ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl33b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC138000.3| Oryza sativa (japonica cultivar-group) chromosome... 224 2e-55
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 224 2e-55
3gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 224 2e-55
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.005
5gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 50 0.005
6emb|AL954853.5|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb... 50 0.005
7emb|AL513324.9| Human DNA sequence from clone RP11-355F22 on chr... 42 1.2
8emb|AL358780.22| Human DNA sequence from clone RP11-418C1 on chr... 42 1.2
9gb|AC099614.9| Mus musculus chromosome 15, clone RP23-408O11, co... 40 4.7
10gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 40 4.7
11gb|AY825832.1| Anopheles gambiae isolate S13 haplotype 2 heat sh... 40 4.7
12gb|AY825831.1| Anopheles gambiae isolate S13 haplotype 1 heat sh... 40 4.7
13gb|AY825830.1| Anopheles gambiae isolate S12 haplotype 2 heat sh... 40 4.7
14gb|AY825829.1| Anopheles gambiae isolate S12 haplotype 1 heat sh... 40 4.7
15gb|AY825828.1| Anopheles gambiae isolate S11 haplotype 2 heat sh... 40 4.7
16gb|AY825827.1| Anopheles gambiae isolate S11 haplotype 1 heat sh... 40 4.7
17gb|AY825826.1| Anopheles gambiae isolate S10 haplotype 2 heat sh... 40 4.7
18gb|AY825825.1| Anopheles gambiae isolate S10 haplotype 1 heat sh... 40 4.7
19gb|AY825824.1| Anopheles gambiae isolate S9 haplotype 2 heat sho... 40 4.7
20gb|AY825823.1| Anopheles gambiae isolate S9 haplotype 1 heat sho... 40 4.7
21gb|AY825822.1| Anopheles gambiae isolate S8 haplotype 2 heat sho... 40 4.7
22gb|AY825821.1| Anopheles gambiae isolate S8 haplotype 1 heat sho... 40 4.7
23gb|AY825820.1| Anopheles gambiae isolate S7 haplotype 2 heat sho... 40 4.7
24gb|AY825819.1| Anopheles gambiae isolate S7 haplotype 1 heat sho... 40 4.7
25gb|AY825818.1| Anopheles gambiae isolate S6 haplotype 2 heat sho... 40 4.7
26gb|AY825817.1| Anopheles gambiae isolate S6 haplotype 1 heat sho... 40 4.7
27gb|AY825816.1| Anopheles gambiae isolate S5 haplotype 2 heat sho... 40 4.7
28gb|AY825815.1| Anopheles gambiae isolate S5 haplotype 1 heat sho... 40 4.7
29gb|AY825814.1| Anopheles gambiae isolate S4 haplotype 2 heat sho... 40 4.7
30gb|AY825813.1| Anopheles gambiae isolate S4 haplotype 1 heat sho... 40 4.7
31gb|AY825812.1| Anopheles gambiae isolate S3 haplotype 2 heat sho... 40 4.7
32gb|AY825811.1| Anopheles gambiae isolate S3 haplotype 1 heat sho... 40 4.7
33gb|AY825810.1| Anopheles gambiae isolate S2 haplotype 2 heat sho... 40 4.7
34gb|AY825809.1| Anopheles gambiae isolate S2 haplotype 1 heat sho... 40 4.7
35gb|AY825808.1| Anopheles gambiae isolate S1 haplotype 2 heat sho... 40 4.7
36gb|AY825807.1| Anopheles gambiae isolate S1 haplotype 1 heat sho... 40 4.7
37gb|AY825806.1| Anopheles gambiae isolate M17 haplotype 2 heat sh... 40 4.7
