ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl32h04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (L... 88 2e-15
2ref|NM_016967.2| Mus musculus oligodendrocyte transcription fact... 46 0.006
3gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, co... 46 0.006
4gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosom... 46 0.006
5dbj|AK080615.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 46 0.006
6gb|BC051967.1| Mus musculus oligodendrocyte transcription factor... 46 0.006
7dbj|AB038697.1| Mus musculus mRNA for Olig2 bHLH protein, comple... 46 0.006
8gb|AC009051.8| Homo sapiens chromosome 16 clone RP11-238M18, com... 42 0.10
9gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, co... 42 0.10
10gb|AC136285.2| Homo sapiens chromosome 16 clone RP11-899L11, com... 42 0.10
11gb|AC133860.5| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genom... 40 0.40
12ref|XM_463123.1| Oryza sativa (japonica cultivar-group), mRNA 40 0.40
13gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 0.40
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 0.40
15dbj|AK070268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.40
16gb|AC153805.1| Homo sapiens chromosome 1 clone fa0648, complete ... 38 1.6
17gb|AF064859.1| Homo sapiens chromosome 21q22.3 PAC 141B3, comple... 38 1.6
18emb|AL163278.2|HS21C078 Homo sapiens chromosome 21 segment HS21C078 38 1.6
19emb|BX470173.6| Human DNA sequence from clone RP11-739C15 on chr... 38 1.6
20gb|AC153370.13| Mus musculus 10 BAC RP23-281M13 (Roswell Park Ca... 38 1.6
21gb|AC145591.5| Mus musculus BAC clone RP24-176N2 from chromosome... 38 1.6
22gb|AY948318.1| Haliotis discus hannai clone KHdh50 microsatellit... 38 1.6
23gb|AC132568.3| Mus musculus BAC clone RP24-484M20 from chromosom... 38 1.6
24gb|AC158599.7| Mus musculus 10 BAC RP23-122O12 (Roswell Park Can... 38 1.6
25dbj|AB124887.1| Oryza barthii EPSPs, rps20 genes for 5-enolpyruv... 38 1.6
26dbj|AB124886.1| Oryza glaberrima EPSPs, rps20 genes for 5-enolpy... 38 1.6
27gb|AC132241.3| Mus musculus BAC clone RP24-413I2 from chromosome... 38 1.6
28gb|AC154046.1| Drosophila melanogaster clone BACR29O22, complete... 36 6.2
29ref|NM_129910.1| Arabidopsis thaliana unknown protein AT2G43490 ... 36 6.2
30gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, com... 36 6.2
31gb|AC121298.10| Mus musculus chromosome 5, clone RP23-377E6, com... 36 6.2
32gb|AC119932.7| Mus musculus chromosome 15, clone RP24-260C11, co... 36 6.2
33gb|AC109311.12| Mus musculus chromosome 5, clone RP23-42K10, com... 36 6.2
34gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 36 6.2
35gb|AC164292.4| Mus musculus BAC clone RP24-177C20 from chromosom... 36 6.2
36gb|AC099628.7| Mus musculus chromosome 1, clone RP24-82L18, comp... 36 6.2
37gb|AC102595.9| Mus musculus chromosome 10, clone RP23-360M11, co... 36 6.2
38gb|AC119959.8| Mus musculus chromosome 15, clone RP24-467H19, co... 36 6.2
39gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome... 36 6.2
40gb|AC164542.2| Mus musculus chromosome 3, clone RP23-391J12, com... 36 6.2
41gb|AC073297.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 36 6.2
42gb|AC091283.11| Mus musculus chromosome 18, clone RP23-146P1, co... 36 6.2
43gb|AC148477.3| Homo sapiens 12 BAC RP13-895J2 (Roswell Park Canc... 36 6.2
44gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome ... 36 6.2
45gb|AC124583.4| Mus musculus BAC clone RP23-123P18 from chromosom... 36 6.2
46ref|XM_983150.1| PREDICTED: Mus musculus similar to zinc finger ... 36 6.2
47ref|XM_914413.2| PREDICTED: Mus musculus similar to zinc finger ... 36 6.2
48ref|XM_984387.1| PREDICTED: Mus musculus similar to zinc finger ... 36 6.2
49gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, com... 36 6.2
50emb|CT025689.6| Mouse DNA sequence from clone RP24-236L7 on chro... 36 6.2
51emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chro... 36 6.2
52gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, com... 36 6.2
53gb|AY429354.1| Arabidopsis thaliana At2g43490 mRNA, partial sequ... 36 6.2
54gb|AC128665.4| Mus musculus BAC clone RP24-141K21 from chromosom... 36 6.2
55emb|Z74038.1|CEF58B4 Caenorhabditis elegans Cosmid F58B4, comple... 36 6.2
56gb|AC124419.4| Mus musculus BAC clone RP24-319P11 from chromosom... 36 6.2
57gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosom... 36 6.2
58gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome... 36 6.2
59gb|AC124742.4| Mus musculus BAC clone RP23-210N16 from 12, compl... 36 6.2
60gb|AC126260.3| Mus musculus BAC clone RP23-338J1 from chromosome... 36 6.2
61gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complet... 36 6.2
62gb|AC116325.5| Mus musculus BAC clone RP23-295K3 from 10, comple... 36 6.2
63gb|AC121961.2| Mus musculus BAC clone RP24-255E8 from 10, comple... 36 6.2
64gb|AC079218.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 36 6.2
65gb|AC100752.10| Mus musculus chromosome 3, clone RP23-2A4, compl... 36 6.2
66gb|AY436590.1| Homo sapiens nuclear receptor subfamily 3, group ... 36 6.2
67emb|CR664351.1|CNS0FBL1 Tetraodon nigroviridis full-length cDNA 36 6.2
68gb|AC112677.8| Mus musculus chromosome 3, clone RP23-176J23, com... 36 6.2
69gb|AC161438.6| Mus musculus chromosome 18, clone RP23-62E1, comp... 36 6.2
70gb|AC125452.7| Mus musculus, clone RP23-43F6, complete sequence 36 6.2
71gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete s... 36 6.2
