 0.28
334gb|AC122470.3| Mus musculus BAC clone RP24-320O6 from chromosome... 44 0.28
335gb|AC116597.3| Mus musculus BAC clone RP24-409C23 from chromosom... 44 0.28
336ref|XM_844535.1| PREDICTED: Canis familiaris similar to Huntingt... 44 0.28
337gb|AC124384.4| Mus musculus BAC clone RP24-413G2 from chromosome... 44 0.28
338gb|AC129291.4| Mus musculus BAC clone RP24-491O22 from chromosom... 44 0.28
339gb|AC087329.10| Mus Musculus Strain C57BL6/J chromosome 5 BAC, R... 44 0.28
340gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosom... 44 0.28
341gb|AC124413.2| Mus musculus BAC clone RP24-280K5 from chromosome... 44 0.28
342gb|AC121973.2| Mus musculus BAC clone RP24-276I10 from chromosom... 44 0.28
343emb|BX950201.12| Zebrafish DNA sequence from clone CH211-101L11 ... 44 0.28
344ref|XM_812379.1| Trypanosoma cruzi strain CL Brener O-6 methyl-g... 44 0.28
345gb|AC125351.3| Mus musculus BAC clone RP23-442M3 from chromosome... 44 0.28
346gb|AC121798.3| Mus musculus BAC clone RP23-426H21 from chromosom... 44 0.28
347gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosom... 44 0.28
348gb|AC121908.3| Mus musculus BAC clone RP24-176J10 from chromosom... 44 0.28
349gb|AC124722.3| Mus musculus BAC clone RP23-389E7 from chromosome... 44 0.28
350gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 44 0.28
351gb|AC124741.5| Mus musculus BAC clone RP23-357D17 from chromosom... 44 0.28
352gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete... 44 0.28
353gb|AC117197.3| Mus musculus BAC clone RP23-127A21 from 16, compl... 44 0.28
354gb|AC113998.5| Mus musculus BAC clone RP23-137C20 from 13, compl... 44 0.28
355gb|AC112147.5| Mus musculus BAC clone RP23-175E16 from 9, comple... 44 0.28
356gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.28
357gb|AC079938.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.28
358gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 44 0.28
359gb|AC124551.4| Mus musculus BAC clone RP23-217K11 from 16, compl... 44 0.28
360gb|AC121566.3| Mus musculus BAC clone RP23-225D10 from 1, comple... 44 0.28
361gb|AC124187.3| Mus musculus BAC clone RP23-237I24 from 18, compl... 44 0.28
362gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, comple... 44 0.28
363gb|AC126273.3| Mus musculus BAC clone RP23-99P15 from 7, complet... 44 0.28
364gb|AC116575.4| Mus musculus BAC clone RP23-263I24 from 9, comple... 44 0.28
365gb|AC124549.5| Mus musculus BAC clone RP23-284E24 from 13, compl... 44 0.28
366gb|AC132684.3| Mus musculus BAC clone RP23-277L20 from 9, comple... 44 0.28
367gb|AC127311.3| Mus musculus BAC clone RP23-301C7 from 6, complet... 44 0.28
368gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complet... 44 0.28
369gb|AC121603.4| Mus musculus BAC clone RP23-310D9 from 18, comple... 44 0.28
370gb|AC126457.3| Mus musculus BAC clone RP23-68E6 from 16, complet... 44 0.28
371gb|AC098717.3| Mus musculus BAC clone RP23-2G2 from 12, complete... 44 0.28
372gb|AC117192.3| Mus musculus BAC clone RP23-77A18 from 2, complet... 44 0.28
373gb|AC122843.2| Mus musculus BAC clone RP23-149L20 from 6, comple... 44 0.28
374gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, comple... 44 0.28
375gb|AC121900.2| Mus musculus BAC clone RP24-167E15 from 7, comple... 44 0.28
376gb|AC121886.2| Mus musculus BAC clone RP24-141K3 from 18, comple... 44 0.28
377gb|AC121949.3| Mus musculus BAC clone RP24-215I11 from 18, compl... 44 0.28
378gb|AC121945.2| Mus musculus BAC clone RP24-211I4 from 17, comple... 44 0.28
379gb|AC115305.4| Mus musculus BAC clone RP24-372L1 from 18, comple... 44 0.28
380gb|AC098732.3| Mus musculus BAC clone RP23-3L20 from 3, complete... 44 0.28
381gb|AC098737.3| Mus musculus BAC clone RP23-122D16 from 1, comple... 44 0.28
382emb|CR717329.2|CNS0GGFR Tetraodon nigroviridis full-length cDNA 44 0.28
383emb|CR717308.2|CNS0GGF6 Tetraodon nigroviridis full-length cDNA 44 0.28
384gb|AC099593.6| Mus musculus chromosome 10, clone RP23-447D24, co... 44 0.28
385emb|CR714524.2|CNS0GEA0 Tetraodon nigroviridis full-length cDNA 44 0.28
386emb|CR709214.2|CNS0GA6I Tetraodon nigroviridis full-length cDNA 44 0.28
387gb|AC114995.7| Mus musculus chromosome 8, clone RP23-171P5, comp... 44 0.28
388gb|AC004965.2| Homo sapiens PAC clone RP5-1106H14 from 7, comple... 44 0.28
389gb|AC104889.10| Mus musculus chromosome 5, clone RP23-201D22, co... 44 0.28
390gb|BC053281.1| Danio rerio cellular myelocytomatosis oncogene, m... 44 0.28
391gb|BC055701.1| Mus musculus RIKEN cDNA A330102K23 gene, mRNA (cD... 44 0.28
392ref|XM_739696.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.28
393gb|AC108812.9| Mus musculus chromosome 18, clone RP23-417M2, com... 44 0.28
394gb|AC115768.9| Mus musculus chromosome 19, clone RP23-107E10, co... 44 0.28
395gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, com... 44 0.28
396gb|AC102663.6| Mus musculus chromosome 6, clone RP23-244M15, com... 44 0.28
397ref|XM_673497.1| Plasmodium berghei strain ANKA hypothetical pro... 44 0.28
398gb|AC110919.10| Mus musculus chromosome 15, clone RP23-216B8, co... 44 0.28
399gb|AC023248.20| Mus musculus chromosome 7, clone RP23-124B2, com... 44 0.28
400gb|AC111087.9| Mus musculus chromosome 9, clone RP23-152O16, com... 44 0.28
401gb|AC166831.3| Mus musculus BAC clone RP23-270P14 from chromosom... 44 0.28
402gb|AC113299.14| Mus musculus chromosome 5, clone RP23-429P17, co... 44 0.28
403gb|AC158750.5| Mus musculus chromosome 15, clone RP24-222C16, co... 44 0.28
404gb|AC110245.10| Mus musculus chromosome 3, clone RP23-251B16, co... 44 0.28
405gb|AC154171.5| Mus musculus BAC clone RP24-259F16 from chromosom... 44 0.28
406gb|AC113043.7| Mus musculus chromosome 1, clone RP23-243C7, comp... 44 0.28
407gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, compl... 44 0.28
408gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, comp... 44 0.28
409gb|AC090530.3| Homo sapiens chromosome 1 clone RP11-416G1, compl... 44 0.28
410gb|BC054818.1| Mus musculus expressed sequence AI480556, mRNA (c... 44 0.28
411gb|AC162919.5| Mus musculus BAC clone RP23-365O8 from chromosome... 44 0.28
412gb|AC127172.13| Mus musculus strain C57BL/6J clone rp23-387d2 ma... 44 0.28
413gb|AC161761.3| Mus musculus BAC clone RP23-379E17 from chromosom... 44 0.28
414gb|AC166654.1| Mus musculus BAC clone RP23-426B21 from chromosom... 44 0.28
415gb|AC161876.3| Mus musculus BAC clone RP24-388H6 from chromosome... 44 0.28
416gb|AY829803.1| Lonomia obliqua troponin I 1 mRNA, complete cds 44 0.28
417gb|AC157595.4| Mus musculus BAC clone RP23-238F18 from chromosom... 44 0.28
418gb|AY312169.1| Zea mays homeobox transcription factor KNOTTED1 (... 44 0.28
419gb|AC165444.2| Mus musculus BAC clone CH25-441A19 from chromosom... 44 0.28
420gb|AC095563.7| Rattus norvegicus 9 BAC CH230-7G11 (Children's Ho... 44 0.28
421gb|AF026000.2| Sus scrofa calcium-activated potassium channel al... 44 0.28
422ref|NM_001350.3| Homo sapiens death-associated protein 6 (DAXX),... 44 0.28
423gb|BC023744.1| Mus musculus cDNA sequence BC023744, mRNA (cDNA c... 44 0.28
424emb|AL844222.19| Mouse DNA sequence from clone RP23-44P13 on chr... 44 0.28
425gb|BC115319.1| Danio rerio cDNA clone MGC:136898 IMAGE:7992371, ... 44 0.28
426gb|BC073776.1| Homo sapiens cDNA clone IMAGE:2988484, containing... 44 0.28
427emb|Z84476.7|HS25J6 Human DNA sequence from clone RP1-25J6 on ch... 44 0.28
428emb|BX248088.18| Human DNA sequence from clone DAQB-126H3 on chr... 44 0.28
429emb|Z97183.1|HSICB2046 Human DNA sequence from clone ICRF6c-CB20... 44 0.28
430emb|Z97184.1|HSF0811 Human DNA sequence from clone ICRF6c-CF0811... 44 0.28
431emb|Z85999.1|HS94G16 Human DNA sequence from clone RP1-94G16 on ... 44 0.28
432emb|BX005144.14| Human DNA sequence from clone DASS-125F11 on ch... 44 0.28
433emb|BX000343.5| Human DNA sequence from clone DAQB-193B15 on chr... 44 0.28
434emb|BX255924.4| Human DNA sequence from clone RP11-541I19 on chr... 44 0.28
435emb|AL662871.9| Human DNA sequence from clone XXbac-322C17 on ch... 44 0.28
436gb|BC099231.1| Rattus norvegicus similar to CG8312-PA, mRNA (cDN... 44 0.28
437emb|AL662820.6| Human DNA sequence from clone XXbac-185D15 on ch... 44 0.28
438emb|AL662859.5| Human DNA sequence from clone XXbac-196D17 on ch... 44 0.28
439emb|AL662865.4| Human DNA sequence from clone XXbac-216M5 on chr... 44 0.28
440emb|AL662827.3| Human DNA sequence from clone XXbac-165D10 on ch... 44 0.28
441emb|AL592045.28| Human DNA sequence from clone RP11-275I14 on ch... 44 0.28
442gb|AC119163.23| Mus musculus chromosome 3, clone RP24-527P22, co... 44 0.28
443ref|XM_793051.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
444ref|XM_793038.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
445emb|AL445068.6| Human DNA sequence from clone RP1-71D21 on chrom... 44 0.28
446emb|AL359764.18| Human DNA sequence from clone RP11-527D7 on chr... 44 0.28
447emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch... 44 0.28
448emb|AL353093.18| Human DNA sequence from clone RP11-224P11 on ch... 44 0.28
449ref|XM_793246.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
450gb|AC095390.9| Rattus norvegicus 12 BAC CH230-7C24 (Children's H... 44 0.28
451emb|AL353641.9| Human DNA sequence from clone RP11-142P12 on chr... 44 0.28
452emb|AL159163.40| Human DNA sequence from clone RP11-514O12 on ch... 44 0.28
453emb|AL162456.14| Human DNA sequence from clone RP11-95C14 on chr... 44 0.28
454emb|AL136167.8| Human DNA sequence from clone RP1-299I16 on chro... 44 0.28
455gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence 44 0.28
456emb|AL136967.5| Human DNA sequence from clone RP1-149M18 on chro... 44 0.28
457gb|AC164104.5| Mus musculus BAC clone RP23-428G7 from chromosome... 44 0.28
458gb|AC160632.5| Mus musculus chromosome 8, clone RP24-319F9, comp... 44 0.28
459gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, com... 44 0.28
460gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hos... 44 0.28
461gb|AC160464.3| Mus musculus chromosome 7, clone RP23-256J14, com... 44 0.28
462gb|AC097745.8| Rattus norvegicus 3 BAC CH230-11N5 (Children's Ho... 44 0.28
463ref|XM_785686.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
464ref|XM_775590.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
465emb|CR936965.7| Human DNA sequence from clone DAMA-219M18 on chr... 44 0.28
466ref|NM_001025506.1| Danio rerio adiponectin receptor 2 (adipor2)... 44 0.28
467ref|XM_776154.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
468ref|XM_784939.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
469gb|AC105600.5| Rattus norvegicus 4 BAC CH230-209E1 (Children's H... 44 0.28
470ref|XM_776637.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
471emb|X69816.1|RNP450AA R.norvegicus CYP17 gene 44 0.28
472ref|XM_779868.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.28
473gb|AY043249.1| Heterodera glycines putative ABC transporter prot... 44 0.28
474emb|CR392356.5| Mouse DNA sequence from clone RP23-329D21 on chr... 44 0.28
475emb|BX842608.1|OSJN00298 Oryza sativa genomic DNA, chromosome 4,... 44 0.28
476emb|BX883052.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.28
477emb|BX883051.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.28
478emb|BX883042.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.28
479gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosom... 44 0.28
480gb|AC162180.2| Mus musculus BAC clone RP23-126K16 from chromosom... 44 0.28
481gb|AC159277.3| Mus musculus BAC clone RP23-356J2 from chromosome... 44 0.28
482gb|AC160391.2| Mus musculus BAC clone RP24-235G7 from chromosome... 44 0.28
483gb|AC153511.4| Mus musculus 10 BAC RP23-102N12 (Roswell Park Can... 44 0.28
484gb|AC159230.2| Mus musculus BAC clone RP24-378I19 from chromosom... 44 0.28
485emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on ch... 44 0.28
486emb|AL645599.14| Mouse DNA sequence from clone RP23-285F4 on chr... 44 0.28
487emb|AL645522.12| Mouse DNA sequence from clone RP23-64E17 on chr... 44 0.28
488emb|AL662964.3|OSJN00161 Oryza sativa genomic DNA, chromosome 4,... 44 0.28
489emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4,... 44 0.28
490emb|AJ851602.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.28
491gb|AC158566.8| Mus musculus chromosome 8, clone RP24-149I12, com... 44 0.28
492gb|AC159821.2| Mus musculus BAC clone RP23-152A3 from chromosome... 44 0.28
493gb|AC154303.2| Mus musculus BAC clone RP23-387F19 from chromosom... 44 0.28
494gb|AC164087.5| Mus musculus BAC clone RP23-408K7 from chromosome... 44 0.28
495emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 b... 44 0.28
496gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, com... 44 0.28
497emb|CR759942.12| Human DNA sequence from clone DAAP-182E11 on ch... 44 0.28
498gb|AC158986.2| Mus musculus BAC clone RP23-284L2 from chromosome... 44 0.28
499gb|AC165068.2| Phakopsora pachyrhizi clone JGIAFNA-605H7, comple... 44 0.28
500gb|AC153914.5| Mus musculus 10 BAC RP23-297H17 (Roswell Park Can... 44 0.28