38gb|AY825805.1| Anopheles gambiae isolate M17 haplotype 1 heat sh... 40 4.7
39gb|AY825804.1| Anopheles gambiae isolate M15 haplotype 2 heat sh... 40 4.7
40gb|AY825803.1| Anopheles gambiae isolate M15 haplotype 1 heat sh... 40 4.7
41gb|AY825802.1| Anopheles gambiae isolate M11 haplotype 2 heat sh... 40 4.7
42gb|AY825801.1| Anopheles gambiae isolate M11 haplotype 1 heat sh... 40 4.7
43gb|AY825800.1| Anopheles gambiae isolate M10 haplotype 2 heat sh... 40 4.7
44gb|AY825799.1| Anopheles gambiae isolate M10 haplotype 1 heat sh... 40 4.7
45gb|AY825798.1| Anopheles gambiae isolate M9 haplotype 2 heat sho... 40 4.7
46gb|AY825797.1| Anopheles gambiae isolate M9 haplotype 1 heat sho... 40 4.7
47gb|AY825796.1| Anopheles gambiae isolate M8 haplotype 2 heat sho... 40 4.7
48gb|AY825795.1| Anopheles gambiae isolate M8 haplotype 1 heat sho... 40 4.7
49gb|AY825794.1| Anopheles gambiae isolate M7 haplotype 2 heat sho... 40 4.7
50gb|AY825793.1| Anopheles gambiae isolate M7 haplotype 1 heat sho... 40 4.7
51gb|AY825792.1| Anopheles gambiae isolate M6 haplotype 2 heat sho... 40 4.7
52gb|AY825791.1| Anopheles gambiae isolate M6 haplotype 1 heat sho... 40 4.7
53gb|AY825790.1| Anopheles gambiae isolate M5 haplotype 2 heat sho... 40 4.7
54gb|AY825789.1| Anopheles gambiae isolate M5 haplotype 1 heat sho... 40 4.7
55gb|AY825788.1| Anopheles gambiae isolate M4 haplotype 2 heat sho... 40 4.7
56gb|AY825787.1| Anopheles gambiae isolate M4 haplotype 1 heat sho... 40 4.7
57gb|AY825786.1| Anopheles gambiae isolate M3 haplotype 2 heat sho... 40 4.7
58gb|AY825785.1| Anopheles gambiae isolate M3 haplotype 1 heat sho... 40 4.7
59gb|AY825784.1| Anopheles gambiae isolate M2 haplotype 2 heat sho... 40 4.7
60gb|AY825783.1| Anopheles gambiae isolate M2 haplotype 1 heat sho... 40 4.7
61gb|AY825782.1| Anopheles gambiae isolate M1 haplotype 2 heat sho... 40 4.7
62gb|AY825781.1| Anopheles gambiae isolate M1 haplotype 1 heat sho... 40 4.7
63ref|XM_447328.1| Candida glabrata CBS138 hypothetical protein (C... 40 4.7
64emb|Z74039.1|CEK03B8 Caenorhabditis elegans Cosmid K03B8, comple... 40 4.7
65emb|CR450782.5| Zebrafish DNA sequence from clone CH211-245B21 i... 40 4.7
66emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 40 4.7
67gb|AC153011.4| Mus musculus BAC clone RP23-316O20 from chromosom... 40 4.7
68emb|AL645757.13| Mouse DNA sequence from clone DN-340J1 on chrom... 40 4.7
69emb|AL606744.30| Mouse DNA sequence from clone RP23-267O21 on ch... 40 4.7
70gb|AC008178.3| Homo sapiens BAC clone RP11-551O2 from 2, complet... 40 4.7
71ref|XM_577226.1| PREDICTED: Rattus norvegicus similar to RIKEN c... 40 4.7
72ref|XM_318286.2| Anopheles gambiae str. PEST ENSANGP00000001755 ... 40 4.7
73gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, comple... 40 4.7
74gb|DQ286433.1| Apium graveolens var. dulce putative sucrose tran... 40 4.7 
>gb|AC138000.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0024M06, complete sequence
          Length = 51144

