ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl33b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 333 2e-88
2gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 333 2e-88
3emb|AL731761.3|CNS07YPV Oryza sativa chromosome 12, . BAC OJ1119... 333 2e-88
4emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007... 333 2e-88
5gb|BT010228.1| Drosophila melanogaster RE64686 full insert cDNA 52 9e-04
6emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 48 0.013
7ref|XM_468519.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.053
8dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.053
9dbj|AP004776.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.053
10dbj|AP004043.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.053
11dbj|AK062497.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.053
12gb|AE015451.1| Pseudomonas putida KT2440 complete genome 46 0.053
13gb|AC114896.5| Oryza sativa chromosome 3 BAC OSJNBa0091B22 genom... 44 0.21
14gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.21
15emb|X65165.1|VCISGMR V.carteri ISG mRNA for extensin 44 0.21
16ref|NM_132275.1| Drosophila melanogaster lethal (1) G0020 CG1994... 44 0.21
17dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.21
18gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 44 0.21
19gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell ... 44 0.21
20dbj|AK068917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.21
21gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 ... 44 0.21
22ref|XM_463227.1| Oryza sativa (japonica cultivar-group), mRNA 42 0.82
23ref|XM_615109.2| PREDICTED: Bos taurus similar to Nuclear pore g... 42 0.82
24gb|BC014842.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
25gb|BC003663.2| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
26ref|XM_958715.1| Neurospora crassa OR74A hypothetical protein (N... 42 0.82
27ref|XM_331622.1| Neurospora crassa OR74A hypothetical protein (N... 42 0.82
28gb|AC092780.6| Oryza sativa chromosome 3 BAC OSJNBb0079B16 genom... 42 0.82
29gb|BC101107.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
30gb|BC101105.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
31gb|BC101106.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
32gb|BC101104.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
33emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 42 0.82
34gb|BC095410.1| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
35emb|AL162061.1|HSM802592 Homo sapiens mRNA; cDNA DKFZp547L134 (f... 42 0.82
36emb|CR859255.1| Pongo pygmaeus mRNA; cDNA DKFZp459M091 (from clo... 42 0.82
37emb|X58521.1|HSNP62 Human mRNA for p62 nucleoporin 42 0.82
38dbj|AK125857.1| Homo sapiens cDNA FLJ43869 fis, clone TESTI40081... 42 0.82
39ref|NM_012346.3| Homo sapiens nucleoporin 62kDa (NUP62), transcr... 42 0.82
40ref|NM_016553.3| Homo sapiens nucleoporin 62kDa (NUP62), transcr... 42 0.82
41ref|NM_153718.2| Homo sapiens nucleoporin 62kDa (NUP62), transcr... 42 0.82
42ref|NM_153719.2| Homo sapiens nucleoporin 62kDa (NUP62), transcr... 42 0.82
43emb|CR541721.1| Homo sapiens full open reading frame cDNA clone ... 42 0.82
44gb|AC011452.6|AC011452 Homo sapiens chromosome 19 clone CTC-326K... 42 0.82
45dbj|AK000829.1| Homo sapiens cDNA FLJ20822 fis, clone ADSE00292,... 42 0.82
46emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 0.82
47gb|BC050717.2| Homo sapiens nucleoporin 62kDa, transcript varian... 42 0.82
48ref|NM_125665.2| Arabidopsis thaliana TUB3; GTP binding / GTPase... 40 3.3
49ref|NM_125664.2| Arabidopsis thaliana TUB2; GTP binding / GTPase... 40 3.3
50ref|XM_481091.1| Oryza sativa (japonica cultivar-group), mRNA 40 3.3
51gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 3.3
52gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retro... 40 3.3
53gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 3.3
54ref|XM_803442.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 3.3
55emb|BX069434.1|CNS09PQM Single read from an extremity of a full-... 40 3.3
56emb|BX069433.1|CNS09PQL Single read from an extremity of a full-... 40 3.3
57emb|BX067838.1|CNS09OIA Single read from an extremity of a full-... 40 3.3
58emb|BX067837.1|CNS09OI9 Single read from an extremity of a full-... 40 3.3
59emb|BX066396.1|CNS09NE8 Single read from an extremity of a full-... 40 3.3
60emb|BX065766.1|CNS09MWQ Single read from an extremity of a full-... 40 3.3
61emb|BX065648.1|CNS09MTG Single read from an extremity of a full-... 40 3.3
62emb|BX064037.1|CNS09LKP Single read from an extremity of a full-... 40 3.3
63emb|BX062672.1|CNS09KIS Single read from an extremity of a full-... 40 3.3
64emb|BX062671.1|CNS09KIR Single read from an extremity of a full-... 40 3.3
65emb|BX062400.1|CNS09KB8 Single read from an extremity of a full-... 40 3.3
66emb|BX062399.1|CNS09KB7 Single read from an extremity of a full-... 40 3.3
67emb|BX061141.1|CNS09JC9 Single read from an extremity of a full-... 40 3.3
68emb|BX060235.1|CNS09IN3 Single read from an extremity of a full-... 40 3.3
69emb|BX058225.1|CNS09H39 Single read from an extremity of a full-... 40 3.3
70emb|BX057600.1|CNS09GLW Single read from an extremity of a full-... 40 3.3
71emb|BX057599.1|CNS09GLV Single read from an extremity of a full-... 40 3.3
72emb|BX054695.1|CNS09ED7 Single read from an extremity of a full-... 40 3.3