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                         
Query: 288     catgtcacgcatgaagcacctcctccgcaagctccacctctc 329
               |||||||||||||||||| || || || ||||||||||||||
Sbjct: 6732364 catgtcacgcatgaagcatctgctgcggaagctccacctctc 6732323



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 179      ggattagctagctagctagcta 200
                ||||||||||||||||||||||
Sbjct: 24141553 ggattagctagctagctagcta 24141532



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 219     gaggaggaggaagaagaagagg 240
               ||||||||||||||||||||||
Sbjct: 4650920 gaggaggaggaagaagaagagg 4650899



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 309     cctccgcaagctccacctctcc 330
               ||||||||||||||||||||||
Sbjct: 4086937 cctccgcaagctccacctctcc 4086958



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 219      gaggaggaggaagaagaagag 239
                |||||||||||||||||||||
Sbjct: 26252487 gaggaggaggaagaagaagag 26252507



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 218      cgaggaggaggaagaagaaga 238
                |||||||||||||||||||||
Sbjct: 21496005 cgaggaggaggaagaagaaga 21496025



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 182     ttagctagctagctagctagc 202
               |||||||||||||||||||||
Sbjct: 2758814 ttagctagctagctagctagc 2758834



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 30694004 gaggaggaggaagaagaaga 30694023



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 26423598 gaggaggaggaagaagaaga 26423579



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 26252793 gaggaggaggaagaagaaga 26252812



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 184      agctagctagctagctagcc 203
                ||||||||||||||||||||
Sbjct: 22670398 agctagctagctagctagcc 22670417



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 21496525 gaggaggaggaagaagaaga 21496506



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 18169404 gaggaggaggaagaagaaga 18169423



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 42      gaggcgaaggcgaagcgaagcaacgaat 69
               ||||||||| ||| ||||||||||||||
Sbjct: 6732578 gaggcgaagccgacgcgaagcaacgaat 6732551



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 183     tagctagctagctagctagc 202
               ||||||||||||||||||||
Sbjct: 4060693 tagctagctagctagctagc 4060674



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 183     tagctagctagctagctagc 202
               ||||||||||||||||||||
Sbjct: 4060672 tagctagctagctagctagc 4060691



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 183     tagctagctagctagctagc 202
               ||||||||||||||||||||
Sbjct: 3686264 tagctagctagctagctagc 3686283



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 183     tagctagctagctagctagc 202
               ||||||||||||||||||||
Sbjct: 2758836 tagctagctagctagctagc 2758817



to top

>dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1131G07
          Length = 133992

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 288   catgtcacgcatgaagcacctcctccgcaagctccacctctc 329
             |||||||||||||||||| || || || ||||||||||||||
Sbjct: 53417 catgtcacgcatgaagcatctgctgcggaagctccacctctc 53376