 Score =  224 bits (113), Expect = 2e-55
 Identities = 244/287 (85%), Gaps = 3/287 (1%)
 Strand = Plus / Plus

                                                                         
Query: 10    ggctacttttctcgatcaacatcaccgctgtttgctgcttctggatgtctcagctcatca 69
             |||||||||||||  || |||||||| || ||||||||  |||| |||||||||||||| 
Sbjct: 37318 ggctacttttctcattctacatcacccctctttgctgcacctgggtgtctcagctcatcg 37377

                                                                         
Query: 70    aatccctctaagctgttgaaaatggcaagaagagaaggatcttccttttcttgcactccg 129
             || ||||||||| | |||||| |  ||||||||||||||||||| |||||||||||||| 
Sbjct: 37378 aacccctctaagtttttgaaagtaccaagaagagaaggatcttcgttttcttgcactcca 37437

                                                                         
Query: 130   gtctccactagctcttattacaggcacagaggcaggaatcccagcaccgtcggttcatgg 189
             ||||||||||| |||||||||||| ||||||| |||||||||||||| || ||||| |||
Sbjct: 37438 gtctccactagttcttattacaggtacagagggaggaatcccagcacggttggttcttgg 37497

                                                                         
Query: 190   catgcaacaactgctgcttcacttgatgacgatgggttgaaccaacaagcaccgctgaga 249
              ||| |||||||||||||||||| ||||| |||||| | |||||||  | |    |||||
Sbjct: 37498 gatggaacaactgctgcttcactagatgaagatgggctaaaccaacctgaattattgaga 37557

                                                            
Query: 250   agtcaaaggtgtggtattccat---attggtcaaaggggagtaaaca 293
             ||||||||||| |||||||| |   ||||||||||| ||| ||||||
Sbjct: 37558 agtcaaaggtgcggtattccttgtaattggtcaaagaggaataaaca 37604



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 293   aaagaagctgttctccttcactatctgatacacttagacgaagaggaagcagcctgttgt 352
             ||||||| | ||||||||| || ||||||||||| ||| ||| ||| |||||||||||||
Sbjct: 37616 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 37675

                
Query: 353   gtg 355
             |||
Sbjct: 37676 gtg 37678
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  224 bits (113), Expect = 2e-55
 Identities = 244/287 (85%), Gaps = 3/287 (1%)
 Strand = Plus / Minus

                                                                           
Query: 10      ggctacttttctcgatcaacatcaccgctgtttgctgcttctggatgtctcagctcatca 69
               |||||||||||||  || |||||||| || ||||||||  |||| |||||||||||||| 
Sbjct: 7678949 ggctacttttctcattctacatcacccctctttgctgcacctgggtgtctcagctcatcg 7678890

                                                                           
Query: 70      aatccctctaagctgttgaaaatggcaagaagagaaggatcttccttttcttgcactccg 129
               || ||||||||| | |||||| |  ||||||||||||||||||| |||||||||||||| 
Sbjct: 7678889 aacccctctaagtttttgaaagtaccaagaagagaaggatcttcgttttcttgcactcca 7678830

                                                                           
Query: 130     gtctccactagctcttattacaggcacagaggcaggaatcccagcaccgtcggttcatgg 189
               ||||||||||| |||||||||||| ||||||| |||||||||||||| || ||||| |||
Sbjct: 7678829 gtctccactagttcttattacaggtacagagggaggaatcccagcacggttggttcttgg 7678770

                                                                           
Query: 190     catgcaacaactgctgcttcacttgatgacgatgggttgaaccaacaagcaccgctgaga 249
                ||| |||||||||||||||||| ||||| |||||| | |||||||  | |    |||||
Sbjct: 7678769 gatggaacaactgctgcttcactagatgaagatgggctaaaccaacctgaattattgaga 7678710

                                                              
Query: 250     agtcaaaggtgtggtattccat---attggtcaaaggggagtaaaca 293
               ||||||||||| |||||||| |   ||||||||||| ||| ||||||
Sbjct: 7678709 agtcaaaggtgcggtattccttgtaattggtcaaagaggaataaaca 7678663



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                           
Query: 293     aaagaagctgttctccttcactatctgatacacttagacgaagaggaagcagcctgttgt 352
               ||||||| | ||||||||| || ||||||||||| ||| ||| ||| |||||||||||||
Sbjct: 7678651 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 7678592