73emb|BX052771.1|CNS09CVR Single read from an extremity of a full-... 40 3.3
74emb|BX051152.1|CNS09BMS Single read from an extremity of a full-... 40 3.3
75emb|BX051151.1|CNS09BMR Single read from an extremity of a full-... 40 3.3
76emb|BX031062.1|CNS08W4Q Single read from an extremity of a full-... 40 3.3
77emb|BX049489.1|CNS09ACL Single read from an extremity of a full-... 40 3.3
78emb|BX049488.1|CNS09ACK Single read from an extremity of a full-... 40 3.3
79emb|BX048965.1|CNS099Y1 Single read from an extremity of a full-... 40 3.3
80emb|BX048827.1|CNS099U7 Single read from an extremity of a full-... 40 3.3
81emb|BX048826.1|CNS099U6 Single read from an extremity of a full-... 40 3.3
82emb|BX048129.1|CNS099AT Single read from an extremity of a full-... 40 3.3
83emb|BX047211.1|CNS098LB Single read from an extremity of a full-... 40 3.3
84emb|BX047210.1|CNS098LA Single read from an extremity of a full-... 40 3.3
85emb|BX046185.1|CNS097ST Single read from an extremity of a full-... 40 3.3
86emb|BX045641.1|CNS097DP Single read from an extremity of a full-... 40 3.3
87emb|BX043262.1|CNS095JM Single read from an extremity of a full-... 40 3.3
88emb|BX043261.1|CNS095JL Single read from an extremity of a full-... 40 3.3
89emb|BX037416.1|CNS09118 Single read from an extremity of a full-... 40 3.3
90emb|BX037415.1|CNS09117 Single read from an extremity of a full-... 40 3.3
91emb|BX037381.1|CNS09109 Single read from an extremity of a full-... 40 3.3
92emb|BX037380.1|CNS09108 Single read from an extremity of a full-... 40 3.3
93emb|BX026237.1|CNS08SEP Single read from an extremity of a full-... 40 3.3
94emb|BX026169.1|CNS08SCT Single read from an extremity of a full-... 40 3.3
95emb|BX025471.1|CNS08RTF Single read from an extremity of a full-... 40 3.3
96emb|BX025470.1|CNS08RTE Single read from an extremity of a full-... 40 3.3
97emb|BX022121.1|CNS08P8D Single read from an extremity of a full-... 40 3.3
98emb|BX021966.1|CNS08P42 Single read from an extremity of a full-... 40 3.3
99emb|BX021965.1|CNS08P41 Single read from an extremity of a full-... 40 3.3
100emb|BX019412.1|CNS08N54 Single read from an extremity of a full-... 40 3.3
101emb|BX019411.1|CNS08N53 Single read from an extremity of a full-... 40 3.3
102emb|BX015928.1|CNS08KGC Single read from an extremity of a full-... 40 3.3
103emb|BX013647.1|CNS08IOZ Single read from an extremity of a full-... 40 3.3
104emb|BX010213.1|CNS08G1L Single read from an extremity of a full-... 40 3.3
105emb|BX010120.1|CNS08FZ0 Single read from an extremity of a full-... 40 3.3
106emb|BX010119.1|CNS08FYZ Single read from an extremity of a full-... 40 3.3
107emb|BX006679.1|CNS08DBF Single read from an extremity of a full-... 40 3.3
108emb|BX006678.1|CNS08DBE Single read from an extremity of a full-... 40 3.3
109emb|BX006638.1|CNS08DAA Single read from an extremity of a full-... 40 3.3
110gb|DQ118124.1| Koi herpesvirus isolate Israel clone replicon 2 g... 40 3.3
111emb|BX470095.12| Zebrafish DNA sequence from clone DKEY-162H1 in... 40 3.3
112gb|AY128785.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain ... 40 3.3
113gb|AF509768.1| Hordeum vulgare subsp. vulgare isolate NRG026 Rpg... 40 3.3
114ref|NM_131384.1| Danio rerio aristaless related homeobox (arx), ... 40 3.3
115dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 3.3
116gb|AF367332.1| Arabidopsis thaliana AT5g62700/MRG21_12 mRNA, com... 40 3.3
117ref|XM_682079.1| PREDICTED: Danio rerio similar to Arx homeoprot... 40 3.3
118gb|AY062742.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain ... 40 3.3
119gb|AY062614.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain ... 40 3.3
120gb|AY060550.1| Arabidopsis thaliana AT5g62700/MRG21_12 mRNA, com... 40 3.3
121gb|AY056411.1| Arabidopsis thaliana AT5g62690/MRG21_11 mRNA, com... 40 3.3
122dbj|AK221201.1| Arabidopsis thaliana mRNA for tubulin beta-2/bet... 40 3.3
123gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 3.3
124dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
125dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
126emb|BX832979.1|CNS09Z2T Arabidopsis thaliana Full-length cDNA Co... 40 3.3
127gb|AY087859.1| Arabidopsis thaliana clone 39002 mRNA, complete s... 40 3.3
128gb|BT002587.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain ... 40 3.3
129dbj|AP003575.2| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
130dbj|AB020751.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.3
131dbj|AB009053.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.3
132dbj|AK117431.1| Arabidopsis thaliana At5g62690 mRNA for putative... 40 3.3
133dbj|AP005095.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.3
134emb|X53609.1|ZDZEAR260 Z.diploperennis repetitive DNA (clone ZEA... 40 3.3
135ref|XM_317504.2| Anopheles gambiae str. PEST ENSANGP00000010167 ... 40 3.3
136dbj|AK108529.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.3
137gb|AY109262.1| Zea mays PCO104376 mRNA sequence 40 3.3
138gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 3.3
139emb|BX004786.8| Zebrafish DNA sequence from clone DKEY-1P6 in li... 40 3.3
140gb|M84701.1|ATHTUB3B Arabidopsis thaliana bete-3 tubulin (TUB3) ... 40 3.3
141gb|M84700.1|ATHTUB2B Arabidopsis thaliana beta-2 tubulin (TUB2) ... 40 3.3
142dbj|AB006104.1| Danio rerio mRNA for Arx homeoprotein, complete cds 40 3.3