72gb|AC108799.9| Mus musculus, clone RP23-119G12, complete sequence 36 6.2
73emb|AL450307.18| Human DNA sequence from clone RP11-245K15 on ch... 36 6.2
74emb|AL449104.5| Human DNA sequence from clone RP1-173P22 on chro... 36 6.2
75emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chr... 36 6.2
76emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on ch... 36 6.2
77gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-... 36 6.2
78gb|AC091617.2| Rattus norvegicus strain Brown Norway clone RP31-... 36 6.2
79emb|AL132981.12|HSDJ80L13 Human DNA sequence from clone RP1-80L1... 36 6.2
80emb|AL109620.5|HSBG54N10 Human DNA sequence from clone GS1-54N10... 36 6.2
81emb|Y10165.2|CPPG12 Claviceps purpurea pg1 gene for polygalactur... 36 6.2
82gb|AC155168.3| Mus musculus BAC clone RP23-208M17 from chromosom... 36 6.2
83emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chro... 36 6.2
84gb|AC164159.2| Mus musculus BAC clone RP23-339C17 from chromosom... 36 6.2
85gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosom... 36 6.2
86emb|BX571866.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 36 6.2
87emb|AL954167.4| Mouse DNA sequence from clone RP23-300M3 on chro... 36 6.2
88gb|AC005252.1| Homo sapiens 12q24.2 PAC RPCI4-800O15 (Roswell P... 36 6.2
89gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosom... 36 6.2
90gb|AC110048.2| Homo sapiens chromosome 15, clone RP11-622C24, co... 36 6.2
91gb|AC144518.32| Pan troglodytes clone rp43-23c18, complete sequence 36 6.2
92gb|AC091925.3| Homo sapiens chromosome 5 clone RP11-278J6, compl... 36 6.2
93gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswel... 36 6.2
94gb|AC087321.20| Homo sapiens 12 BAC RP11-606D9 (Roswell Park Can... 36 6.2
95gb|AC005956.4| Arabidopsis thaliana chromosome 2 clone MHK10 map... 36 6.2
96gb|AC002335.3| Arabidopsis thaliana chromosome 2 clone T1O24 map... 36 6.2
97dbj|AK148821.1| Mus musculus 2 days neonate sympathetic ganglion... 36 6.2
98gb|AY062031.1| Homo sapiens hypocretin receptor 2 (HCRTR2) gene,... 36 6.2
99gb|AC090461.4| Homo sapiens chromosome 15, clone RP11-100A11, co... 36 6.2
100dbj|AK161007.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 36 6.2
101gb|DQ099347.1| Bombus lucorum clone BL16 microsatellite sequence 36 6.2
102dbj|AK156446.1| Mus musculus activated spleen cDNA, RIKEN full-l... 36 6.2
103gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosom... 36 6.2
104gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome... 36 6.2
105gb|AC151733.5| Mus musculus BAC clone RP23-89N20 from chromosome... 36 6.2
106gb|AC008569.7| Homo sapiens chromosome 19 clone CTC-548K16, comp... 36 6.2
107emb|BX324142.7| Zebrafish DNA sequence from clone CH211-196F19 i... 36 6.2
108gb|AC026464.7| Homo sapiens chromosome 16 clone RP11-343C2, comp... 36 6.2
109gb|AC157515.2| Mus musculus BAC clone RP24-226N22 from chromosom... 36 6.2
110gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosom... 36 6.2
111gb|BC095756.1| Danio rerio hypothetical protein LOC553473, mRNA ... 36 6.2
112dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.2
113gb|AC004616.1| Homo sapiens X BAC GSHB-536K7 (Genome Systems Hum... 36 6.2
114gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p... 36 6.2
115gb|AC005186.3| Homo sapiens 12 PAC RP5-916L7 (Roswell Park Cance... 36 6.2
116gb|AC175664.2| Mus musculus BAC clone RP24-391A3 from chromosome... 36 6.2
117emb|BX842668.3| Mouse DNA sequence from clone RP23-161M5 on chro... 36 6.2
118emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in... 36 6.2
119emb|BX255885.5| Zebrafish DNA sequence from clone CH211-213M12 i... 36 6.2
120gb|AY726769.1| Myrmica scabrinodis clone Msca9 microsatellite se... 36 6.2
121gb|AC116483.10| Mus musculus chromosome 1, clone RP23-424K5, com... 36 6.2
122gb|AC004168.2|AC004168 Homo sapiens chromosome 4 clone B159L21 m... 36 6.2
123gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48... 36 6.2
124gb|AC115689.22| Mus musculus chromosome 9, clone RP23-166A9, com... 36 6.2
125gb|AC174776.3| Mus musculus BAC clone RP23-349J24 from chromosom... 36 6.2
126gb|AC166323.5| Mus musculus BAC clone RP24-491I24 from chromosom... 36 6.2
127gb|AC174762.1| Gasterosteus aculeatus clone VMRC28-105C03, compl... 36 6.2
128gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 36 6.2
129gb|AC159636.3| Mus musculus BAC clone RP24-93H15 from chromosome... 36 6.2
130emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 36 6.2
131gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, comple... 36 6.2
132emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on ch... 36 6.2
133emb|BX004998.7| Mouse DNA sequence from clone RP23-402C17 on chr... 36 6.2
134gb|AY861514.1| Malus x domestica clone MS11D10 microsatellite se... 36 6.2
135emb|AL606927.12| Mouse DNA sequence from clone RP23-144I6 on chr... 36 6.2
136emb|AL627122.18| Mouse DNA sequence from clone RP23-132E8 on chr... 36 6.2
137emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chr... 36 6.2
138emb|AL808018.7| Mouse DNA sequence from clone RP23-473C10 on chr... 36 6.2
139emb|AL772173.16| Mouse DNA sequence from clone RP23-163P22 on ch... 36 6.2
140dbj|AB047297.1| Rattus norvegicus gene for sst2 somatostatin rec... 36 6.2 
>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter
            region and partial cds
          Length = 5236