                  
Query: 353     gtg 355
               |||
Sbjct: 7678591 gtg 7678589
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  224 bits (113), Expect = 2e-55
 Identities = 244/287 (85%), Gaps = 3/287 (1%)
 Strand = Plus / Minus

                                                                           
Query: 10      ggctacttttctcgatcaacatcaccgctgtttgctgcttctggatgtctcagctcatca 69
               |||||||||||||  || |||||||| || ||||||||  |||| |||||||||||||| 
Sbjct: 7749036 ggctacttttctcattctacatcacccctctttgctgcacctgggtgtctcagctcatcg 7748977

                                                                           
Query: 70      aatccctctaagctgttgaaaatggcaagaagagaaggatcttccttttcttgcactccg 129
               || ||||||||| | |||||| |  ||||||||||||||||||| |||||||||||||| 
Sbjct: 7748976 aacccctctaagtttttgaaagtaccaagaagagaaggatcttcgttttcttgcactcca 7748917

                                                                           
Query: 130     gtctccactagctcttattacaggcacagaggcaggaatcccagcaccgtcggttcatgg 189
               ||||||||||| |||||||||||| ||||||| |||||||||||||| || ||||| |||
Sbjct: 7748916 gtctccactagttcttattacaggtacagagggaggaatcccagcacggttggttcttgg 7748857

                                                                           
Query: 190     catgcaacaactgctgcttcacttgatgacgatgggttgaaccaacaagcaccgctgaga 249
                ||| |||||||||||||||||| ||||| |||||| | |||||||  | |    |||||
Sbjct: 7748856 gatggaacaactgctgcttcactagatgaagatgggctaaaccaacctgaattattgaga 7748797

                                                              
Query: 250     agtcaaaggtgtggtattccat---attggtcaaaggggagtaaaca 293
               ||||||||||| |||||||| |   ||||||||||| ||| ||||||
Sbjct: 7748796 agtcaaaggtgcggtattccttgtaattggtcaaagaggaataaaca 7748750



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                           
Query: 293     aaagaagctgttctccttcactatctgatacacttagacgaagaggaagcagcctgttgt 352
               ||||||| | ||||||||| || ||||||||||| ||| ||| ||| |||||||||||||
Sbjct: 7748738 aaagaagtttttctccttcgctctctgatacactcagaagaaaagggagcagcctgttgt 7748679

                  
Query: 353     gtg 355
               |||
Sbjct: 7748678 gtg 7748676
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 97      agaagagaaggatcttccttttcttgcac 125
               |||||||| ||||||||||||||||||||
Sbjct: 5706556 agaagagagggatcttccttttcttgcac 5706528
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 97      agaagagaaggatcttccttttcttgcac 125
               |||||||| ||||||||||||||||||||
Sbjct: 5706549 agaagagagggatcttccttttcttgcac 5706521
to top
>emb|AL954853.5|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb0071I17 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 159056

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 97    agaagagaaggatcttccttttcttgcac 125
             |||||||| ||||||||||||||||||||
Sbjct: 61079 agaagagagggatcttccttttcttgcac 61051
to top
>emb|AL513324.9| Human DNA sequence from clone RP11-355F22 on chromosome 10, complete
             sequence
          Length = 131195

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 151   aggcacagaggcaggaatccc 171
             |||||||||||||||||||||
Sbjct: 66522 aggcacagaggcaggaatccc 66502
to top
>emb|AL358780.22| Human DNA sequence from clone RP11-418C1 on chromosome 10 Contains two
             novel genes (FLJ31094), the gene for a novel protein, the
             5' end of the MLLT10 gene for myeloid/lymphoid or
             mixed-lineage leukemia (trithorax homolog, Drosophila);
             translocated to 10 (AF10), a noel gene (DKFZP761J229) and
             six CpG islands, complete sequence
          Length = 112311