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  333 bits (168), Expect = 2e-88
 Identities = 192/200 (96%)
 Strand = Plus / Plus

                                                                           
Query: 53      ggcgaggatgaggaagaaggtggacgagcgcatccgcacgctgatcgagaatggcgtgcg 112
               |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 3587237 ggcgaggatgaggaagaaggtggacgagcgcatccggacgctgatcgagaacggcgtgcg 3587296

                                                                           
Query: 113     gcagcggcagcggtccatgttcatcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 172
               | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 3587297 ggagcggcagcggtccatgttcgtcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 3587356

                                                                           
Query: 173     cctcaactacatgctggccaagtcccgcgtcaagtcgcgcccctccgtgctctggtgcta 232
               ||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 3587357 cctcaactacatgctcgccaagtcccgcgtcaagtcccgcccctccgtcctctggtgcta 3587416

                                   
Query: 233     ccgcaacaagctcgagatca 252
               |||| |||||||||||||||
Sbjct: 3587417 ccgcgacaagctcgagatca 3587436



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  333 bits (168), Expect = 2e-88
 Identities = 192/200 (96%)
 Strand = Plus / Plus

                                                                           
Query: 53      ggcgaggatgaggaagaaggtggacgagcgcatccgcacgctgatcgagaatggcgtgcg 112
               |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 3587182 ggcgaggatgaggaagaaggtggacgagcgcatccggacgctgatcgagaacggcgtgcg 3587241

                                                                           
Query: 113     gcagcggcagcggtccatgttcatcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 172
               | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 3587242 ggagcggcagcggtccatgttcgtcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 3587301

                                                                           
Query: 173     cctcaactacatgctggccaagtcccgcgtcaagtcgcgcccctccgtgctctggtgcta 232
               ||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 3587302 cctcaactacatgctcgccaagtcccgcgtcaagtcccgcccctccgtcctctggtgcta 3587361

                                   
Query: 233     ccgcaacaagctcgagatca 252
               |||| |||||||||||||||
Sbjct: 3587362 ccgcgacaagctcgagatca 3587381



to top

>emb|AL731761.3|CNS07YPV Oryza sativa chromosome 12, . BAC OJ1119_B11 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 122128

 Score =  333 bits (168), Expect = 2e-88
 Identities = 192/200 (96%)
 Strand = Plus / Minus

                                                                          
Query: 53     ggcgaggatgaggaagaaggtggacgagcgcatccgcacgctgatcgagaatggcgtgcg 112
              |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 102191 ggcgaggatgaggaagaaggtggacgagcgcatccggacgctgatcgagaacggcgtgcg 102132

                                                                          
Query: 113    gcagcggcagcggtccatgttcatcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 172
              | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 102131 ggagcggcagcggtccatgttcgtcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 102072

                                                                          
Query: 173    cctcaactacatgctggccaagtcccgcgtcaagtcgcgcccctccgtgctctggtgcta 232
              ||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 102071 cctcaactacatgctcgccaagtcccgcgtcaagtcccgcccctccgtcctctggtgcta 102012

                                  
Query: 233    ccgcaacaagctcgagatca 252
              |||| |||||||||||||||
Sbjct: 102011 ccgcgacaagctcgagatca 101992



to top

>emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007_H06 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 103647

 Score =  333 bits (168), Expect = 2e-88
 Identities = 192/200 (96%)
 Strand = Plus / Plus

                                                                          
Query: 53     ggcgaggatgaggaagaaggtggacgagcgcatccgcacgctgatcgagaatggcgtgcg 112
              |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 102165 ggcgaggatgaggaagaaggtggacgagcgcatccggacgctgatcgagaacggcgtgcg 102224

                                                                          
Query: 113    gcagcggcagcggtccatgttcatcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 172
              | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 102225 ggagcggcagcggtccatgttcgtcatcgtcggcgacaagtcgcgcgaccagatcgtcaa 102284

                                                                          
Query: 173    cctcaactacatgctggccaagtcccgcgtcaagtcgcgcccctccgtgctctggtgcta 232
              ||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 102285 cctcaactacatgctcgccaagtcccgcgtcaagtcccgcccctccgtcctctggtgcta 102344

                                  
Query: 233    ccgcaacaagctcgagatca 252
              |||| |||||||||||||||
Sbjct: 102345 ccgcgacaagctcgagatca 102364



to top

>gb|BT010228.1| Drosophila melanogaster RE64686 full insert cDNA
          Length = 3242

 Score = 52.0 bits (26), Expect = 9e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 127 ccatgttcatcatcgtcggcgacaagtcgcgcgaccag 164
           |||||||||||||| |||| |||||| |||||||||||
Sbjct: 165 ccatgttcatcatcatcggggacaaggcgcgcgaccag 202