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                        
Query: 1    acacacactcacgcaacacacatccatcttcactgaaaagtgaa 44
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3406 acacacactcacgcaacacacatccatcttcactgaaaagtgaa 3449
to top
>ref|NM_016967.2| Mus musculus oligodendrocyte transcription factor 2 (Olig2), mRNA
          Length = 2462

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1    acacacactcacgcaacacacat 23
            |||||||||||||||||||||||
Sbjct: 1892 acacacactcacgcaacacacat 1914
to top
>gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, complete sequence
          Length = 210023

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1      acacacactcacgcaacacacat 23
              |||||||||||||||||||||||
Sbjct: 161084 acacacactcacgcaacacacat 161106
to top
>gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosome 16, complete
            sequence
          Length = 204940

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1    acacacactcacgcaacacacat 23
            |||||||||||||||||||||||
Sbjct: 4076 acacacactcacgcaacacacat 4098
to top
>dbj|AK080615.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830025B18 product:oligodendrocyte
            transcription factor 2, full insert sequence
          Length = 2362

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1    acacacactcacgcaacacacat 23
            |||||||||||||||||||||||
Sbjct: 1870 acacacactcacgcaacacacat 1892
to top
>gb|BC051967.1| Mus musculus oligodendrocyte transcription factor 2, mRNA (cDNA clone
            MGC:62240 IMAGE:5695592), complete cds
          Length = 2462

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1    acacacactcacgcaacacacat 23
            |||||||||||||||||||||||
Sbjct: 1892 acacacactcacgcaacacacat 1914
to top
>dbj|AB038697.1| Mus musculus mRNA for Olig2 bHLH protein, complete cds
          Length = 2433

 Score = 46.1 bits (23), Expect = 0.006
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1    acacacactcacgcaacacacat 23
            |||||||||||||||||||||||
Sbjct: 1871 acacacactcacgcaacacacat 1893
to top
>gb|AC009051.8| Homo sapiens chromosome 16 clone RP11-238M18, complete sequence
          Length = 157691

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 2     cacacactcacgcaacacaca 22
             |||||||||||||||||||||
Sbjct: 40763 cacacactcacgcaacacaca 40743
to top
>gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, complete sequence
          Length = 198821

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     acacacactcacgcaacacac 21
             |||||||||||||||||||||
Sbjct: 67476 acacacactcacgcaacacac 67496
to top
>gb|AC136285.2| Homo sapiens chromosome 16 clone RP11-899L11, complete sequence
          Length = 235286

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 2      cacacactcacgcaacacaca 22
              |||||||||||||||||||||
Sbjct: 137837 cacacactcacgcaacacaca 137817
to top
>gb|AC133860.5| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genomic sequence, complete
             sequence
          Length = 157397

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     acacactcacgcaacacaca 22
             ||||||||||||||||||||
Sbjct: 42630 acacactcacgcaacacaca 42611
to top
>ref|XM_463123.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 773

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   acacactcacgcaacacaca 22
           ||||||||||||||||||||
Sbjct: 113 acacactcacgcaacacaca 94
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 3        acacactcacgcaacacaca 22
                ||||||||||||||||||||
Sbjct: 22625516 acacactcacgcaacacaca 22625535
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 3        acacactcacgcaacacaca 22
                ||||||||||||||||||||
Sbjct: 22618545 acacactcacgcaacacaca 22618564
to top
>dbj|AK070268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023044E14, full
           insert sequence
          Length = 773

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   acacactcacgcaacacaca 22
           ||||||||||||||||||||
Sbjct: 113 acacactcacgcaacacaca 94
to top
>gb|AC153805.1| Homo sapiens chromosome 1 clone fa0648, complete sequence
          Length = 39930