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 42    gaggcgaaggcgaagcgaagcaacgaat 69
             ||||||||| ||| ||||||||||||||
Sbjct: 53631 gaggcgaagccgacgcgaagcaacgaat 53604



to top

>ref|XM_790907.1| PREDICTED: Strongylocentrotus purpuratus similar to
           ADP-ribosylation factor-like 2-like 1 (LOC591340), mRNA
          Length = 1539

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 218 cgaggaggaggaagaagaagaggct 242
           |||||||||||||||||||||||||
Sbjct: 759 cgaggaggaggaagaagaagaggct 783



to top

>ref|NM_105452.1| Arabidopsis thaliana ATP binding AT1G67840 transcript variant
           AT1G67840.1 mRNA, complete cds
          Length = 2126

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 218 cgaggaggaggaagaagaagaggc 241
           ||||||||||||||||||||||||
Sbjct: 192 cgaggaggaggaagaagaagaggc 169



to top

>ref|NM_202372.1| Arabidopsis thaliana ATP binding AT1G67840 transcript variant
           AT1G67840.2 mRNA, complete cds
          Length = 2130

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 218 cgaggaggaggaagaagaagaggc 241
           ||||||||||||||||||||||||
Sbjct: 192 cgaggaggaggaagaagaagaggc 169



to top

>gb|BC107439.1| Rattus norvegicus RAB2, member RAS oncogene family-like, mRNA (cDNA
           clone MGC:124925 IMAGE:7121126), complete cds
          Length = 2865

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 219 gaggaggaggaagaagaagaggct 242
           ||||||||||||||||||||||||
Sbjct: 226 gaggaggaggaagaagaagaggct 249



to top

>ref|NM_212547.1| Rattus norvegicus RAB2, member RAS oncogene family-like (Rab2l), mRNA
          Length = 3824

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 219  gaggaggaggaagaagaagaggct 242
            ||||||||||||||||||||||||
Sbjct: 1212 gaggaggaggaagaagaagaggct 1235



to top

>gb|AY049244.1| Arabidopsis thaliana At1g67840/F12A21_3 mRNA, complete cds
          Length = 2126

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 218 cgaggaggaggaagaagaagaggc 241
           ||||||||||||||||||||||||
Sbjct: 192 cgaggaggaggaagaagaagaggc 169



to top

>emb|BX814127.1|CNS0ABZM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 2057

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 218 cgaggaggaggaagaagaagaggc 241
           ||||||||||||||||||||||||
Sbjct: 146 cgaggaggaggaagaagaagaggc 123



to top

>gb|AC008113.4|AC008113 Genomic sequence for Arabidopsis thaliana BAC F12A21 from chromosome
            I, complete sequence
          Length = 114190

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 218  cgaggaggaggaagaagaagaggc 241
            ||||||||||||||||||||||||
Sbjct: 9071 cgaggaggaggaagaagaagaggc 9094



to top

>gb|AF115498.2| Xenopus laevis Smad1 antagonistic effector (SANE) mRNA, complete
           cds
          Length = 2397

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 531 cgaggaggaggaagaagaagagg 553



to top

>ref|NM_004761.2| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2
           (RGL2), mRNA
          Length = 2918

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 219 gaggaggaggaagaagaagaggc 241
           |||||||||||||||||||||||
Sbjct: 269 gaggaggaggaagaagaagaggc 291



to top

>gb|AC117662.13| Mus musculus chromosome 16, clone RP23-351D19, complete sequence
          Length = 293822

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 180   gattagctagctagctagctagc 202
             |||||||||||||||||||||||
Sbjct: 25891 gattagctagctagctagctagc 25869



to top

>ref|XM_499980.1| Yarrowia lipolytica CLIB122, YALI0A11407g predicted mRNA
          Length = 1878

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 218  cgaggaggaggaagaagaagagg 240
            |||||||||||||||||||||||
Sbjct: 1563 cgaggaggaggaagaagaagagg 1585



to top

>emb|Y14366.1|DMLIPASE1 Drosophila melanogaster mRNA for lipase 1
          Length = 1582

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 168 cgaggaggaggaagaagaagagg 190



to top

>emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone B8I24
          Length = 83591

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 186   ctagctagctagctagccgtgtt 208
             |||||||||||||||||||||||
Sbjct: 48561 ctagctagctagctagccgtgtt 48583



to top

>gb|BC040989.1| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2,
           mRNA (cDNA clone IMAGE:4816423), complete cds
          Length = 3204

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 219 gaggaggaggaagaagaagaggc 241
           |||||||||||||||||||||||
Sbjct: 286 gaggaggaggaagaagaagaggc 308



to top

>emb|AL050259.1|HSM800260 Homo sapiens mRNA; cDNA DKFZp564D0782 (from clone DKFZp564D0782)
          Length = 2918

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 219 gaggaggaggaagaagaagaggc 241
           |||||||||||||||||||||||
Sbjct: 269 gaggaggaggaagaagaagaggc 291



to top

>gb|BC032681.1| Homo sapiens ral guanine nucleotide dissociation stimulator-like 2,
           mRNA (cDNA clone MGC:45263 IMAGE:5585507), complete cds
          Length = 2955

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 219 gaggaggaggaagaagaagaggc 241
           |||||||||||||||||||||||
Sbjct: 251 gaggaggaggaagaagaagaggc 273



to top

>dbj|AB218279.1| Gallus gallus NR5A2 gene for liver receptor homolog-1, partial cds
          Length = 12065

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 219  gaggaggaggaagaagaagaggc 241
            |||||||||||||||||||||||
Sbjct: 9472 gaggaggaggaagaagaagaggc 9494



to top

>tpg|BK004062.1| TPA: TPA_inf: Gallus gallus RTN4-B2 (RTN4) mRNA, complete cds
          Length = 2573

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 789 cgaggaggaggaagaagaagagg 811



to top

>tpg|BK004061.1| TPA: TPA_inf: Gallus gallus RTN4-B1 (RTN4) mRNA, complete cds
          Length = 2516

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 789 cgaggaggaggaagaagaagagg 811



to top

>ref|NM_078816.2| Drosophila melanogaster Lipase 1 CG7279-RA (Lip1), mRNA
          Length = 1598

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 200 cgaggaggaggaagaagaagagg 222



to top

>gb|AC159633.2| Mus musculus BAC clone RP24-159L15 from chromosome 12, complete sequence
          Length = 188757

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 219    gaggaggaggaagaagaagaggc 241
              |||||||||||||||||||||||
Sbjct: 127831 gaggaggaggaagaagaagaggc 127853



to top

>gb|AC074229.53| Mus musculus strain C57BL/6J clone rp23-242n21 map 5, complete sequence
          Length = 158661

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 180    gattagctagctagctagctagc 202
              |||||||||||||||||||||||
Sbjct: 138078 gattagctagctagctagctagc 138056



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 219     gaggaggaggaagaagaagaggc 241
               |||||||||||||||||||||||
Sbjct: 2645242 gaggaggaggaagaagaagaggc 2645220



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 182      ttagctagctagctagctagc 202
                |||||||||||||||||||||
Sbjct: 40414171 ttagctagctagctagctagc 40414151



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 182      ttagctagctagctagctagc 202
                |||||||||||||||||||||
Sbjct: 24965459 ttagctagctagctagctagc 24965439



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 181     attagctagctagctagctag 201
               |||||||||||||||||||||
Sbjct: 3429514 attagctagctagctagctag 3429494



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 213      tggatcgaggaggaggaagaagaagagg 240
                ||||| |||||||| |||||||||||||
Sbjct: 42911933 tggatggaggaggaagaagaagaagagg 42911906



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 42858985 gaggaggaggaagaagaaga 42859004



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 221      ggaggaggaagaagaagagg 240
                ||||||||||||||||||||
Sbjct: 41941441 ggaggaggaagaagaagagg 41941460



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 183      tagctagctagctagctagc 202
                ||||||||||||||||||||
Sbjct: 40414149 tagctagctagctagctagc 40414168



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 26781839 gaggaggaggaagaagaaga 26781858



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 221      ggaggaggaagaagaagagg 240
                ||||||||||||||||||||
Sbjct: 26586164 ggaggaggaagaagaagagg 26586183



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 22923693 gaggaggaggaagaagaaga 22923712



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 21756115 gaggaggaggaagaagaaga 21756096



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 11232813 gaggaggaggaagaagaaga 11232794



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 10512648 gaggaggaggaagaagaaga 10512629



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 183      tagctagctagctagctagc 202
                ||||||||||||||||||||
Sbjct: 10464815 tagctagctagctagctagc 10464834



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 184     agctagctagctagctagcc 203
               ||||||||||||||||||||
Sbjct: 7605593 agctagctagctagctagcc 7605574



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 184     agctagctagctagctagcc 203
               ||||||||||||||||||||
Sbjct: 6602275 agctagctagctagctagcc 6602256



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 183     tagctagctagctagctagc 202
               ||||||||||||||||||||
Sbjct: 5098426 tagctagctagctagctagc 5098407



to top

>gb|AY075506.1| Drosophila melanogaster RE54405 full insert cDNA
          Length = 1502

