ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl33b05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK121389.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 1e-22
2gb|AY111935.1| Zea mays CL5916_1 mRNA sequence 94 1e-16
3gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome... 88 6e-15
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 88 6e-15
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 88 6e-15
6gb|AC137076.1| Genomic sequence for Oryza sativa, Nipponbare str... 88 6e-15
7ref|NM_129738.3| Arabidopsis thaliana VLN2 (VILLIN 2); actin bin... 54 9e-05
8gb|AY133782.1| Arabidopsis thaliana clone U11765 putative villin... 54 9e-05
9gb|AY080601.1| Arabidopsis thaliana putative villin 2 protein (A... 54 9e-05
10gb|AF081202.1|AF081202 Arabidopsis thaliana villin 2 (VLN2) mRNA... 54 9e-05
11gb|AF088901.1|AF088901 Lilium longiflorum actin bundling protein... 46 0.022
12ref|NM_115601.2| Arabidopsis thaliana VLN3 (VILLIN 3); actin bin... 42 0.34
13ref|XM_759363.1| Theileria parva strain Muguga chromosome 4 hypo... 42 0.34
14gb|AY128932.1| Arabidopsis thaliana unknown protein (At3g57410) ... 42 0.34
15gb|AY093052.1| Arabidopsis thaliana unknown protein (At3g57410) ... 42 0.34
16gb|AF081203.1|AF081203 Arabidopsis thaliana villin 3 (VLN3) mRNA... 42 0.34
17emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BA... 40 1.3
18gb|AC009930.7| Homo sapiens chromosome 8, clone RP11-114O8, comp... 40 1.3
19gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complet... 40 1.3
20gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 38 5.3
21gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, co... 38 5.3
22emb|Z99531.1|SPAC19D5 S.pombe chromosome I cosmid c19D5 38 5.3
23gb|AY676137.1| Euprymna scolopes bone morphogenic protein 2/4 mR... 38 5.3
24ref|NM_001020331.1| Schizosaccharomyces pombe 972h- hypothetical... 38 5.3 
>dbj|AK121389.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128M19, full
           insert sequence
          Length = 3343

 Score =  113 bits (57), Expect = 1e-22
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                       
Query: 25  gtgtgtgatgttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaa 84
           |||||||||||||| || ||||||||||| ||| | ||||| |||||||| |||||||||
Sbjct: 794 gtgtgtgatgttgcgattgttgatgatggaaaattgcaagcagaatcagattctggtgaa 853

                                        
Query: 85  ttctgggtcctttttggaggttttgcacc 113
           |||||||| ||||||||||||||||||||
Sbjct: 854 ttctgggttctttttggaggttttgcacc 882
to top
>gb|AY111935.1| Zea mays CL5916_1 mRNA sequence
          Length = 504

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   ttaaaggagaagtaccatgggggcgtgtgtgatgttgcaatcgttgatgatgggaaacta 60
           ||||||||| | |||||||  || ||||| | ||||||||||||||||||||||||||| 
Sbjct: 84  ttaaaggaggaataccatgacggagtgtgcgctgttgcaatcgttgatgatgggaaactg 143

                                                             
Query: 61  caagcggaatcagactctggtgaattctgggtcctttttggaggttttgc 110
           ||||| |||||||| || || |||||||||||||     |||||||||||
Sbjct: 144 caagcagaatcagattcaggagaattctgggtccnnnnnggaggttttgc 193
to top
>gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0087D01, complete sequence
          Length = 83225

 Score = 87.7 bits (44), Expect = 6e-15
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                         
Query: 46    gatgatgggaaactacaagcggaatcagactctggtgaattctgggtcctttttggaggt 105
             |||||||| ||| | ||||| |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 80510 gatgatggaaaattgcaagcagaatcagattctggtgaattctgggttctttttggaggt 80569

                     
Query: 106   tttgcacc 113
             ||||||||
Sbjct: 80570 tttgcacc 80577
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 87.7 bits (44), Expect = 6e-15
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                            
Query: 46       gatgatgggaaactacaagcggaatcagactctggtgaattctgggtcctttttggaggt 105
                |||||||| ||| | ||||| |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 13617755 gatgatggaaaattgcaagcagaatcagattctggtgaattctgggttctttttggaggt 13617814