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    tccatcttcactgaaaagt 41
             |||||||||||||||||||
Sbjct: 23599 tccatcttcactgaaaagt 23617
to top
>gb|AF064859.1| Homo sapiens chromosome 21q22.3 PAC 141B3, complete sequence,
             containing ribosomal protein homologue pseudogene L23a
          Length = 122571

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     acacacactcacgcaacacacat 23
             |||||||| ||||||||||||||
Sbjct: 68726 acacacacccacgcaacacacat 68748
to top
>emb|AL163278.2|HS21C078 Homo sapiens chromosome 21 segment HS21C078
          Length = 340000

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 1      acacacactcacgcaacacacat 23
              |||||||| ||||||||||||||
Sbjct: 310136 acacacacccacgcaacacacat 310158
to top
>emb|BX470173.6| Human DNA sequence from clone RP11-739C15 on chromosome 1, complete
             sequence
          Length = 66303

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    tccatcttcactgaaaagt 41
             |||||||||||||||||||
Sbjct: 56898 tccatcttcactgaaaagt 56916
to top
>gb|AC153370.13| Mus musculus 10 BAC RP23-281M13 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 213550

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    ttcactgaaaagtgaatat 47
             |||||||||||||||||||
Sbjct: 79026 ttcactgaaaagtgaatat 79044
to top
>gb|AC145591.5| Mus musculus BAC clone RP24-176N2 from chromosome 18, complete sequence
          Length = 167532

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     acacacactcacgcaacacacat 23
             |||||||||||| ||||||||||
Sbjct: 60057 acacacactcacacaacacacat 60079
to top
>gb|AY948318.1| Haliotis discus hannai clone KHdh50 microsatellite sequence
          Length = 51

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 1  acacacactcacgcaacacacat 23
          |||||||||||| ||||||||||
Sbjct: 20 acacacactcacacaacacacat 42
to top
>gb|AC132568.3| Mus musculus BAC clone RP24-484M20 from chromosome 1, complete
            sequence
          Length = 133079

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ttcactgaaaagtgaatat 47
            |||||||||||||||||||
Sbjct: 1693 ttcactgaaaagtgaatat 1675
to top
>gb|AC158599.7| Mus musculus 10 BAC RP23-122O12 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 191825

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    ttcactgaaaagtgaatat 47
             |||||||||||||||||||
Sbjct: 24762 ttcactgaaaagtgaatat 24744



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 188590 tcactgaaaagtgaatat 188573
to top
>dbj|AB124887.1| Oryza barthii EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W159b-2
          Length = 2960

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 10   cacgcaacacacatccatc 28
            |||||||||||||||||||
Sbjct: 2872 cacgcaacacacatccatc 2890
to top
>dbj|AB124886.1| Oryza glaberrima EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W025
          Length = 2961

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 10   cacgcaacacacatccatc 28
            |||||||||||||||||||
Sbjct: 2873 cacgcaacacacatccatc 2891
to top
>gb|AC132241.3| Mus musculus BAC clone RP24-413I2 from chromosome 1, complete sequence
          Length = 138670

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    ttcactgaaaagtgaatat 47
             |||||||||||||||||||
Sbjct: 75002 ttcactgaaaagtgaatat 74984
to top
>gb|AC154046.1| Drosophila melanogaster clone BACR29O22, complete sequence
          Length = 177480

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||| |||||||||||
Sbjct: 166373 acacacactctcgcaacacaca 166394
to top
>ref|NM_129910.1| Arabidopsis thaliana unknown protein AT2G43490 mRNA, complete cds
          Length = 2271

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 28  cttcactgaaaagtgaat 45
           ||||||||||||||||||
Sbjct: 800 cttcactgaaaagtgaat 817
to top
>gb|AC113991.4| Mus musculus chromosome 3, clone RP24-138E17, complete sequence
          Length = 138057

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 65920 acacacactcacacaacacaca 65941
to top
>gb|AC121298.10| Mus musculus chromosome 5, clone RP23-377E6, complete sequence
          Length = 194045

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 117543 acacacactcacacaacacaca 117564
to top
>gb|AC119932.7| Mus musculus chromosome 15, clone RP24-260C11, complete sequence
          Length = 170117

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 158857 acacacactcacacaacacaca 158878
to top
>gb|AC109311.12| Mus musculus chromosome 5, clone RP23-42K10, complete sequence
          Length = 191698

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||| |||||||||||||
Sbjct: 126712 acacacacgcacgcaacacaca 126733
to top
>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 29     ttcactgaaaagtgaata 46
              ||||||||||||||||||
Sbjct: 183252 ttcactgaaaagtgaata 183235
to top
>gb|AC164292.4| Mus musculus BAC clone RP24-177C20 from chromosome 3, complete sequence
          Length = 185822

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 2     cacacactcacgcaacacacat 23
             |||||||||| |||||||||||
Sbjct: 11503 cacacactcatgcaacacacat 11482
to top
>gb|AC099628.7| Mus musculus chromosome 1, clone RP24-82L18, complete sequence
          Length = 171875

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 45179 tcactgaaaagtgaatat 45162
to top
>gb|AC102595.9| Mus musculus chromosome 10, clone RP23-360M11, complete sequence
          Length = 223843