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 77    cgagcgcatccgcacgctgatcga 100
             ||||||||||||||||||||||||
Sbjct: 16826 cgagcgcatccgcacgctgatcga 16849



to top

>ref|XM_468519.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 492

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 43  ggcgggcggcggcgaggatgagg 65
           |||||||||||||||||||||||
Sbjct: 127 ggcgggcggcggcgaggatgagg 105



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 43       ggcgggcggcggcgaggatgagg 65
                |||||||||||||||||||||||
Sbjct: 35640603 ggcgggcggcggcgaggatgagg 35640625



to top

>dbj|AP004776.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0452F04
          Length = 171421

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 43     ggcgggcggcggcgaggatgagg 65
              |||||||||||||||||||||||
Sbjct: 156995 ggcgggcggcggcgaggatgagg 157017



to top

>dbj|AP004043.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1124_D06
          Length = 102239

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 43   ggcgggcggcggcgaggatgagg 65
            |||||||||||||||||||||||
Sbjct: 1217 ggcgggcggcggcgaggatgagg 1239



to top

>dbj|AK062497.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A03, full
           insert sequence
          Length = 492

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 43  ggcgggcggcggcgaggatgagg 65
           |||||||||||||||||||||||
Sbjct: 127 ggcgggcggcggcgaggatgagg 105



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 46.1 bits (23), Expect = 0.053
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 89      cacgctgatcgagaatggcgtgc 111
               |||||||||||||||||||||||
Sbjct: 1085981 cacgctgatcgagaatggcgtgc 1086003



to top

>gb|AC114896.5| Oryza sativa chromosome 3 BAC OSJNBa0091B22 genomic sequence, complete
             sequence
          Length = 115815

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 47    ggcggcggcgaggatgaggaag 68
             ||||||||||||||||||||||
Sbjct: 63554 ggcggcggcgaggatgaggaag 63575



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 47       ggcggcggcgaggatgaggaag 68
                ||||||||||||||||||||||
Sbjct: 17828561 ggcggcggcgaggatgaggaag 17828540



 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 46       gggcggcggcgaggatgagga 66
                |||||||||||||||||||||
Sbjct: 23544536 gggcggcggcgaggatgagga 23544556



to top

>emb|X65165.1|VCISGMR V.carteri ISG mRNA for extensin
          Length = 1395

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 43  ggcgggcggcggcgaggatgag 64
           ||||||||||||||||||||||
Sbjct: 735 ggcgggcggcggcgaggatgag 714



to top

>ref|NM_132275.1| Drosophila melanogaster lethal (1) G0020 CG1994-RA (l(1)G0020),
           mRNA
          Length = 3211

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 127 ccatgttcatcatcgtcggcgacaagtcgcgcgaccag 164
           ||||||||||| || |||| |||||| |||||||||||
Sbjct: 149 ccatgttcatcgtcatcggggacaaggcgcgcgaccag 186



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 47       ggcggcggcgaggatgaggaag 68
                ||||||||||||||||||||||
Sbjct: 17822102 ggcggcggcgaggatgaggaag 17822081



 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 46       gggcggcggcgaggatgagga 66
                |||||||||||||||||||||
Sbjct: 23537564 gggcggcggcgaggatgagga 23537584



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 79      agcgcatccgcacgctgatcga 100
               ||||||||||||||||||||||
Sbjct: 2545384 agcgcatccgcacgctgatcga 2545363



 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 48      gcggcggcgaggatgaggaa 67
               ||||||||||||||||||||
Sbjct: 2599277 gcggcggcgaggatgaggaa 2599296



to top

>gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181974

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 127    ccatgttcatcatcgtcggcgacaagtcgcgcgaccag 164
              ||||||||||| || |||| |||||| |||||||||||
Sbjct: 149078 ccatgttcatcgtcatcggggacaaggcgcgcgaccag 149115



to top

>dbj|AK068917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023002L14, full
           insert sequence
          Length = 1811

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 47  ggcggcggcgaggatgaggaag 68
           ||||||||||||||||||||||
Sbjct: 169 ggcggcggcgaggatgaggaag 148



to top

>gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 of 74 of the
            complete sequence
          Length = 334222

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 127  ccatgttcatcatcgtcggcgacaagtcgcgcgaccag 164
            ||||||||||| || |||| |||||| |||||||||||
Sbjct: 5245 ccatgttcatcgtcatcggggacaaggcgcgcgaccag 5208



to top

>ref|XM_463227.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 498

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 46  gggcggcggcgaggatgagga 66
           |||||||||||||||||||||
Sbjct: 445 gggcggcggcgaggatgagga 425



to top

>ref|XM_615109.2| PREDICTED: Bos taurus similar to Nuclear pore glycoprotein p62 (62
            kDa nucleoporin) (LOC541219), mRNA
          Length = 2743

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1307 ccgcacgctgatcgagaatgg 1327



to top

>gb|BC014842.1| Homo sapiens nucleoporin 62kDa, transcript variant 4, mRNA (cDNA
            clone MGC:21169 IMAGE:4499630), complete cds
          Length = 2349

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1166 ccgcacgctgatcgagaatgg 1186



to top

>gb|BC003663.2| Homo sapiens nucleoporin 62kDa, transcript variant 1, mRNA (cDNA
            clone MGC:841 IMAGE:3050260), complete cds
          Length = 2059