                        
Query: 106      tttgcacc 113
                ||||||||
Sbjct: 13617815 tttgcacc 13617822
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 87.7 bits (44), Expect = 6e-15
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                            
Query: 46       gatgatgggaaactacaagcggaatcagactctggtgaattctgggtcctttttggaggt 105
                |||||||| ||| | ||||| |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 13612730 gatgatggaaaattgcaagcagaatcagattctggtgaattctgggttctttttggaggt 13612789

                        
Query: 106      tttgcacc 113
                ||||||||
Sbjct: 13612790 tttgcacc 13612797
to top
>gb|AC137076.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBb0033D20, from chromosome 3, complete sequence
          Length = 128707

 Score = 87.7 bits (44), Expect = 6e-15
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                        
Query: 46   gatgatgggaaactacaagcggaatcagactctggtgaattctgggtcctttttggaggt 105
            |||||||| ||| | ||||| |||||||| ||||||||||||||||| ||||||||||||
Sbjct: 8427 gatgatggaaaattgcaagcagaatcagattctggtgaattctgggttctttttggaggt 8486

                    
Query: 106  tttgcacc 113
            ||||||||
Sbjct: 8487 tttgcacc 8494
to top
>ref|NM_129738.3| Arabidopsis thaliana VLN2 (VILLIN 2); actin binding AT2G41740
           (VLN2) mRNA, complete cds
          Length = 3390

 Score = 54.0 bits (27), Expect = 9e-05
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  tgtgatgttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattc 87
           ||||||||||| || |||||||| || ||| || |  | |||||||| ||||||| ||| 
Sbjct: 828 tgtgatgttgcgattgttgatgacggaaaattagatacagaatcagattctggtgcattt 887

                                  
Query: 88  tgggtcctttttggaggttttgc 110
           |||||||| ||||| ||||||||
Sbjct: 888 tgggtcctctttggtggttttgc 910
to top
>gb|AY133782.1| Arabidopsis thaliana clone U11765 putative villin 2 protein
           (At2g41740) mRNA, complete cds
          Length = 2962

 Score = 54.0 bits (27), Expect = 9e-05
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  tgtgatgttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattc 87
           ||||||||||| || |||||||| || ||| || |  | |||||||| ||||||| ||| 
Sbjct: 616 tgtgatgttgcgattgttgatgacggaaaattagatacagaatcagattctggtgcattt 675

                                  
Query: 88  tgggtcctttttggaggttttgc 110
           |||||||| ||||| ||||||||
Sbjct: 676 tgggtcctctttggtggttttgc 698
to top
>gb|AY080601.1| Arabidopsis thaliana putative villin 2 protein (At2g41740) mRNA,
           complete cds
          Length = 3383

 Score = 54.0 bits (27), Expect = 9e-05
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  tgtgatgttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattc 87
           ||||||||||| || |||||||| || ||| || |  | |||||||| ||||||| ||| 
Sbjct: 819 tgtgatgttgcgattgttgatgacggaaaattagatacagaatcagattctggtgcattt 878

                                  
Query: 88  tgggtcctttttggaggttttgc 110
           |||||||| ||||| ||||||||
Sbjct: 879 tgggtcctctttggtggttttgc 901
to top
>gb|AF081202.1|AF081202 Arabidopsis thaliana villin 2 (VLN2) mRNA, complete cds
          Length = 3107

 Score = 54.0 bits (27), Expect = 9e-05
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 28  tgtgatgttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattc 87
           ||||||||||| || |||||||| || ||| || |  | |||||||| ||||||| ||| 
Sbjct: 616 tgtgatgttgcgattgttgatgacggaaaattagatacagaatcagattctggtgcattt 675

                                  
Query: 88  tgggtcctttttggaggttttgc 110
           |||||||| ||||| ||||||||
Sbjct: 676 tgggtcctctttggtggttttgc 698
to top
>gb|AF088901.1|AF088901 Lilium longiflorum actin bundling protein ABP135 (Y5-7) mRNA,
           complete cds
          Length = 3295

 Score = 46.1 bits (23), Expect = 0.022
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 79  ggtgaattctgggtcctttttggaggttttgcacc 113
           |||||||| |||||||||||||| || ||||||||
Sbjct: 795 ggtgaattttgggtcctttttggtggctttgcacc 829
to top
>ref|NM_115601.2| Arabidopsis thaliana VLN3 (VILLIN 3); actin binding AT3G57410
           (VLN3) mRNA, complete cds
          Length = 3479

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 34  gttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattctgggtc 93
           ||||| || ||||||||||| ||| || |  | |||||||| ||||| || |||||||||
Sbjct: 822 gttgctattgttgatgatggaaaattagatacagaatcagattctggcgagttctgggtc 881