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 77106 tcactgaaaagtgaatat 77089
to top
>gb|AC119959.8| Mus musculus chromosome 15, clone RP24-467H19, complete sequence
          Length = 163783

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 112798 acacacactcacacaacacaca 112777
to top
>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence
          Length = 203180

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 77334 acacacactcacacaacacaca 77355
to top
>gb|AC164542.2| Mus musculus chromosome 3, clone RP23-391J12, complete sequence
          Length = 202319

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 30831 acacacactcacacaacacaca 30852
to top
>gb|AC073297.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-167N24, complete
             sequence
          Length = 96335

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 76375 acacacacacacgcaacacaca 76396
to top
>gb|AC091283.11| Mus musculus chromosome 18, clone RP23-146P1, complete sequence
          Length = 220804

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              ||||||||||| ||||||||||
Sbjct: 116372 acacacactcatgcaacacaca 116393
to top
>gb|AC148477.3| Homo sapiens 12 BAC RP13-895J2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 160802

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              ||||||||||| ||||||||||
Sbjct: 136641 acacacactcatgcaacacaca 136662
to top
>gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome 14, complete sequence
          Length = 187798

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 175924 tcactgaaaagtgaatat 175907
to top
>gb|AC124583.4| Mus musculus BAC clone RP23-123P18 from chromosome 17, complete sequence
          Length = 221980

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 169455 acacacactcacacaacacaca 169476
to top
>ref|XM_983150.1| PREDICTED: Mus musculus similar to zinc finger protein 541
            (LOC670763), mRNA
          Length = 4561

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 17   cacacatccatcttcact 34
            ||||||||||||||||||
Sbjct: 2291 cacacatccatcttcact 2274
to top
>ref|XM_914413.2| PREDICTED: Mus musculus similar to zinc finger protein 541
            (LOC638394), mRNA
          Length = 4561

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 17   cacacatccatcttcact 34
            ||||||||||||||||||
Sbjct: 2291 cacacatccatcttcact 2274
to top
>ref|XM_984387.1| PREDICTED: Mus musculus similar to zinc finger protein 541
            (LOC666528), mRNA
          Length = 4567

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 17   cacacatccatcttcact 34
            ||||||||||||||||||
Sbjct: 2291 cacacatccatcttcact 2274
to top
>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence
          Length = 229632

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 2      cacacactcacgcaacacacat 23
              |||||||||| |||||||||||
Sbjct: 140675 cacacactcatgcaacacacat 140654
to top
>emb|CT025689.6| Mouse DNA sequence from clone RP24-236L7 on chromosome 14, complete
              sequence
          Length = 177482

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 161663 tcactgaaaagtgaatat 161680
to top
>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
             sequence
          Length = 233365

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 32921 tcactgaaaagtgaatat 32904
to top
>gb|AC102769.11| Mus musculus chromosome 17, clone RP23-89A3, complete sequence
          Length = 162417

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 104563 acacacactcacacaacacaca 104542
to top
>gb|AY429354.1| Arabidopsis thaliana At2g43490 mRNA, partial sequence
          Length = 972

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 28  cttcactgaaaagtgaat 45
           ||||||||||||||||||
Sbjct: 899 cttcactgaaaagtgaat 916
to top
>gb|AC128665.4| Mus musculus BAC clone RP24-141K21 from chromosome 18, complete
             sequence
          Length = 183285

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             ||||||||||| ||||||||||
Sbjct: 46752 acacacactcatgcaacacaca 46773
to top
>emb|Z74038.1|CEF58B4 Caenorhabditis elegans Cosmid F58B4, complete sequence
          Length = 23861

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 14434 acacacactcactcaacacaca 14455
to top
>gb|AC124419.4| Mus musculus BAC clone RP24-319P11 from chromosome 18, complete sequence
          Length = 140103

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 130906 tcactgaaaagtgaatat 130889
to top
>gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosome 10, complete sequence
          Length = 225663

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 1      acacacactcacgcaacacacatcca 26
              |||||||| ||| |||||||||||||
Sbjct: 202262 acacacacacactcaacacacatcca 202287
to top
>gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome 17, complete sequence
          Length = 171820

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 78032 acacacactcacacaacacaca 78011
to top
>gb|AC124742.4| Mus musculus BAC clone RP23-210N16 from 12, complete sequence
          Length = 208101

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 170472 acacacactcacacaacacaca 170451
to top
>gb|AC126260.3| Mus musculus BAC clone RP23-338J1 from chromosome 9, complete sequence
          Length = 208028

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 23    tccatcttcactgaaaagtgaa 44
             ||||||||||| ||||||||||
Sbjct: 15168 tccatcttcaccgaaaagtgaa 15189
to top
>gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complete sequence
          Length = 209359

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 104858 acacacactcacacaacacaca 104879



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 104731 acacacactcacacaacacaca 104752



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 104592 acacacactcacacaacacaca 104613



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 104465 acacacactcacacaacacaca 104486



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 103685 acacacactcacacaacacaca 103706



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 103450 acacacactcacacaacacaca 103471



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 102947 acacacactcacacaacacaca 102968



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 102577 acacacactcacacaacacaca 102598