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 218 cgaggaggaggaagaagaagagg 240
           |||||||||||||||||||||||
Sbjct: 200 cgaggaggaggaagaagaagagg 222



to top

>gb|AC007300.6|AC007300 Drosophila melanogaster, chromosome 2L, region 32A-, BAC clone BACR09I15,
              complete sequence
          Length = 169090

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 218    cgaggaggaggaagaagaagagg 240
              |||||||||||||||||||||||
Sbjct: 137687 cgaggaggaggaagaagaagagg 137665



to top

>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0434B04
          Length = 167029

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 219   gaggaggaggaagaagaagaggc 241
             |||||||||||||||||||||||
Sbjct: 95017 gaggaggaggaagaagaagaggc 94995



to top

>gb|AE003629.2| Drosophila melanogaster chromosome 2L, section 38 of 83 of the complete
              sequence
          Length = 261176

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 218    cgaggaggaggaagaagaagagg 240
              |||||||||||||||||||||||
Sbjct: 194332 cgaggaggaggaagaagaagagg 194310



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 218     cgaggaggaggaagaagaagagg 240
               |||||||||||||||||||||||
Sbjct: 1179707 cgaggaggaggaagaagaagagg 1179685



to top

>emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chromosome 4, complete
             sequence
          Length = 197061

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 219   gaggaggaggaagaagaagaggc 241
             |||||||||||||||||||||||
Sbjct: 62911 gaggaggaggaagaagaagaggc 62889



to top

>gb|AC138221.23| Mus musculus chromosome 15, clone RP23-204C16, complete sequence
          Length = 239740

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 219    gaggaggaggaagaagaagaggc 241
              |||||||||||||||||||||||
Sbjct: 135117 gaggaggaggaagaagaagaggc 135095



to top

>dbj|AB012295.1| Homo sapiens HKE1.5 mRNA for GDS-related protein, complete cds
          Length = 2771

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 219 gaggaggaggaagaagaagaggc 241
           |||||||||||||||||||||||
Sbjct: 48  gaggaggaggaagaagaagaggc 70



to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 23636 gaggaggaggaagaagaagagg 23657



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 18417 gaggaggaggaagaagaaga 18436



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 18306 gaggaggaggaagaagaaga 18325



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 18219 gaggaggaggaagaagaaga 18238



to top

>gb|AC123726.11| Mus musculus chromosome 3, clone RP23-436F15, complete sequence
          Length = 224297

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 135077 gaggaggaggaagaagaagagg 135056



to top

>gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb001_104_J07, complete
             sequence
          Length = 103334

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 81306 gaggaggaggaagaagaagagg 81285



to top

>gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, complete sequence
          Length = 198559

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 21421 gaggaggaggaagaagaagagg 21400



to top

>gb|AC102324.9| Mus musculus chromosome 1, clone RP24-476A18, complete sequence
          Length = 129634

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 52878 gaggaggaggaagaagaagagg 52899



to top

>gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, complete sequence
          Length = 173914

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 139439 gaggaggaggaagaagaagagg 139460



to top

>gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 226269

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 6130 gaggaggaggaagaagaagagg 6109



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 25200 gaggaggaggaagaagaaga 25181



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 25079 gaggaggaggaagaagaaga 25060



to top

>gb|AC113013.15| Mus musculus chromosome 7, clone RP23-174K7, complete sequence
          Length = 235823

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 78361 gaggaggaggaagaagaagagg 78382



to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4646 gaggaggaggaagaagaagagg 4667



to top

>gb|AC102616.7| Mus musculus chromosome 18, clone RP23-425L21, complete sequence
          Length = 192276

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 56410 gaggaggaggaagaagaagagg 56431



to top

>gb|BC085153.1| Mus musculus expressed sequence AI480556, mRNA (cDNA clone MGC:109685
            IMAGE:6837651), complete cds
          Length = 4195

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 999  gaggaggaggaagaagaagagg 1020



to top

>gb|BC109074.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126246
            IMAGE:40034219), complete cds
          Length = 2388

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1435 gaggaggaggaagaagaagagg 1456



to top

>gb|BC109073.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126245
            IMAGE:40034214), complete cds
          Length = 2388

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1435 gaggaggaggaagaagaagagg 1456



to top

>ref|NM_001036342.1| Arabidopsis thaliana catalytic/ ubiquitin-protein ligase/ zinc ion
           binding AT2G26000 transcript variant AT2G26000.2 mRNA,
           complete cds
          Length = 1724

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 250 tcgaggaggaggaagaagaaga 229



to top

>ref|NM_128159.2| Arabidopsis thaliana catalytic/ ubiquitin-protein ligase/ zinc ion
           binding AT2G26000 transcript variant AT2G26000.1 mRNA,
           complete cds
          Length = 1672

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 250 tcgaggaggaggaagaagaaga 229



to top

>gb|BC052920.1| Mus musculus cell division cycle 2-like 1, mRNA (cDNA clone MGC:56740
            IMAGE:6489832), complete cds
          Length = 2777

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1041 gaggaggaggaagaagaagagg 1062



to top

>gb|BC051012.1| Mus musculus cell division cycle 2-like 1, mRNA (cDNA clone
           MGC:54635 IMAGE:6488634), complete cds
          Length = 2203

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 513 gaggaggaggaagaagaagagg 534



to top

>gb|AC139218.10| Mus musculus chromosome 15, clone RP23-456O10, complete sequence
          Length = 163749

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 136267 gaggaggaggaagaagaagagg 136246



to top

>gb|AC093339.17| Mus musculus chromosome 19, clone RP23-5G6, complete sequence
          Length = 218747

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 101980 gaggaggaggaagaagaagagg 101959



to top

>gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, complete sequence
          Length = 215135

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 92876 gaggaggaggaagaagaagagg 92855



to top

>gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, complete sequence
          Length = 171510

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 155150 gaggaggaggaagaagaagagg 155129



to top

>gb|AC110909.10| Mus musculus chromosome 7, clone RP24-186G5, complete sequence
          Length = 161738

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 122920 gaggaggaggaagaagaagagg 122941



to top

>gb|AC153727.6| Mus musculus BAC clone RP23-354L15 from chromosome 12, complete
             sequence
          Length = 202733

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 61267 gaggaggaggaagaagaagagg 61246



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 61234 gaggaggaggaagaagaagagg 61213



to top

>gb|AC120437.7| Mus musculus chromosome 5, clone RP24-571K14, complete sequence
          Length = 147493

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 121022 gaggaggaggaagaagaagagg 121043



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 159476 gaggaggaggaagaagaagagg 159497



to top

>ref|XM_632216.1| Dictyostelium discoideum hypothetical protein (DDB0219214), partial
            mRNA
          Length = 4419

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2086 gaggaggaggaagaagaagagg 2107



to top

>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence
          Length = 182658

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 41212 gaggaggaggaagaagaagagg 41233



to top

>gb|AC165418.6| Mus musculus chromosome 7, clone RP23-148M16, complete sequence
          Length = 205525

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 78038 gaggaggaggaagaagaagagg 78017



to top

>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence
          Length = 205646

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 150697 gaggaggaggaagaagaagagg 150718



to top

>ref|XM_642008.1| Dictyostelium discoideum hypothetical protein (DDB0189345), partial
           mRNA
          Length = 981

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 835 gaggaggaggaagaagaagagg 856



to top

>gb|AC110512.13| Mus musculus chromosome 15, clone RP24-134E9, complete sequence
          Length = 163319

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 121173 gaggaggaggaagaagaagagg 121152



to top

>ref|XM_637292.1| Dictyostelium discoideum SMAD/FHA domain-containing protein
            (DDB0220703), partial mRNA
          Length = 2148

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1018 gaggaggaggaagaagaagagg 1039



to top

>ref|XM_630260.1| Dictyostelium discoideum hypothetical protein (DDB0219987), partial
           mRNA
          Length = 1860

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 832 gaggaggaggaagaagaagagg 853



to top

>ref|XM_634880.1| Dictyostelium discoideum hypothetical protein (DDB0218660), partial
           mRNA
          Length = 1272

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 236 gaggaggaggaagaagaagagg 215



to top

>ref|XM_631434.1| Dictyostelium discoideum hypothetical protein (DDB0188114), partial
            mRNA
          Length = 1683

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1622 gaggaggaggaagaagaagagg 1601



to top

>gb|AC152418.5| Mus musculus BAC clone RP23-7L11 from chromosome 7, complete sequence
          Length = 249571

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 18831 gaggaggaggaagaagaagagg 18810



to top

>gb|AC161119.3| Mus musculus BAC clone RP23-32J13 from chromosome 18, complete sequence
          Length = 218697

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 151831 gaggaggaggaagaagaagagg 151810



to top

>gb|AC163104.2| Mus musculus BAC clone RP23-332A4 from chromosome 6, complete sequence
          Length = 195179

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 149103 gaggaggaggaagaagaagagg 149082



to top

>gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome 9, complete sequence
          Length = 210475