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1418 ccgcacgctgatcgagaatgg 1438



to top

>ref|XM_958715.1| Neurospora crassa OR74A hypothetical protein (NCU09231.1) partial
           mRNA
          Length = 1086

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 46  gggcggcggcgaggatgaggaagaaggtg 74
           ||||||||||||||| |||||||| ||||
Sbjct: 316 gggcggcggcgaggaggaggaagacggtg 288



to top

>ref|XM_331622.1| Neurospora crassa OR74A hypothetical protein (NCU09231.1) partial
           mRNA
          Length = 1086

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 46  gggcggcggcgaggatgaggaagaaggtg 74
           ||||||||||||||| |||||||| ||||
Sbjct: 316 gggcggcggcgaggaggaggaagacggtg 288



to top

>gb|AC092780.6| Oryza sativa chromosome 3 BAC OSJNBb0079B16 genomic sequence, complete
             sequence
          Length = 144383

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 46    gggcggcggcgaggatgagga 66
             |||||||||||||||||||||
Sbjct: 37721 gggcggcggcgaggatgagga 37701



to top

>gb|BC101107.1| Homo sapiens nucleoporin 62kDa, transcript variant 1, mRNA (cDNA
            clone MGC:119677 IMAGE:40011540), complete cds
          Length = 2197

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1436 ccgcacgctgatcgagaatgg 1456



to top

>gb|BC101105.1| Homo sapiens nucleoporin 62kDa, transcript variant 2, mRNA (cDNA
            clone MGC:119675 IMAGE:40011537), complete cds
          Length = 2164

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1403 ccgcacgctgatcgagaatgg 1423



to top

>gb|BC101106.1| Homo sapiens nucleoporin 62kDa, transcript variant 4, mRNA (cDNA
            clone MGC:119676 IMAGE:40011539), complete cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1190 ccgcacgctgatcgagaatgg 1210



to top

>gb|BC101104.1| Homo sapiens nucleoporin 62kDa, transcript variant 3, mRNA (cDNA
            clone MGC:119674 IMAGE:40011533), complete cds
          Length = 2042

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1281 ccgcacgctgatcgagaatgg 1301



to top

>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 46   gggcggcggcgaggatgaggaagaaggtg 74
            ||||||||||||||| |||||||| ||||
Sbjct: 6620 gggcggcggcgaggaggaggaagacggtg 6592



to top

>gb|BC095410.1| Homo sapiens nucleoporin 62kDa, transcript variant 2, mRNA (cDNA
            clone MGC:110906 IMAGE:30335030), complete cds
          Length = 2629

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1450 ccgcacgctgatcgagaatgg 1470



to top

>emb|AL162061.1|HSM802592 Homo sapiens mRNA; cDNA DKFZp547L134 (from clone DKFZp547L134)
          Length = 3200

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1291 ccgcacgctgatcgagaatgg 1311



to top

>emb|CR859255.1| Pongo pygmaeus mRNA; cDNA DKFZp459M091 (from clone DKFZp459M091)
          Length = 3328

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1357 ccgcacgctgatcgagaatgg 1377



to top

>emb|X58521.1|HSNP62 Human mRNA for p62 nucleoporin
          Length = 1840

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1237 ccgcacgctgatcgagaatgg 1257



to top

>dbj|AK125857.1| Homo sapiens cDNA FLJ43869 fis, clone TESTI4008176, highly  similar
            to Homo sapiens nucleoporin 62kDa (NUP62)
          Length = 3591

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 2975 ccgcacgctgatcgagaatgg 2995



to top

>ref|NM_012346.3| Homo sapiens nucleoporin 62kDa (NUP62), transcript variant 4, mRNA
          Length = 3253

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1343 ccgcacgctgatcgagaatgg 1363



to top

>ref|NM_016553.3| Homo sapiens nucleoporin 62kDa (NUP62), transcript variant 2, mRNA
          Length = 3399

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1489 ccgcacgctgatcgagaatgg 1509



to top

>ref|NM_153718.2| Homo sapiens nucleoporin 62kDa (NUP62), transcript variant 3, mRNA
          Length = 3277

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1367 ccgcacgctgatcgagaatgg 1387



to top

>ref|NM_153719.2| Homo sapiens nucleoporin 62kDa (NUP62), transcript variant 1, mRNA
          Length = 3432

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1522 ccgcacgctgatcgagaatgg 1542



to top

>emb|CR541721.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0729D for
            gene NUP62, nucleoporin 62kDa; complete cds, without
            stopcodon
          Length = 1566

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1086 ccgcacgctgatcgagaatgg 1106



to top

>gb|AC011452.6|AC011452 Homo sapiens chromosome 19 clone CTC-326K19, complete sequence
          Length = 146741

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 86    ccgcacgctgatcgagaatgg 106
             |||||||||||||||||||||
Sbjct: 15226 ccgcacgctgatcgagaatgg 15206



to top

>dbj|AK000829.1| Homo sapiens cDNA FLJ20822 fis, clone ADSE00292, highly similar to
            X58521 Human mRNA for p62 nucleoporin
          Length = 2642

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1459 ccgcacgctgatcgagaatgg 1479



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 80      gcgcatccgcacgctgatcgagaatggcg 108
               |||||||  ||||||||||||||||||||
Sbjct: 5076535 gcgcatcaccacgctgatcgagaatggcg 5076507



to top

>gb|BC050717.2| Homo sapiens nucleoporin 62kDa, transcript variant 3, mRNA (cDNA
            clone MGC:60330 IMAGE:6021336), complete cds
          Length = 2476