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 102348 acacacactcacacaacacaca 102369
to top
>gb|AC116325.5| Mus musculus BAC clone RP23-295K3 from 10, complete sequence
          Length = 196265

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 186814 acacacactcacacaacacaca 186835
to top
>gb|AC121961.2| Mus musculus BAC clone RP24-255E8 from 10, complete sequence
          Length = 162752

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 1     acacacactcacgcaacacacatcca 26
             |||||||| ||| |||||||||||||
Sbjct: 47568 acacacacacactcaacacacatcca 47593
to top
>gb|AC079218.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-382G13, complete
            sequence
          Length = 142667

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1    acacacactcacgcaacacaca 22
            |||||||| |||||||||||||
Sbjct: 3012 acacacacacacgcaacacaca 3033
to top
>gb|AC100752.10| Mus musculus chromosome 3, clone RP23-2A4, complete sequence
          Length = 208757

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 174013 acacacactcacacaacacaca 174034
to top
>gb|AY436590.1| Homo sapiens nuclear receptor subfamily 3, group C, member 1
            (glucocorticoid receptor) (NR3C1) gene, complete cds
          Length = 127687

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 30   tcactgaaaagtgaatat 47
            ||||||||||||||||||
Sbjct: 3244 tcactgaaaagtgaatat 3227
to top
>emb|CR664351.1|CNS0FBL1 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 25  catcttcactgaaaagtg 42
           ||||||||||||||||||
Sbjct: 156 catcttcactgaaaagtg 173
to top
>gb|AC112677.8| Mus musculus chromosome 3, clone RP23-176J23, complete sequence
          Length = 215247

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 63799 tcactgaaaagtgaatat 63782
to top
>gb|AC161438.6| Mus musculus chromosome 18, clone RP23-62E1, complete sequence
          Length = 198865

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 29     ttcactgaaaagtgaata 46
              ||||||||||||||||||
Sbjct: 181633 ttcactgaaaagtgaata 181650
to top
>gb|AC125452.7| Mus musculus, clone RP23-43F6, complete sequence
          Length = 162045

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 43693 acacacactcacacaacacaca 43714
to top
>gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete sequence
          Length = 113210

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    tcttcactgaaaagtgaa 44
             ||||||||||||||||||
Sbjct: 48848 tcttcactgaaaagtgaa 48831
to top
>gb|AC108799.9| Mus musculus, clone RP23-119G12, complete sequence
          Length = 228349

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 197462 tcactgaaaagtgaatat 197445
to top
>emb|AL450307.18| Human DNA sequence from clone RP11-245K15 on chromosome 10, complete
             sequence
          Length = 159020

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 57867 acacacacacacgcaacacaca 57846
to top
>emb|AL449104.5| Human DNA sequence from clone RP1-173P22 on chromosome 6 Contains the
             3' end of the HCRTR2 gene for hypocretin (orexin) receptor
             2, complete sequence
          Length = 120466

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 65203 acacacacacacgcaacacaca 65224
to top
>emb|AL360269.21| Human DNA sequence from clone RP11-192I3 on chromosome 1 Contains the
             WNT9A gene for wingless-type MMTV integration site family,
             member 9A and a CpG island, complete sequence
          Length = 141703

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 75437 tcactgaaaagtgaatat 75454
to top
>emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on chromosome 20 Contains the
             3' end of the PPP4R1L gene for protein phosphatase 4
             regulatory subunit 1-like, the C20orf85 gene for an
             ankyrin domain-containing protein, the C20orf86 gene and
             three CpG islands, complete sequence
          Length = 146208

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    cacatccatcttcactga 36
             ||||||||||||||||||
Sbjct: 79412 cacatccatcttcactga 79395
to top
>gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-547A5, complete
            sequence
          Length = 175512

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    acacacactcacgcaacacaca 22
            |||||||||||| |||||||||
Sbjct: 1067 acacacactcacacaacacaca 1046



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    acacacactcacgcaacacaca 22
            |||||||||||| |||||||||
Sbjct: 1032 acacacactcacacaacacaca 1011



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||||||| |||||||||
Sbjct: 603 acacacactcacacaacacaca 582



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||||||| |||||||||
Sbjct: 550 acacacactcacacaacacaca 529
to top
>gb|AC091617.2| Rattus norvegicus strain Brown Norway clone RP31-371K3, complete sequence
          Length = 150494

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 150455 acacacactcacacaacacaca 150434



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 150420 acacacactcacacaacacaca 150399



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 149991 acacacactcacacaacacaca 149970



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 149938 acacacactcacacaacacaca 149917
to top
>emb|AL132981.12|HSDJ80L13 Human DNA sequence from clone RP1-80L13 on chromosome 20 Contains STSs
             and GSSs, complete sequence
          Length = 112186

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    ttcactgaaaagtgaata 46
             ||||||||||||||||||
Sbjct: 85157 ttcactgaaaagtgaata 85174
to top
>emb|AL109620.5|HSBG54N10 Human DNA sequence from clone GS1-54N10 on chromosome Xq26.3-28,
             complete sequence
          Length = 113148

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 34904 acacacacacacgcaacacaca 34883
to top
>emb|Y10165.2|CPPG12 Claviceps purpurea pg1 gene for polygalacturonase & pg2 gene for
           polygalacturonase
          Length = 4777