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 87858 gaggaggaggaagaagaagagg 87837



to top

>gb|AC165948.2| Mus musculus BAC clone RP24-430M9 from chromosome 17, complete sequence
          Length = 176267

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 80288 gaggaggaggaagaagaagagg 80267



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 102339 gaggaggaggaagaagaaga 102320



to top

>gb|AC132617.4| Mus musculus BAC clone RP23-230A6 from chromosome 12, complete sequence
          Length = 239046

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 24863 gaggaggaggaagaagaagagg 24842



to top

>gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, complete sequence
          Length = 156900

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 153015 gaggaggaggaagaagaagagg 152994



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 91764 gaggaggaggaagaagaaga 91745



to top

>gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, complete sequence
          Length = 142975

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 75165 gaggaggaggaagaagaagagg 75186



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 75220 gaggaggaggaagaagaaga 75239



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 75055 gaggaggaggaagaagaaga 75074



to top

>ref|XM_482656.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 627

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 498 gaggaggaggaagaagaagagg 519



to top

>gb|DQ216074.1| Taeniopygia guttata clone 0058P0014G04 translocase of inner
           mitochondrial membrane 17-like A-like mRNA, complete
           sequence
          Length = 806

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 559 gaggaggaggaagaagaagagg 538



to top

>gb|DQ216073.1| Taeniopygia guttata clone 0063P0009F01 translocase of inner
           mitochondrial membrane 17-like A-like mRNA, complete
           sequence
          Length = 817

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 567 gaggaggaggaagaagaagagg 546



to top

>gb|DQ216072.1| Taeniopygia guttata clone 0058P0002C04 translocase of inner
           mitochondrial membrane 17-like A-like mRNA, complete
           sequence
          Length = 820

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 572 gaggaggaggaagaagaagagg 551



to top

>gb|DQ216070.1| Taeniopygia guttata clone 0058P0022G10 translocase of inner
           mitochondrial membrane 17-like A-like mRNA, complete
           sequence
          Length = 811

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 562 gaggaggaggaagaagaagagg 541



to top

>gb|DQ216069.1| Taeniopygia guttata clone 0063P0013D08 translocase of inner
           mitochondrial membrane 17-like A-like mRNA, complete
           sequence
          Length = 807

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 548 gaggaggaggaagaagaagagg 527



to top

>ref|XM_464318.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2079

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 309 cctccgcaagctccacctctcc 330
           ||||||||||||||||||||||
Sbjct: 504 cctccgcaagctccacctctcc 525



to top

>gb|DQ022604.1| Zea mays subsp. huehuetenangensis cultivar CIMMYT_9479a Opaque-2
           (O2) gene, partial cds
          Length = 2055

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 148 tcgaggaggaggaagaagaaga 127



to top

>gb|DQ022600.1| Zea mays subsp. mexicana cultivar CIMMYT_8771 Opaque-2 (O2) gene,
           partial cds
          Length = 2008

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 142 tcgaggaggaggaagaagaaga 121



to top

>gb|DQ022589.1| Zea mays cultivar mays Coest6 Opaque-2 (O2) gene, partial cds
          Length = 2071

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 143 tcgaggaggaggaagaagaaga 122



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 256     gccgcgccggatgccccctcgctgccgccg 285
               |||||||||||||| || ||||||||||||
Sbjct: 1756550 gccgcgccggatgcaccgtcgctgccgccg 1756521



to top

>gb|AC163325.7| Mus musculus chromosome 1, clone RP23-76L21, complete sequence
          Length = 253153

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 177605 gaggaggaggaagaagaagagg 177626



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 131966 gaggaggaggaagaagaaga 131985



to top

>gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, complete sequence
          Length = 181156

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 3541 gaggaggaggaagaagaagagg 3562



to top

>gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, complete sequence
          Length = 196756

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 115978 gaggaggaggaagaagaagagg 115999



to top

>ref|XM_470393.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 885

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 732 gaggaggaggaagaagaagagg 753



to top

>gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 188027

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 21884 gaggaggaggaagaagaagagg 21905



to top

>gb|AC105948.9| Mus musculus chromosome 8, clone RP24-96N12, complete sequence
          Length = 143798

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 80847 gaggaggaggaagaagaagagg 80826



to top

>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete
              sequence
          Length = 249995

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 186259 gaggaggaggaagaagaagagg 186238



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 186235 gaggaggaggaagaagaagagg 186214



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 186190 gaggaggaggaagaagaagagg 186169



to top

>gb|BT019628.1| Synthetic construct Homo sapiens troponin T1, skeletal, slow mRNA,
           partial cds
          Length = 756

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 58  gaggaggaggaagaagaagagg 79



to top

>gb|AC102220.8| Mus musculus chromosome 7, clone RP24-117E17, complete sequence
          Length = 182996

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 177760 gaggaggaggaagaagaagagg 177781



to top

>gb|AC102410.5| Mus musculus chromosome 18, clone RP24-369O1, complete sequence
          Length = 164142

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 155119 gaggaggaggaagaagaagagg 155140



to top

>gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, complete sequence
          Length = 172336

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 145976 gaggaggaggaagaagaagagg 145997



to top

>gb|AC112997.10| Mus musculus chromosome 8, clone RP24-484I6, complete sequence
          Length = 191413

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 35737 gaggaggaggaagaagaagagg 35758



to top

>gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, complete sequence
          Length = 155372

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 66206 gaggaggaggaagaagaagagg 66185



to top

>gb|AC104743.28| Mus musculus chromosome 6, clone RP23-27D8, complete sequence
          Length = 218391

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 132500 gaggaggaggaagaagaagagg 132521



to top

>gb|AC162169.4| Mus musculus chromosome 1, clone RP24-268D20, complete sequence
          Length = 158792

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 138959 gaggaggaggaagaagaagagg 138980



to top

>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 215    gatcgaggaggaggaagaagaa 236
              ||||||||||||||||||||||
Sbjct: 385984 gatcgaggaggaggaagaagaa 385963



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 181    attagctagctagctagctag 201
              |||||||||||||||||||||
Sbjct: 288878 attagctagctagctagctag 288858



to top

>gb|AE001393.1| Plasmodium falciparum 3D7 chromosome 2 section 30 of 73 of the
            complete sequence
          Length = 15148

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1716 gaggaggaggaagaagaagagg 1737



to top

>gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section 8 of 9 of the complete
              sequence
          Length = 251762

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 236760 gaggaggaggaagaagaagagg 236781



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 236733 gaggaggaggaagaagaagagg 236754



to top

>gb|AF393505.1| Mus musculus potential meiotic DNA repair locus
          Length = 17157

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 14490 gaggaggaggaagaagaagagg 14469



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 903292 gaggaggaggaagaagaagagg 903271



to top

>gb|L08135.1|PFAPS230X Plasmodium falciparum transmission blocking target antigen (Ps230)
            mRNA, complete cds
          Length = 9636

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 995  gaggaggaggaagaagaagagg 1016



to top

>gb|L22219.1|PFAPFS230A Plasmodium falciparum transmission-blocking target antigen (s230)
           gene, 5' end
          Length = 9416

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 861 gaggaggaggaagaagaagagg 882



to top

>gb|AC004632.1| Homo sapiens chromosome 5, BAC clone 18f2 (LBNL H125), complete
             sequence
          Length = 24494

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 14031 gaggaggaggaagaagaagagg 14052



to top

>gb|AC104488.4| Trypanosoma brucei chromosome 5 clone RPCI93-26K5, complete sequence
          Length = 136001

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 56380 gaggaggaggaagaagaagagg 56401



to top

>gb|AC111097.10| Mus musculus chromosome 3, clone RP23-174G7, complete sequence
          Length = 206043

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 167068 gaggaggaggaagaagaagagg 167047



to top

>gb|BT015905.1| Arabidopsis thaliana At2g26000 gene, complete cds
          Length = 1440

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 157 tcgaggaggaggaagaagaaga 136



to top

>gb|AC138210.10| Mus musculus chromosome 1, clone RP23-346B12, complete sequence
          Length = 206044

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 126686 gaggaggaggaagaagaagagg 126707



to top

>gb|AC102017.15| Mus musculus chromosome 5, clone RP24-571N6, complete sequence
          Length = 119681

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 7419 gaggaggaggaagaagaagagg 7398



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 74609 gaggaggaggaagaagaaga 74628



to top

>gb|AC102873.10| Mus musculus chromosome 17, clone RP24-536C15, complete sequence
          Length = 155210

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 54456 gaggaggaggaagaagaagagg 54435



to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 90600 gaggaggaggaagaagaagagg 90621



to top

>gb|AC116781.9| Mus musculus chromosome 16, clone RP24-134G20, complete sequence
          Length = 166568

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 130924 gaggaggaggaagaagaagagg 130945



to top

>gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, complete sequence
          Length = 149726

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 62458 gaggaggaggaagaagaagagg 62437



to top

>gb|AC158114.7| Mus musculus chromosome 5, clone RP23-371A16, complete sequence
          Length = 167040