 Score = 42.1 bits (21), Expect = 0.82
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 86   ccgcacgctgatcgagaatgg 106
            |||||||||||||||||||||
Sbjct: 1292 ccgcacgctgatcgagaatgg 1312



to top

>ref|NM_125665.2| Arabidopsis thaliana TUB3; GTP binding / GTPase/ structural molecule
            AT5G62700 (TUB3) mRNA, complete cds
          Length = 1741

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1411 cgaggatgaggaagaaggtg 1430



to top

>ref|NM_125664.2| Arabidopsis thaliana TUB2; GTP binding / GTPase/ structural molecule
            AT5G62690 (TUB2) mRNA, complete cds
          Length = 1722

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1449 cgaggatgaggaagaaggtg 1468



to top

>ref|XM_481091.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  ggcggcggcgaggatgagga 66
           ||||||||||||||||||||
Sbjct: 291 ggcggcggcgaggatgagga 272



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 143     cggcgacaagtcgcgcgacc 162
               ||||||||||||||||||||
Sbjct: 1022490 cggcgacaagtcgcgcgacc 1022471



to top

>gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retrotransposon grande1,
             xilon1 retrotransposon, helitron B73_14578, gypsy
             retrotransposon huck1 and ruda retrotransposon, complete
             sequence
          Length = 152384

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggcggcggcgaggatgagga 66
             ||||||||||||||||||||
Sbjct: 67639 ggcggcggcgaggatgagga 67658



to top

>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 73     tggacgagcgcatccgcacgctga 96
              |||||| |||||||||||||||||
Sbjct: 998781 tggacgcgcgcatccgcacgctga 998758



to top

>ref|XM_803442.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053505163.40) partial mRNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 56  gaggatgaggaagaaggtgg 75
           ||||||||||||||||||||
Sbjct: 760 gaggatgaggaagaaggtgg 779



to top

>emb|BX069434.1|CNS09PQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 791 cgtcggcgacaagtcgcgcg 772



to top

>emb|BX069433.1|CNS09PQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 507 cgtcggcgacaagtcgcgcg 526



to top

>emb|BX067838.1|CNS09OIA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 771 cgtcggcgacaagtcgcgcg 752



to top

>emb|BX067837.1|CNS09OI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 501 cgtcggcgacaagtcgcgcg 520



to top

>emb|BX066396.1|CNS09NE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 437 cgtcggcgacaagtcgcgcg 456



to top

>emb|BX065766.1|CNS09MWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 290 cgtcggcgacaagtcgcgcg 309



to top

>emb|BX065648.1|CNS09MTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 492 cgtcggcgacaagtcgcgcg 511



to top

>emb|BX064037.1|CNS09LKP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 493 cgtcggcgacaagtcgcgcg 512



to top

>emb|BX062672.1|CNS09KIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 768 cgtcggcgacaagtcgcgcg 749



to top

>emb|BX062671.1|CNS09KIR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 521 cgtcggcgacaagtcgcgcg 540



to top

>emb|BX062400.1|CNS09KB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 769 cgtcggcgacaagtcgcgcg 750



to top

>emb|BX062399.1|CNS09KB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 495 cgtcggcgacaagtcgcgcg 514



to top

>emb|BX061141.1|CNS09JC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 521 cgtcggcgacaagtcgcgcg 540



to top

>emb|BX060235.1|CNS09IN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 411 cgtcggcgacaagtcgcgcg 430



to top

>emb|BX058225.1|CNS09H39 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 513 cgtcggcgacaagtcgcgcg 532



to top

>emb|BX057600.1|CNS09GLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 804 cgtcggcgacaagtcgcgcg 785



to top

>emb|BX057599.1|CNS09GLV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 406 cgtcggcgacaagtcgcgcg 425



to top

>emb|BX054695.1|CNS09ED7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 490 cgtcggcgacaagtcgcgcg 509



to top

>emb|BX052771.1|CNS09CVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 502 cgtcggcgacaagtcgcgcg 521



to top

>emb|BX051152.1|CNS09BMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 487

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 414 cgtcggcgacaagtcgcgcg 395



to top

>emb|BX051151.1|CNS09BMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 466 cgtcggcgacaagtcgcgcg 485



to top

>emb|BX031062.1|CNS08W4Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 474

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 438 cgtcggcgacaagtcgcgcg 457



to top

>emb|BX049489.1|CNS09ACL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 789 cgtcggcgacaagtcgcgcg 770



to top

>emb|BX049488.1|CNS09ACK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 490 cgtcggcgacaagtcgcgcg 509



to top

>emb|BX048965.1|CNS099Y1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 479 cgtcggcgacaagtcgcgcg 498



to top

>emb|BX048827.1|CNS099U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 752 cgtcggcgacaagtcgcgcg 733



to top

>emb|BX048826.1|CNS099U6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 456 cgtcggcgacaagtcgcgcg 475



to top

>emb|BX048129.1|CNS099AT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 570 cgtcggcgacaagtcgcgcg 589



to top

>emb|BX047211.1|CNS098LB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 759 cgtcggcgacaagtcgcgcg 740



to top

>emb|BX047210.1|CNS098LA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 181 cgtcggcgacaagtcgcgcg 200