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||| |||||||||||||
Sbjct: 642 acacacacacacgcaacacaca 663
to top
>gb|AC155168.3| Mus musculus BAC clone RP23-208M17 from chromosome 10, complete
             sequence
          Length = 174112

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 68072 acacacactcacacaacacaca 68093
to top
>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the
            Vamp2 gene for vesicle-associated membrane 2, the Per1
            gene for period homolog 1 (Drosophila), the Hes7 gene for
            hairy and enhancer of split 7 (Drosophila), the Aloxe3
            gene for arachidonate lipoxygenase 3, the Alox12b gene
            for arachidonate 12-lipoxygenase 12R type, the Alox15b
            gene for arachidonate 15-lipoxygenase second type, the
            Gucy2e gene for guanylate cyclase 2e, a novel gene, the
            gene for LYST-interacting protein LIP8 (Lip8-pending),
            the gene for the likely ortholog of H. sapiens
            trafficking protein particle complex 1 (TRAPPC1)), the
            Kcnab3 gene for potassium voltage-gated channel
            shaker-related subfamily beta member 3, a novel gene, the
            3' end of the Chd3 gene for chromodomain helicase DNA
            binding protein 3 and six CpG islands, complete sequence
          Length = 261224

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    acacacactcacgcaacacaca 22
            |||||||| |||||||||||||
Sbjct: 3442 acacacacacacgcaacacaca 3421
to top
>gb|AC164159.2| Mus musculus BAC clone RP23-339C17 from chromosome 17, complete sequence
          Length = 206481

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 159835 acacacactcacacaacacaca 159856
to top
>gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosome 10, complete sequence
          Length = 196603

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 158401 tcactgaaaagtgaatat 158418
to top
>emb|BX571866.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              8/17
          Length = 349652

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 23     tccatcttcactgaaaag 40
              ||||||||||||||||||
Sbjct: 141077 tccatcttcactgaaaag 141060
to top
>emb|AL954167.4| Mouse DNA sequence from clone RP23-300M3 on chromosome 11 Contains a
             zinc finger protein pseudogene, complete sequence
          Length = 190351

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 40113 tcactgaaaagtgaatat 40096
to top
>gb|AC005252.1| Homo sapiens 12q24.2  PAC RPCI4-800O15 (Roswell Park Cancer Institute
              Human PAC library) complete sequence
          Length = 126327

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     acacatccatcttcactg 35
              ||||||||||||||||||
Sbjct: 107339 acacatccatcttcactg 107322
to top
>gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosome 12, complete
             sequence
          Length = 216485

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 11960 acacacactcacacaacacaca 11939
to top
>gb|AC110048.2| Homo sapiens chromosome 15, clone RP11-622C24, complete sequence
          Length = 163592

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 24     ccatcttcactgaaaagt 41
              ||||||||||||||||||
Sbjct: 138835 ccatcttcactgaaaagt 138818
to top
>gb|AC144518.32| Pan troglodytes clone rp43-23c18, complete sequence
          Length = 186577

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 48092 acacacactcacacaacacaca 48071
to top
>gb|AC091925.3| Homo sapiens chromosome 5 clone RP11-278J6, complete sequence
          Length = 164668

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 119843 tcactgaaaagtgaatat 119860
to top
>gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 167638

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||| |||||||||||
Sbjct: 65383 acacacactctcgcaacacaca 65362
to top
>gb|AC087321.20| Homo sapiens 12 BAC RP11-606D9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 123010

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 75336 acacacacacacgcaacacaca 75357
to top
>gb|AC005956.4| Arabidopsis thaliana chromosome 2 clone MHK10 map EG05C12, complete
             sequence
          Length = 85835

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    ttcactgaaaagtgaata 46
             ||||||||||||||||||
Sbjct: 50457 ttcactgaaaagtgaata 50440
to top
>gb|AC002335.3| Arabidopsis thaliana chromosome 2 clone T1O24 map CIC10F02, complete
             sequence
          Length = 102057

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    cttcactgaaaagtgaat 45
             ||||||||||||||||||
Sbjct: 71995 cttcactgaaaagtgaat 71978
to top
>dbj|AK148821.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120451J01
            product:hypothetical protein, full insert sequence
          Length = 2483

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   atccatcttcactgaaaa 39
            ||||||||||||||||||
Sbjct: 2065 atccatcttcactgaaaa 2048
to top
>gb|AY062031.1| Homo sapiens hypocretin receptor 2 (HCRTR2) gene, complete cds
          Length = 168575

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 99823 acacacacacacgcaacacaca 99844
to top
>gb|AC090461.4| Homo sapiens chromosome 15, clone RP11-100A11, complete sequence
          Length = 167218

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 24     ccatcttcactgaaaagt 41
              ||||||||||||||||||
Sbjct: 139027 ccatcttcactgaaaagt 139010
to top
>dbj|AK161007.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:4022442O12 product:hypothetical TPR-like
            containing protein, full insert sequence
          Length = 2625

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 1    acacacactcacgcaacacacatcca 26
            |||||||| ||| |||||||||||||
Sbjct: 1778 acacacacacactcaacacacatcca 1753
to top
>gb|DQ099347.1| Bombus lucorum clone BL16 microsatellite sequence
          Length = 276

