>emb|BX569690.1| Synechococcus sp. WH8102 complete genome; segment 2/7
          Length = 349652

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 391    gacccagacccaggcgacgccgtgg 415
              ||||||| |||||||||||||||||
Sbjct: 186331 gacccaggcccaggcgacgccgtgg 186307

>emb|AL939129.1|SCO939129 Streptomyces coelicolor A3(2) complete genome; segment 26/29
          Length = 292200

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 376    cgacagcgcggggccgacccagacccagg 404
              |||| |||||| |||||||||||||||||
Sbjct: 276259 cgacggcgcggtgccgacccagacccagg 276231

>ref|XM_824022.1| Trypanosoma brucei TREU927 ubiquinone biosynthesis
           methyltransferase (Tb11.01.2280) partial mRNA
          Length = 867

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 221 aggaagcaaccacagcgacggagc 244
           ||||||||||||| ||||||||||
Sbjct: 26  aggaagcaaccactgcgacggagc 3

>gb|AC144913.13| Mus musculus chromosome 15, clone RP24-203A19, complete sequence
          Length = 167647

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 425    ctgtagccctccgtcttcct 444
              ||||||||||||||||||||
Sbjct: 119962 ctgtagccctccgtcttcct 119981

>gb|AC161172.4| Mus musculus chromosome 15, clone RP24-265I13, complete sequence
          Length = 181782

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 425    ctgtagccctccgtcttcct 444
              ||||||||||||||||||||
Sbjct: 101070 ctgtagccctccgtcttcct 101051


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,259,801
Number of Sequences: 3902068
Number of extensions: 2259801
Number of successful extensions: 33154
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33147
Number of HSP's gapped (non-prelim): 7
length of query: 458
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 436
effective length of database: 17,147,199,772
effective search space: 7476179100592
effective search space used: 7476179100592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)