to top

>emb|BX046185.1|CNS097ST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 497 cgtcggcgacaagtcgcgcg 516



to top

>emb|BX045641.1|CNS097DP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 486 cgtcggcgacaagtcgcgcg 505



to top

>emb|BX043262.1|CNS095JM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 789 cgtcggcgacaagtcgcgcg 770



to top

>emb|BX043261.1|CNS095JL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 517 cgtcggcgacaagtcgcgcg 536



to top

>emb|BX037416.1|CNS09118 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 441 cgtcggcgacaagtcgcgcg 422



to top

>emb|BX037415.1|CNS09117 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 511 cgtcggcgacaagtcgcgcg 530



to top

>emb|BX037381.1|CNS09109 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 765 cgtcggcgacaagtcgcgcg 746



to top

>emb|BX037380.1|CNS09108 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 503 cgtcggcgacaagtcgcgcg 522



to top

>emb|BX026237.1|CNS08SEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 635

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 509 cgtcggcgacaagtcgcgcg 528



to top

>emb|BX026169.1|CNS08SCT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 512 cgtcggcgacaagtcgcgcg 531



to top

>emb|BX025471.1|CNS08RTF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 772 cgtcggcgacaagtcgcgcg 753



to top

>emb|BX025470.1|CNS08RTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 498 cgtcggcgacaagtcgcgcg 517



to top

>emb|BX022121.1|CNS08P8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 540 cgtcggcgacaagtcgcgcg 559



to top

>emb|BX021966.1|CNS08P42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 748 cgtcggcgacaagtcgcgcg 729



to top

>emb|BX021965.1|CNS08P41 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 487 cgtcggcgacaagtcgcgcg 506



to top

>emb|BX019412.1|CNS08N54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 772 cgtcggcgacaagtcgcgcg 753



to top

>emb|BX019411.1|CNS08N53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 497 cgtcggcgacaagtcgcgcg 516



to top

>emb|BX015928.1|CNS08KGC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 762 cgtcggcgacaagtcgcgcg 743



to top

>emb|BX013647.1|CNS08IOZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 499 cgtcggcgacaagtcgcgcg 518



to top

>emb|BX010213.1|CNS08G1L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 487 cgtcggcgacaagtcgcgcg 506



to top

>emb|BX010120.1|CNS08FZ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 770 cgtcggcgacaagtcgcgcg 751



to top

>emb|BX010119.1|CNS08FYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 491 cgtcggcgacaagtcgcgcg 510



to top

>emb|BX006679.1|CNS08DBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 706

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 506 cgtcggcgacaagtcgcgcg 487



to top

>emb|BX006678.1|CNS08DBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 349 cgtcggcgacaagtcgcgcg 368



to top

>emb|BX006638.1|CNS08DAA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 741 cgtcggcgacaagtcgcgcg 722



to top

>gb|DQ118124.1| Koi herpesvirus isolate Israel clone replicon 2 genomic sequence
          Length = 1230

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 70  aggtggacgagcgcatccgcacgc 93
           |||||||||||| |||||||||||
Sbjct: 605 aggtggacgagctcatccgcacgc 628



to top

>emb|BX470095.12| Zebrafish DNA sequence from clone DKEY-162H1 in linkage group 24,
              complete sequence
          Length = 209513

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     gaggatgaggaagaaggtgg 75
              ||||||||||||||||||||
Sbjct: 181555 gaggatgaggaagaaggtgg 181574



to top

>gb|AY128785.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain (At5g62690) mRNA,
            complete cds
          Length = 1441

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1308 cgaggatgaggaagaaggtg 1327



to top

>gb|AF509768.1| Hordeum vulgare subsp. vulgare isolate NRG026 Rpg1 region, genomic
            sequence
          Length = 5371

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 133  tcatcatcgtcggcgacaag 152
            ||||||||||||||||||||
Sbjct: 2028 tcatcatcgtcggcgacaag 2009



to top

>ref|NM_131384.1| Danio rerio aristaless related homeobox (arx), mRNA
          Length = 1414

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 56   gaggatgaggaagaaggtgg 75
            ||||||||||||||||||||
Sbjct: 1238 gaggatgaggaagaaggtgg 1219



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 196     cccgcgtcaagtcgcgcccc 215
               ||||||||||||||||||||
Sbjct: 4352915 cccgcgtcaagtcgcgcccc 4352934



to top

>gb|AF367332.1| Arabidopsis thaliana AT5g62700/MRG21_12 mRNA, complete cds
          Length = 1737

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1406 cgaggatgaggaagaaggtg 1425



to top

>ref|XM_682079.1| PREDICTED: Danio rerio similar to Arx homeoprotein (LOC572891), mRNA
          Length = 1490

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 56   gaggatgaggaagaaggtgg 75
            ||||||||||||||||||||
Sbjct: 1320 gaggatgaggaagaaggtgg 1301



to top

>gb|AY062742.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain (MRG21.11) mRNA,
            complete cds
          Length = 1686

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1449 cgaggatgaggaagaaggtg 1468



to top

>gb|AY062614.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain (MRG21.11) mRNA,
            complete cds
          Length = 1647

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1400 cgaggatgaggaagaaggtg 1419



to top

>gb|AY060550.1| Arabidopsis thaliana AT5g62700/MRG21_12 mRNA, complete cds
          Length = 1652

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1410 cgaggatgaggaagaaggtg 1429



to top

>gb|AY056411.1| Arabidopsis thaliana AT5g62690/MRG21_11 mRNA, complete cds
          Length = 1656