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 86676 gaggaggaggaagaagaagagg 86655



to top

>gb|AC160136.2| Mus musculus BAC clone RP23-125E11 from chromosome 16, complete
            sequence
          Length = 192119

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 7075 gaggaggaggaagaagaagagg 7054



to top

>gb|AC159817.2| Mus musculus BAC clone RP23-228E8 from chromosome 9, complete sequence
          Length = 193445

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 93656 gaggaggaggaagaagaagagg 93677



to top

>gb|AC161050.2| Mus musculus BAC clone RP23-477C12 from chromosome 12, complete sequence
          Length = 197084

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 189472 gaggaggaggaagaagaagagg 189493



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 189438 gaggaggaggaagaagaaga 189457



to top

>gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosome 13, complete
             sequence
          Length = 191036

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 70390 gaggaggaggaagaagaagagg 70411



to top

>gb|AC161226.7| Mus musculus chromosome 3, clone RP23-298B8, complete sequence
          Length = 200107

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 47614 gaggaggaggaagaagaagagg 47635



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 47669 gaggaggaggaagaagaaga 47688



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 47504 gaggaggaggaagaagaaga 47523



to top

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 135741 gaggaggaggaagaagaagagg 135720



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 173645 gaggaggaggaagaagaaga 173664



to top

>gb|AC102354.14| Mus musculus chromosome 17, clone RP23-80J17, complete sequence
          Length = 117703

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 14769 gaggaggaggaagaagaagagg 14790



to top

>gb|AC079357.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0033D06,
              complete sequence
          Length = 142659

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 125652 gaggaggaggaagaagaagagg 125673



to top

>gb|BC077321.1| Xenopus laevis MGC80275 protein, mRNA (cDNA clone MGC:80275
            IMAGE:5073384), complete cds
          Length = 2574

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1012 gaggaggaggaagaagaagagg 1033



to top

>gb|AC115724.10| Mus musculus chromosome 3, clone RP23-20L18, complete sequence
          Length = 208154

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 186496 gaggaggaggaagaagaagagg 186517



to top

>gb|AC133608.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0085G12, complete sequence
          Length = 121470

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 183   tagctagctagctagctagccg 204
             ||||||||||||||||||||||
Sbjct: 99311 tagctagctagctagctagccg 99290



to top

>gb|AC151468.2| Xenopus tropicalis BAC clone ISB-42G17 containing the Id3 gene,
             complete cds, complete sequence
          Length = 46609

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 34326 gaggaggaggaagaagaagagg 34305



to top

>gb|AC119190.7| Mus musculus chromosome 8, clone RP24-178B9, complete sequence
          Length = 139843

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 135915 gaggaggaggaagaagaagagg 135936



to top

>gb|AC123597.9| Mus musculus chromosome 8, clone RP23-134A7, complete sequence
          Length = 172297

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 151588 gaggaggaggaagaagaagagg 151567



to top

>gb|AC163333.6| Mus musculus chromosome 1, clone RP24-98O21, complete sequence
          Length = 128643

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 95103 gaggaggaggaagaagaagagg 95124



to top

>gb|AC159376.12| Mus musculus 10 BAC RP23-114N21 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 223292

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1440 gaggaggaggaagaagaagagg 1419



to top

>gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, complete sequence
          Length = 247484

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 95676 gaggaggaggaagaagaagagg 95655



to top

>gb|AC135569.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone
            OSJNBb0018F17, complete sequence
          Length = 104291

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 183  tagctagctagctagctagccg 204
            ||||||||||||||||||||||
Sbjct: 5611 tagctagctagctagctagccg 5590



to top

>gb|AC148086.6| Mus musculus chromosome 17, clone RP24-147C6, complete sequence
          Length = 125116

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 99735 gaggaggaggaagaagaagagg 99714



to top

>ref|XM_874456.1| PREDICTED: Bos taurus hypothetical protein LOC613779 (LOC613779),
           mRNA
          Length = 519

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 103 gaggaggaggaagaagaagagg 124



to top

>gb|AC118628.11| Mus musculus chromosome 19, clone RP24-92P15, complete sequence
          Length = 202071

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 11521 gaggaggaggaagaagaagagg 11500



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 11473 gaggaggaggaagaagaaga 11454



to top

>gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 204000

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 70023 gaggaggaggaagaagaagagg 70044



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156078

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 102080 gaggaggaggaagaagaagagg 102059



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 220    aggaggaggaagaagaagagg 240
              |||||||||||||||||||||
Sbjct: 100736 aggaggaggaagaagaagagg 100716



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 99794 gaggaggaggaagaagaaga 99775



to top

>gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 227955

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 214798 gaggaggaggaagaagaagagg 214777



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 214756 gaggaggaggaagaagaaga 214737



to top

>gb|AC120237.5| Rattus norvegicus 1 BAC CH230-453N3 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 150760

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 13616 gaggaggaggaagaagaagagg 13637



to top

>gb|AC116075.5| Rattus norvegicus 6 BAC CH230-139H23 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 153441

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 218    cgaggaggaggaagaagaagag 239
              ||||||||||||||||||||||
Sbjct: 119298 cgaggaggaggaagaagaagag 119319



to top

>gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 237425

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 163184 gaggaggaggaagaagaagagg 163163



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 147495 gaggaggaggaagaagaaga 147476



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 147398 gaggaggaggaagaagaaga 147379



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 147262 gaggaggaggaagaagaaga 147243



to top

>gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228433

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 225665 gaggaggaggaagaagaagagg 225644



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 225835 gaggaggaggaagaagaaga 225816



to top

>gb|AC096938.8| Rattus norvegicus 16 BAC CH230-49B24 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 220401

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 69366 gaggaggaggaagaagaagagg 69387



to top

>gb|AC120877.15| Mus musculus chromosome 6, clone RP24-548D19, complete sequence
          Length = 228206

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 48063 gaggaggaggaagaagaagagg 48042



to top

>gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, complete sequence
          Length = 188137

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 130637 gaggaggaggaagaagaagagg 130658



to top

>gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence
          Length = 103930

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 63129 gaggaggaggaagaagaagagg 63108



to top

>gb|AY519474.1| Xenopus laevis aristaless-related homeobox 2 (Arx2) mRNA, complete
           cds
          Length = 3158

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 788 gaggaggaggaagaagaagagg 809



to top

>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence
          Length = 214765

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 17878 gaggaggaggaagaagaagagg 17899



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 17839 gaggaggaggaagaagaagagg 17860



to top

>ref|XM_615480.2| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 1
            (LOC535403), mRNA
          Length = 7393

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 3675 gaggaggaggaagaagaagagg 3696



to top

>ref|XM_880839.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 12
            (LOC535403), mRNA
          Length = 8130

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4412 gaggaggaggaagaagaagagg 4433



to top

>ref|XM_880818.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 11
            (LOC535403), mRNA
          Length = 7599

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 3881 gaggaggaggaagaagaagagg 3902



to top

>ref|XM_880799.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 10
            (LOC535403), mRNA
          Length = 7590

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 3872 gaggaggaggaagaagaagagg 3893



to top

>ref|XM_880782.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 9
            (LOC535403), mRNA
          Length = 8148

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4430 gaggaggaggaagaagaagagg 4451



to top

>ref|XM_880765.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 8
            (LOC535403), mRNA
          Length = 8187

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4469 gaggaggaggaagaagaagagg 4490



to top

>ref|XM_880749.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 7
            (LOC535403), mRNA
          Length = 8160

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4442 gaggaggaggaagaagaagagg 4463



to top

>ref|XM_880727.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 6
            (LOC535403), mRNA
          Length = 8142

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4424 gaggaggaggaagaagaagagg 4445



to top

>ref|XM_867653.1| PREDICTED: Bos taurus similar to Histone acetyltransferase MYST4
            (MYST protein 4) (MOZ, YBF2/SAS3, SAS2 and TIP60 protein
            4) (Histone acetyltransferase MOZ2) (Monocytic leukemia
            zinc finger protein-related factor) (Histone
            acetyltransferase MORF), transcript variant 2
            (LOC535403), mRNA
          Length = 8248

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4530 gaggaggaggaagaagaagagg 4551



to top

>ref|XM_879800.1| PREDICTED: Bos taurus hypothetical protein LOC615402 (LOC615402),
           mRNA
          Length = 1431

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 802 gaggaggaggaagaagaagagg 823



to top

>ref|XM_591851.2| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 1 (LOC514062), mRNA
          Length = 3890

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 953 gaggaggaggaagaagaagagg 974



to top

>ref|XM_882445.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 7 (LOC514062), mRNA
          Length = 3941

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 950 gaggaggaggaagaagaagagg 971



to top

>ref|XM_882432.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 6 (LOC514062), mRNA
          Length = 3920

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 950 gaggaggaggaagaagaagagg 971



to top

>ref|XM_882425.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 5 (LOC514062), mRNA
          Length = 3869

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 950 gaggaggaggaagaagaagagg 971



to top

>ref|XM_882418.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 4 (LOC514062), mRNA
          Length = 3124