                            
Query: 94  ctttttggaggttttgc 110
           || ||||| || |||||
Sbjct: 882 ctctttggggggtttgc 898
to top
>ref|XM_759363.1| Theileria parva strain Muguga chromosome 4 hypothetical protein
            (TP04_0819) partial mRNA
          Length = 1939

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 28   tgtgatgttgcaatcgttgatgatg 52
            |||||||||| ||||||||||||||
Sbjct: 1888 tgtgatgttggaatcgttgatgatg 1864
to top
>gb|AY128932.1| Arabidopsis thaliana unknown protein (At3g57410) mRNA, complete cds
          Length = 2999

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 34  gttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattctgggtc 93
           ||||| || ||||||||||| ||| || |  | |||||||| ||||| || |||||||||
Sbjct: 628 gttgctattgttgatgatggaaaattagatacagaatcagattctggcgagttctgggtc 687

                            
Query: 94  ctttttggaggttttgc 110
           || ||||| || |||||
Sbjct: 688 ctctttggggggtttgc 704
to top
>gb|AY093052.1| Arabidopsis thaliana unknown protein (At3g57410) mRNA, complete cds
          Length = 3548

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 34  gttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattctgggtc 93
           ||||| || ||||||||||| ||| || |  | |||||||| ||||| || |||||||||
Sbjct: 823 gttgctattgttgatgatggaaaattagatacagaatcagattctggcgagttctgggtc 882

                            
Query: 94  ctttttggaggttttgc 110
           || ||||| || |||||
Sbjct: 883 ctctttggggggtttgc 899
to top
>gb|AF081203.1|AF081203 Arabidopsis thaliana villin 3 (VLN3) mRNA, complete cds
          Length = 3335

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 34  gttgcaatcgttgatgatgggaaactacaagcggaatcagactctggtgaattctgggtc 93
           ||||| || ||||||||||| ||| || |  | |||||||| ||||| || |||||||||
Sbjct: 702 gttgctattgttgatgatggaaaattagatacagaatcagattctggcgagttctgggtc 761

                            
Query: 94  ctttttggaggttttgc 110
           || ||||| || |||||
Sbjct: 762 ctctttggggggtttgc 778
to top
>emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8H10
          Length = 87503

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 67   gaatcagactctggtgaattctgggtcctttttggaggttttgc 110
            |||||||| ||||| || ||||||||||| ||||| || |||||
Sbjct: 2338 gaatcagattctggcgagttctgggtcctctttggggggtttgc 2295
to top
>gb|AC009930.7| Homo sapiens chromosome 8, clone RP11-114O8, complete sequence
          Length = 165662

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 76    tctggtgaattctgggtcct 95
             ||||||||||||||||||||
Sbjct: 73190 tctggtgaattctgggtcct 73171
to top
>gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complete sequence
          Length = 177285

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 81     tgaattctgggtcctttttg 100
              ||||||||||||||||||||
Sbjct: 108393 tgaattctgggtcctttttg 108412
to top
>gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosome 13, complete
             sequence
          Length = 147695

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 70    tcagactctggtgaattctgggtcctttttg 100
             ||||| |||||||||  ||||||||||||||
Sbjct: 84277 tcagagtctggtgaaggctgggtcctttttg 84307
to top
>gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, complete sequence
          Length = 195356

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 82    gaattctgggtcctttttggagg 104
             |||||||||| ||||||||||||
Sbjct: 22395 gaattctgggacctttttggagg 22373
to top
>emb|Z99531.1|SPAC19D5 S.pombe chromosome I cosmid c19D5
          Length = 30389

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 92    tcctttttggaggttttgc 110
             |||||||||||||||||||
Sbjct: 20697 tcctttttggaggttttgc 20715
to top
>gb|AY676137.1| Euprymna scolopes bone morphogenic protein 2/4 mRNA, partial cds
          Length = 1200

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 71  cagactctggtgaattctg 89
           |||||||||||||||||||
Sbjct: 643 cagactctggtgaattctg 661
to top
>ref|NM_001020331.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC19D5.04),
            partial mRNA
          Length = 9684

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 92   tcctttttggaggttttgc 110
            |||||||||||||||||||
Sbjct: 6916 tcctttttggaggttttgc 6934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 989,912
Number of Sequences: 3902068
Number of extensions: 989912
Number of successful extensions: 59872
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 59824
Number of HSP's gapped (non-prelim): 52
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top