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1419 cgaggatgaggaagaaggtg 1438



to top

>dbj|AK221201.1| Arabidopsis thaliana mRNA for tubulin beta-2/beta-3 chain, complete
           cds, clone: RAFL23-06-F17
          Length = 867

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  cgaggatgaggaagaaggtg 74
           ||||||||||||||||||||
Sbjct: 621 cgaggatgaggaagaaggtg 640



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 42      cggcgggcggcggcgaggat 61
               ||||||||||||||||||||
Sbjct: 3678111 cggcgggcggcggcgaggat 3678092



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 47      ggcggcggcgaggatgagga 66
               ||||||||||||||||||||
Sbjct: 9780289 ggcggcggcgaggatgagga 9780308



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 40      accggcgggcggcggcgagg 59
               ||||||||||||||||||||
Sbjct: 8936676 accggcgggcggcggcgagg 8936657



to top

>emb|BX832979.1|CNS09Z2T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL27ZG06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 358

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  cgaggatgaggaagaaggtg 74
           ||||||||||||||||||||
Sbjct: 154 cgaggatgaggaagaaggtg 173



to top

>gb|AY087859.1| Arabidopsis thaliana clone 39002 mRNA, complete sequence
          Length = 1645

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1398 cgaggatgaggaagaaggtg 1417



to top

>gb|BT002587.1| Arabidopsis thaliana tubulin beta-2/beta-3 chain (At5g62690) mRNA,
            complete cds
          Length = 1442

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1308 cgaggatgaggaagaaggtg 1327



to top

>dbj|AP003575.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0528B02
          Length = 144495

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     accggcgggcggcggcgagg 59
              ||||||||||||||||||||
Sbjct: 102305 accggcgggcggcggcgagg 102286



to top

>dbj|AB020751.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG21
          Length = 55151

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    cgaggatgaggaagaaggtg 74
             ||||||||||||||||||||
Sbjct: 53243 cgaggatgaggaagaaggtg 53262



to top

>dbj|AB009053.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2
          Length = 78145

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1017 cgaggatgaggaagaaggtg 1036



to top

>dbj|AK117431.1| Arabidopsis thaliana At5g62690 mRNA for putative tubulin
            beta-2/beta-3 chain, complete cds, clone: RAFL17-03-K20
          Length = 2406

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 1399 cgaggatgaggaagaaggtg 1418



to top

>dbj|AP005095.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:B1063H10
          Length = 170453

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggcggcggcgaggatgagga 66
             ||||||||||||||||||||
Sbjct: 44221 ggcggcggcgaggatgagga 44240



to top

>emb|X53609.1|ZDZEAR260 Z.diploperennis repetitive DNA (clone ZEAR 260)
          Length = 260

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 47 ggcggcggcgaggatgagga 66
          ||||||||||||||||||||
Sbjct: 69 ggcggcggcgaggatgagga 88



to top

>ref|XM_317504.2| Anopheles gambiae str. PEST ENSANGP00000010167
           (ENSANGG00000007678), partial mRNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 cgtcggcgacaagtcgcgcg 159
           ||||||||||||||||||||
Sbjct: 558 cgtcggcgacaagtcgcgcg 577



to top

>dbj|AK108529.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-144-B12, full
           insert sequence
          Length = 1090

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  ggcggcggcgaggatgagga 66
           ||||||||||||||||||||
Sbjct: 291 ggcggcggcgaggatgagga 272



to top

>gb|AY109262.1| Zea mays PCO104376 mRNA sequence
          Length = 578

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 46  gggcggcggcgaggatgagg 65
           ||||||||||||||||||||
Sbjct: 266 gggcggcggcgaggatgagg 247



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 85      tccgcacgctgatcgagaatggcg 108
               ||||||||||||||||| ||||||
Sbjct: 1433809 tccgcacgctgatcgagcatggcg 1433832



to top

>emb|BX004786.8| Zebrafish DNA sequence from clone DKEY-1P6 in linkage group 24, complete
              sequence
          Length = 178232

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     gaggatgaggaagaaggtgg 75
              ||||||||||||||||||||
Sbjct: 139105 gaggatgaggaagaaggtgg 139124



to top

>gb|M84701.1|ATHTUB3B Arabidopsis thaliana bete-3 tubulin (TUB3) gene, complete cds
          Length = 2764

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 2381 cgaggatgaggaagaaggtg 2400



to top

>gb|M84700.1|ATHTUB2B Arabidopsis thaliana beta-2 tubulin (TUB2) gene, complete cds
          Length = 2699

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   cgaggatgaggaagaaggtg 74
            ||||||||||||||||||||
Sbjct: 2155 cgaggatgaggaagaaggtg 2174



to top

>dbj|AB006104.1| Danio rerio mRNA for Arx homeoprotein, complete cds
          Length = 1414

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 56   gaggatgaggaagaaggtgg 75
            ||||||||||||||||||||
Sbjct: 1238 gaggatgaggaagaaggtgg 1219


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,012,905
Number of Sequences: 3902068
Number of extensions: 2012905
Number of successful extensions: 62869
Number of sequences better than 10.0: 142
Number of HSP's better than 10.0 without gapping: 144
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61590
Number of HSP's gapped (non-prelim): 1279
length of query: 252
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 230
effective length of database: 17,147,199,772
effective search space: 3943855947560
effective search space used: 3943855947560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top