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 950 gaggaggaggaagaagaagagg 971



to top

>ref|XM_869170.1| PREDICTED: Bos taurus similar to HLA-B associated transcript 8
           isoform a, transcript variant 2 (LOC514062), mRNA
          Length = 3992

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 953 gaggaggaggaagaagaagagg 974



to top

>ref|XM_369127.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
            (MG00117.4) partial mRNA
          Length = 2106

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2023 gaggaggaggaagaagaagagg 2044



to top

>ref|XM_421438.1| PREDICTED: Gallus gallus similar to RIKEN cDNA 3632451O06
            (LOC423545), mRNA
          Length = 2642

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1911 gaggaggaggaagaagaagagg 1932



to top

>ref|XM_418829.1| PREDICTED: Gallus gallus similar to MLN64 N-terminal homolog; MLN64
           N-terminal domain homolog (LOC420730), mRNA
          Length = 1531

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 14  gaggaggaggaagaagaagagg 35



to top

>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence
          Length = 213155

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 136956 gaggaggaggaagaagaagagg 136977



to top

>gb|AC121500.6| Mus musculus chromosome 5, clone RP23-471H10, complete sequence
          Length = 179337

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 142453 gaggaggaggaagaagaagagg 142474



to top

>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 119890 gaggaggaggaagaagaagagg 119911



to top

>gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, complete sequence
          Length = 211691

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1422 gaggaggaggaagaagaagagg 1443



to top

>gb|BC075691.1| Mus musculus apoptotic chromatin condensation inducer 1, mRNA (cDNA
           clone IMAGE:30611061), partial cds
          Length = 3404

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 641 gaggaggaggaagaagaagagg 662



to top

>gb|AC137969.9| Mus musculus chromosome 7, clone RP23-267N11, complete sequence
          Length = 176711

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 20415 gaggaggaggaagaagaagagg 20394



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 111357 gaggaggaggaagaagaaga 111376



to top

>gb|AC133156.7| Mus musculus chromosome 15, clone RP24-291M22, complete sequence
          Length = 151577

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 38963 gaggaggaggaagaagaagagg 38942



to top

>gb|BT015082.1| Arabidopsis thaliana At2g26000 gene, complete cds
          Length = 1724

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 217 tcgaggaggaggaagaagaaga 238
           ||||||||||||||||||||||
Sbjct: 250 tcgaggaggaggaagaagaaga 229



to top

>gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map qA7.2, complete
             sequence
          Length = 168775

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 44928 gaggaggaggaagaagaagagg 44949



to top

>gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete sequence
          Length = 163107

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 116455 gaggaggaggaagaagaagagg 116476



to top

>gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete sequence
          Length = 152943

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 110612 gaggaggaggaagaagaagagg 110633



to top

>gb|AC142211.3| Mus musculus BAC clone RP24-501B23 from chromosome 8, complete sequence
          Length = 175636

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 144353 gaggaggaggaagaagaagagg 144374



to top

>gb|AC147225.3| Mus musculus BAC clone RP23-105L19 from chromosome 6, complete sequence
          Length = 210239

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 169788 gaggaggaggaagaagaagagg 169767



to top

>gb|AC147992.3| Mus musculus BAC clone RP24-384K8 from chromosome 18, complete sequence
          Length = 239075

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 186744 gaggaggaggaagaagaagagg 186723



to top

>gb|AC130528.4| Mus musculus BAC clone RP23-122M14 from chromosome 6, complete sequence
          Length = 208738

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 32290 gaggaggaggaagaagaagagg 32269



to top

>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence
          Length = 203437

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 184644 gaggaggaggaagaagaagagg 184665



to top

>gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome 7, complete sequence
          Length = 208880

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 95183 gaggaggaggaagaagaagagg 95204



to top

>gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosome 13, complete sequence
          Length = 147695

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 109589 gaggaggaggaagaagaagagg 109568



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 109389 gaggaggaggaagaagaagagg 109368



to top

>gb|AC142145.3| Mus musculus BAC clone RP24-69D13 from chromosome 8, complete sequence
          Length = 169014

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 33242 gaggaggaggaagaagaagagg 33221



to top

>gb|AC129593.4| Mus musculus BAC clone RP24-142E6 from chromosome 7, complete sequence
          Length = 210291

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 82176 gaggaggaggaagaagaagagg 82197



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 116336 gaggaggaggaagaagaaga 116355



to top

>gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosome 10, complete sequence
          Length = 166554

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 148705 gaggaggaggaagaagaagagg 148684



to top

>gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence
          Length = 179978

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 72094 gaggaggaggaagaagaagagg 72115



to top

>gb|AC145554.2| Mus musculus BAC clone RP23-217E22 from chromosome 18, complete sequence
          Length = 214489

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 145669 gaggaggaggaagaagaagagg 145648



to top

>gb|BC058412.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:67312
            IMAGE:5715729), complete cds
          Length = 3367

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2688 gaggaggaggaagaagaagagg 2667



to top

>gb|AC091309.13| Mus musculus chromosome 17, clone RP23-127L4, complete sequence
          Length = 184755

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 164222 gaggaggaggaagaagaagagg 164201



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 164198 gaggaggaggaagaagaagagg 164177



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 164174 gaggaggaggaagaagaagagg 164153



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 164132 gaggaggaggaagaagaaga 164113



to top

>gb|AC109627.8| Mus musculus chromosome 16, clone RP24-226M22, complete sequence
          Length = 176288

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 159038 gaggaggaggaagaagaagagg 159017



to top

>gb|BC056396.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:65645
            IMAGE:6841272), complete cds
          Length = 3449

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2764 gaggaggaggaagaagaagagg 2743



to top

>gb|BC052404.1| Mus musculus serine/threonine kinase 32B, mRNA (cDNA clone MGC:63434
            IMAGE:5715729), complete cds
          Length = 3367

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2688 gaggaggaggaagaagaagagg 2667



to top

>ref|XM_322409.1| Neurospora crassa OR74A hypothetical protein (NCU00324.1) partial
            mRNA
          Length = 2397

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 217  tcgaggaggaggaagaagaaga 238
            ||||||||||||||||||||||
Sbjct: 1538 tcgaggaggaggaagaagaaga 1559



to top

>ref|XM_952702.1| Neurospora crassa OR74A hypothetical protein (NCU00324.1) partial
            mRNA
          Length = 2397

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 217  tcgaggaggaggaagaagaaga 238
            ||||||||||||||||||||||
Sbjct: 1538 tcgaggaggaggaagaagaaga 1559



to top

>gb|AC116516.7| Mus musculus chromosome 1, clone RP24-336H7, complete sequence
          Length = 134253

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 118103 gaggaggaggaagaagaagagg 118124



to top

>gb|AC100212.8| Mus musculus chromosome 18, clone RP23-60D22, complete sequence
          Length = 225698

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 81532 gaggaggaggaagaagaagagg 81511



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 189524 gaggaggaggaagaagaaga 189505



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 40160 gaggaggaggaagaagaagagg 40181



to top

>ref|XM_581028.2| PREDICTED: Bos taurus similar to cyclin I, transcript variant 3
           (LOC504847), mRNA
          Length = 2525

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 87  gaggaggaggaagaagaagagg 108



to top

>ref|XM_873106.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 6
           (LOC504847), mRNA
          Length = 2580

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 85  gaggaggaggaagaagaagagg 106



to top

>ref|XM_864393.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 4
           (LOC504847), mRNA
          Length = 3088

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 521 gaggaggaggaagaagaagagg 542



to top

>ref|XM_872917.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 5
           (LOC504847), mRNA
          Length = 1970

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 521 gaggaggaggaagaagaagagg 542



to top

>gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, complete sequence
          Length = 212061

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 83145 gaggaggaggaagaagaagagg 83166



to top

>gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, complete sequence
          Length = 228842

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 215064 gaggaggaggaagaagaagagg 215043



to top

>gb|AC168278.2| Mus musculus  BAC RP24-83C9 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 247493

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 147020 gaggaggaggaagaagaagagg 147041



to top

>ref|NM_182996.2| Mus musculus zinc finger protein 692 (Zfp692), mRNA
          Length = 2308

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 808 gaggaggaggaagaagaagagg 829



to top

>gb|AC140331.2| Mus musculus BAC clone RP23-406J20 from chromosome 13, complete sequence
          Length = 192473

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 149727 gaggaggaggaagaagaagagg 149706



to top

>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence
          Length = 218640

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 185687 gaggaggaggaagaagaagagg 185666



to top

>gb|AC140478.2| Mus musculus BAC clone RP24-149A3 from chromosome 6, complete sequence
          Length = 162440

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 92637 gaggaggaggaagaagaagagg 92658



to top

>gb|AC100730.8| Mus musculus chromosome 15, clone RP24-288B1, complete sequence
          Length = 190788

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 63919 gaggaggaggaagaagaagagg 63898



to top

>ref|NM_001030661.1| Gallus gallus SET domain containing 1B (SETD1B), mRNA
          Length = 6313