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 193   gcaacaactgctgcttcactt 213
             |||||||||||||||||||||
Sbjct: 10092 gcaacaactgctgcttcactt 10072
to top
>gb|AC099614.9| Mus musculus chromosome 15, clone RP23-408O11, complete sequence
          Length = 201092

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 249    aagtcaaaggtgtggtattccata 272
              |||||||||| |||||||||||||
Sbjct: 112102 aagtcaaaggagtggtattccata 112125
to top
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 151     aggcacagaggcaggaatcc 170
               ||||||||||||||||||||
Sbjct: 3948109 aggcacagaggcaggaatcc 3948128
to top
>gb|AY825832.1| Anopheles gambiae isolate S13 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825831.1| Anopheles gambiae isolate S13 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825830.1| Anopheles gambiae isolate S12 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825829.1| Anopheles gambiae isolate S12 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825828.1| Anopheles gambiae isolate S11 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 517

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825827.1| Anopheles gambiae isolate S11 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 517

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825826.1| Anopheles gambiae isolate S10 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825825.1| Anopheles gambiae isolate S10 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825824.1| Anopheles gambiae isolate S9 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 485

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 445 tattccatattggtcaaagg 464
to top
>gb|AY825823.1| Anopheles gambiae isolate S9 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 485

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 445 tattccatattggtcaaagg 464
to top
>gb|AY825822.1| Anopheles gambiae isolate S8 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 480

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825821.1| Anopheles gambiae isolate S8 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 480

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825820.1| Anopheles gambiae isolate S7 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825819.1| Anopheles gambiae isolate S7 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825818.1| Anopheles gambiae isolate S6 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825817.1| Anopheles gambiae isolate S6 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825816.1| Anopheles gambiae isolate S5 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 488

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825815.1| Anopheles gambiae isolate S5 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 488

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825814.1| Anopheles gambiae isolate S4 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825813.1| Anopheles gambiae isolate S4 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825812.1| Anopheles gambiae isolate S3 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825811.1| Anopheles gambiae isolate S3 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825810.1| Anopheles gambiae isolate S2 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825809.1| Anopheles gambiae isolate S2 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 508

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825808.1| Anopheles gambiae isolate S1 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 516

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825807.1| Anopheles gambiae isolate S1 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 516

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 434 tattccatattggtcaaagg 453
to top
>gb|AY825806.1| Anopheles gambiae isolate M17 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825805.1| Anopheles gambiae isolate M17 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825804.1| Anopheles gambiae isolate M15 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825803.1| Anopheles gambiae isolate M15 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825802.1| Anopheles gambiae isolate M11 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825801.1| Anopheles gambiae isolate M11 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825800.1| Anopheles gambiae isolate M10 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 512

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 429 tattccatattggtcaaagg 448
to top
>gb|AY825799.1| Anopheles gambiae isolate M10 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 512

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 429 tattccatattggtcaaagg 448
to top
>gb|AY825798.1| Anopheles gambiae isolate M9 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825797.1| Anopheles gambiae isolate M9 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 507

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825796.1| Anopheles gambiae isolate M8 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825795.1| Anopheles gambiae isolate M8 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 433 tattccatattggtcaaagg 452
to top
>gb|AY825794.1| Anopheles gambiae isolate M7 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 510

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 428 tattccatattggtcaaagg 447
to top
>gb|AY825793.1| Anopheles gambiae isolate M7 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 510

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 428 tattccatattggtcaaagg 447
to top
>gb|AY825792.1| Anopheles gambiae isolate M6 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 462

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825791.1| Anopheles gambiae isolate M6 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 462

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 425 tattccatattggtcaaagg 444
to top
>gb|AY825790.1| Anopheles gambiae isolate M5 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825789.1| Anopheles gambiae isolate M5 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825788.1| Anopheles gambiae isolate M4 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825787.1| Anopheles gambiae isolate M4 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825786.1| Anopheles gambiae isolate M3 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825785.1| Anopheles gambiae isolate M3 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825784.1| Anopheles gambiae isolate M2 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825783.1| Anopheles gambiae isolate M2 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825782.1| Anopheles gambiae isolate M1 haplotype 2 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>gb|AY825781.1| Anopheles gambiae isolate M1 haplotype 1 heat shock protein DnaJ
           gene, exon 2 and partial cds
          Length = 506