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 3507 gaggaggaggaagaagaagagg 3528



to top

>gb|AC149133.1| Pan troglodytes chromosome X clone RP43-010O16 map human ortholog p11.23
              complete sequence
          Length = 179327

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 154658 gaggaggaggaagaagaagagg 154637



to top

>gb|AC108947.5| Mus musculus BAC clone RP23-140A11 from chromosome 13, complete
            sequence
          Length = 187401

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 7654 gaggaggaggaagaagaagagg 7633



to top

>gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome 8, complete sequence
          Length = 199459

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 187901 gaggaggaggaagaagaagagg 187922



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 13672 gaggaggaggaagaagaagagg 13651



to top

>gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome 9, complete sequence
          Length = 221263

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 111106 gaggaggaggaagaagaagagg 111127



to top

>gb|AC144794.2| Mus musculus BAC clone RP24-463B6 from chromosome 18, complete sequence
          Length = 152588

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 34791 gaggaggaggaagaagaagagg 34812



to top

>gb|AC134826.4| Mus musculus BAC clone RP24-459P6 from chromosome 13, complete sequence
          Length = 168202

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 38620 gaggaggaggaagaagaagagg 38599



to top

>gb|AC147369.3| Mus musculus BAC clone RP24-392B5 from chromosome 19, complete sequence
          Length = 184037

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 106077 gaggaggaggaagaagaagagg 106098



to top

>gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosome 15, complete sequence
          Length = 192020

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 130769 gaggaggaggaagaagaagagg 130790



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 130841 gaggaggaggaagaagaaga 130860



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 130802 gaggaggaggaagaagaaga 130821



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 130685 gaggaggaggaagaagaaga 130704



to top

>ref|NM_022416.1| Mus musculus serine/threonine kinase 32B (Stk32b), mRNA
          Length = 3367

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 2688 gaggaggaggaagaagaagagg 2667



to top

>ref|NM_001040391.1| Danio rerio zgc:136898 (zgc:136898), mRNA
          Length = 2967

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1516 gaggaggaggaagaagaagagg 1537



to top

>ref|XM_652943.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0431.2), mRNA
          Length = 3480

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 595 gaggaggaggaagaagaagagg 616



to top

>gb|AC157901.4| Mus musculus chromosome 18, clone RP23-189P21, complete sequence
          Length = 191242

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 51292 gaggaggaggaagaagaagagg 51271



to top

>gb|AC183831.2| Pan troglodytes BAC clone CH251-280E18 from chromosome 7, complete
             sequence
          Length = 169210

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 49241 gaggaggaggaagaagaagagg 49220



to top

>ref|NM_014424.3| Homo sapiens heat shock 27kDa protein family, member 7
           (cardiovascular) (HSPB7), mRNA
          Length = 2589

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 219 gaggaggaggaagaagaagagg 240
           ||||||||||||||||||||||
Sbjct: 564 gaggaggaggaagaagaagagg 543



to top

>gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, complete sequence
          Length = 189100

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 93797 gaggaggaggaagaagaagagg 93818



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 112605 gaggaggaggaagaagaaga 112624



to top

>gb|AC161000.5| Mus musculus BAC clone RP23-51A9 from chromosome 13, complete sequence
          Length = 216751

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 163793 gaggaggaggaagaagaagagg 163772



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    gaggaggaggaagaagaaga 238
              ||||||||||||||||||||
Sbjct: 163870 gaggaggaggaagaagaaga 163851



to top

>gb|AC138737.10| Mus musculus chromosome 5, clone RP23-307F20, complete sequence
          Length = 216064

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 215744 gaggaggaggaagaagaagagg 215765



to top

>gb|AC024914.48| Mus musculus BAC Clone 262c6 RPCI-23, complete sequence
          Length = 205922

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 116976 gaggaggaggaagaagaagagg 116955



to top

>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 194127

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 52689 gaggaggaggaagaagaagagg 52710



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 52778 gaggaggaggaagaagaaga 52797



to top

>gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, complete sequence
          Length = 214848

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 185046 gaggaggaggaagaagaagagg 185025



to top

>gb|AC121533.6| Mus musculus chromosome 9, clone RP24-555P22, complete sequence
          Length = 175009

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 50347 gaggaggaggaagaagaagagg 50326



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 66956 gaggaggaggaagaagaaga 66975



to top

>gb|AC023174.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-25N12, complete
              sequence
          Length = 223266

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 195582 gaggaggaggaagaagaagagg 195561



to top

>gb|AC112675.12| Mus musculus chromosome 1, clone RP23-138J12, complete sequence
          Length = 278715

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 132968 gaggaggaggaagaagaagagg 132989



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 219    gaggaggaggaagaagaagagg 240
              ||||||||||||||||||||||
Sbjct: 132947 gaggaggaggaagaagaagagg 132968



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 219      gaggaggaggaagaagaagagg 240
                ||||||||||||||||||||||
Sbjct: 35215360 gaggaggaggaagaagaagagg 35215339



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 181      attagctagctagctagctagc 202
                ||||||||||||||||||||||
Sbjct: 13677377 attagctagctagctagctagc 13677356



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 219      gaggaggaggaagaagaagag 239
                |||||||||||||||||||||
Sbjct: 22089723 gaggaggaggaagaagaagag 22089743



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 218      cgaggaggaggaagaagaaga 238
                |||||||||||||||||||||
Sbjct: 15483831 cgaggaggaggaagaagaaga 15483811



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 219      gaggaggaggaagaagaagag 239
                |||||||||||||||||||||
Sbjct: 12485069 gaggaggaggaagaagaagag 12485049



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 183      tagctagctagctagctagc 202
                ||||||||||||||||||||
Sbjct: 35900978 tagctagctagctagctagc 35900959



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 182      ttagctagctagctagctag 201
                ||||||||||||||||||||
Sbjct: 32121770 ttagctagctagctagctag 32121751



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 37       gcgaggaggcgaaggcgaag 56
                ||||||||||||||||||||
Sbjct: 29788784 gcgaggaggcgaaggcgaag 29788765



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 221      ggaggaggaagaagaagagg 240
                ||||||||||||||||||||
Sbjct: 29711330 ggaggaggaagaagaagagg 29711349



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 22235283 gaggaggaggaagaagaaga 22235264



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      gaggaggaggaagaagaaga 238
                ||||||||||||||||||||
Sbjct: 16568361 gaggaggaggaagaagaaga 16568342



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 183      tagctagctagctagctagc 202
                ||||||||||||||||||||
Sbjct: 13677354 tagctagctagctagctagc 13677373



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 182      ttagctagctagctagctag 201
                ||||||||||||||||||||
Sbjct: 12993754 ttagctagctagctagctag 12993735



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 219     gaggaggaggaagaagaaga 238
               ||||||||||||||||||||
Sbjct: 5609670 gaggaggaggaagaagaaga 5609689



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 181     attagctagctagctagcta 200
               ||||||||||||||||||||
Sbjct: 3458554 attagctagctagctagcta 3458535



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 181     attagctagctagctagcta 200
               ||||||||||||||||||||
Sbjct: 2668859 attagctagctagctagcta 2668840



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 182     ttagctagctagctagctag 201
               ||||||||||||||||||||
Sbjct: 1125560 ttagctagctagctagctag 1125541



to top

>gb|AC163393.6| Mus musculus chromosome 15, clone RP24-224P8, complete sequence
          Length = 167152

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 58952 gaggaggaggaagaagaagagg 58931



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 53721 gaggaggaggaagaagaaga 53702



to top

>gb|AC166178.10| Mus musculus 6 BAC RP24-414G20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 173015

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 51438 gaggaggaggaagaagaagagg 51459



to top

>ref|NM_001017842.1| Danio rerio zgc:110175 (zgc:110175), mRNA
          Length = 1438

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1196 gaggaggaggaagaagaagagg 1217



to top

>gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome 8, complete
            sequence
          Length = 208153

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 1098 gaggaggaggaagaagaagagg 1077



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 219   gaggaggaggaagaagaagag 239
             |||||||||||||||||||||
Sbjct: 29109 gaggaggaggaagaagaagag 29089



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gaggaggaggaagaagaaga 238
             ||||||||||||||||||||
Sbjct: 17244 gaggaggaggaagaagaaga 17263



to top

>gb|AC163346.3| Mus musculus BAC clone RP23-370A2 from chromosome 6, complete
            sequence
          Length = 173936

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 219  gaggaggaggaagaagaagagg 240
            ||||||||||||||||||||||
Sbjct: 4058 gaggaggaggaagaagaagagg 4079



to top

>gb|AC164637.3| Mus musculus BAC clone RP23-128I20 from chromosome 13, complete
             sequence
          Length = 222651

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 219   gaggaggaggaagaagaagagg 240
             ||||||||||||||||||||||
Sbjct: 11170 gaggaggaggaagaagaagagg 11149


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,164,097
Number of Sequences: 3902068
Number of extensions: 4164097
Number of successful extensions: 242337
Number of sequences better than 10.0: 4577
Number of HSP's better than 10.0 without gapping: 4642
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 196616
Number of HSP's gapped (non-prelim): 44049
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top