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 424 tattccatattggtcaaagg 443
to top
>ref|XM_447328.1| Candida glabrata CBS138 hypothetical protein (CAGL0I01782g) partial
            mRNA
          Length = 3156

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   ctcagctcatcaaatccctc 77
            ||||||||||||||||||||
Sbjct: 1865 ctcagctcatcaaatccctc 1884
to top
>emb|Z74039.1|CEK03B8 Caenorhabditis elegans Cosmid K03B8, complete sequence
          Length = 29132

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   tgttctccttcactatctga 320
             ||||||||||||||||||||
Sbjct: 10654 tgttctccttcactatctga 10635
to top
>emb|CR450782.5| Zebrafish DNA sequence from clone CH211-245B21 in linkage group 3,
             complete sequence
          Length = 99702

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   gcaacaactgctgcttcact 212
             ||||||||||||||||||||
Sbjct: 84139 gcaacaactgctgcttcact 84158
to top
>emb|CR380955.1| Candida glabrata strain CBS138 chromosome I complete sequence
          Length = 1089401

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     ctcagctcatcaaatccctc 77
              ||||||||||||||||||||
Sbjct: 148345 ctcagctcatcaaatccctc 148364
to top
>gb|AC153011.4| Mus musculus BAC clone RP23-316O20 from chromosome 9, complete sequence
          Length = 190332

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    ctggatgtctcagctcatca 69
             ||||||||||||||||||||
Sbjct: 14581 ctggatgtctcagctcatca 14562
to top
>emb|AL645757.13| Mouse DNA sequence from clone DN-340J1 on chromosome 3, complete
             sequence
          Length = 134040

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    tctaagctgttgaaaatggc 95
             ||||||||||||||||||||
Sbjct: 65021 tctaagctgttgaaaatggc 65040
to top
>emb|AL606744.30| Mouse DNA sequence from clone RP23-267O21 on chromosome 3, complete
              sequence
          Length = 185867

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 76     tctaagctgttgaaaatggc 95
              ||||||||||||||||||||
Sbjct: 162584 tctaagctgttgaaaatggc 162603
to top
>gb|AC008178.3| Homo sapiens BAC clone RP11-551O2 from 2, complete sequence
          Length = 113367

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 279   aaaggggagtaaacaaagaa 298
             ||||||||||||||||||||
Sbjct: 16976 aaaggggagtaaacaaagaa 16995
to top
>ref|XM_577226.1| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 2310015N07
           (LOC363885), mRNA
          Length = 702

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 197 caactgctgcttcacttgat 216
           ||||||||||||||||||||
Sbjct: 417 caactgctgcttcacttgat 398
to top
>ref|XM_318286.2| Anopheles gambiae str. PEST ENSANGP00000001755
           (ENSANGG00000001474), partial mRNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 264 tattccatattggtcaaagg 283
           ||||||||||||||||||||
Sbjct: 261 tattccatattggtcaaagg 242
to top
>gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, complete sequence
          Length = 168604

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    ctggatgtctcagctcatca 69
             ||||||||||||||||||||
Sbjct: 51690 ctggatgtctcagctcatca 51709
to top
>gb|DQ286433.1| Apium graveolens var. dulce putative sucrose transporter SUT3 mRNA,
           complete cds
          Length = 1768

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 217 gacgatgggttgaaccaaca 236
           ||||||||||||||||||||
Sbjct: 325 gacgatgggttgaaccaaca 306


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,895,833
Number of Sequences: 3902068
Number of extensions: 4895833
Number of successful extensions: 69797
Number of sequences better than 10.0: 74
Number of HSP's better than 10.0 without gapping: 74
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69614
Number of HSP's gapped (non-prelim): 180
length of query: 357
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 335
effective length of database: 17,147,199,772
effective search space: 5744311923620
effective search space used: 5744311923620
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top