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||| |||||||||||||
Sbjct: 163 acacacacacacgcaacacaca 142



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||| |||||||||||||
Sbjct: 148 acacacacacacgcaacacaca 127



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||| |||||||||||||
Sbjct: 131 acacacacacacgcaacacaca 110
to top
>dbj|AK156446.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830022C22 product:hypothetical protein,
            full insert sequence
          Length = 2410

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 22   atccatcttcactgaaaa 39
            ||||||||||||||||||
Sbjct: 2241 atccatcttcactgaaaa 2224
to top
>gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosome 12, complete
             sequence
          Length = 196540

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 73997 acacacacgcacgcaacacaca 74018



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||| |||||||||||||
Sbjct: 73960 acacacacacacgcaacacaca 73981
to top
>gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome 17, complete sequence
          Length = 146960

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 138929 acacacactcacacaacacaca 138908
to top
>gb|AC151733.5| Mus musculus BAC clone RP23-89N20 from chromosome 7, complete sequence
          Length = 204775

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 17     cacacatccatcttcact 34
              ||||||||||||||||||
Sbjct: 117276 cacacatccatcttcact 117259
to top
>gb|AC008569.7| Homo sapiens chromosome 19 clone CTC-548K16, complete sequence
          Length = 227245

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 16    acacacatccatcttcac 33
             ||||||||||||||||||
Sbjct: 48927 acacacatccatcttcac 48944
to top
>emb|BX324142.7| Zebrafish DNA sequence from clone CH211-196F19 in linkage group 20,
             complete sequence
          Length = 177066

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 13045 acacacactcacacaacacaca 13024
to top
>gb|AC026464.7| Homo sapiens chromosome 16 clone RP11-343C2, complete sequence
          Length = 190185

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||| |||||||||||||
Sbjct: 165877 acacacacacacgcaacacaca 165856
to top
>gb|AC157515.2| Mus musculus BAC clone RP24-226N22 from chromosome 12, complete sequence
          Length = 143190

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     atccatcttcactgaaaa 39
              ||||||||||||||||||
Sbjct: 113244 atccatcttcactgaaaa 113227
to top
>gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosome 6, complete sequence
          Length = 171057

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 139867 acacacactcacacaacacaca 139846
to top
>gb|BC095756.1| Danio rerio hypothetical protein LOC553473, mRNA (cDNA clone
          IMAGE:7273893), partial cds
          Length = 1034

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                
Query: 1  acacacactcacgcaacacaca 22
          |||||||||||| |||||||||
Sbjct: 32 acacacactcactcaacacaca 53
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 3      acacactcacgcaacacacatccatc 28
              |||||| || ||||||||||||||||
Sbjct: 725028 acacacacaggcaacacacatccatc 725053
to top
>gb|AC004616.1| Homo sapiens X BAC GSHB-536K7 (Genome Systems Human BAC library) complete
              sequence
          Length = 149752

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||| |||||||||||||
Sbjct: 119756 acacacacacacgcaacacaca 119735
to top
>gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p22, complete sequence
          Length = 129014

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 126133 tcactgaaaagtgaatat 126116
to top
>gb|AC005186.3| Homo sapiens 12 PAC RP5-916L7 (Roswell Park Cancer Institute Human PAC
              Library) complete sequence
          Length = 134471

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 18     acacatccatcttcactg 35
              ||||||||||||||||||
Sbjct: 117630 acacatccatcttcactg 117647
to top
>gb|AC175664.2| Mus musculus BAC clone RP24-391A3 from chromosome 8, complete sequence
          Length = 168189

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 114386 tcactgaaaagtgaatat 114403
to top
>emb|BX842668.3| Mouse DNA sequence from clone RP23-161M5 on chromosome 2, complete
            sequence
          Length = 105989

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 30   tcactgaaaagtgaatat 47
            ||||||||||||||||||
Sbjct: 2630 tcactgaaaagtgaatat 2647
to top
>emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in linkage group 7, complete
              sequence
          Length = 214581

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     aacacacatccatcttca 32
              ||||||||||||||||||
Sbjct: 108235 aacacacatccatcttca 108218
to top
>emb|BX255885.5| Zebrafish DNA sequence from clone CH211-213M12 in linkage group 4,
              complete sequence
          Length = 134701

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              ||||||||||||| ||||||||
Sbjct: 120234 acacacactcacgtaacacaca 120255
to top
>gb|AY726769.1| Myrmica scabrinodis clone Msca9 microsatellite sequence
          Length = 645

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 1   acacacactcacgcaacacaca 22
           |||||||| |||||||||||||
Sbjct: 323 acacacacacacgcaacacaca 344
to top
>gb|AC116483.10| Mus musculus chromosome 1, clone RP23-424K5, complete sequence
          Length = 194546

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 63359 tcactgaaaagtgaatat 63342
to top
>gb|AC004168.2|AC004168 Homo sapiens chromosome 4 clone B159L21 map 4q25, complete sequence
          Length = 185566

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 18958 acacacactcacacaacacaca 18979
to top
>gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48 of 83 of the complete
              sequence
          Length = 282116

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||| |||||||||||
Sbjct: 261095 acacacactctcgcaacacaca 261074
to top
>gb|AC115689.22| Mus musculus chromosome 9, clone RP23-166A9, complete sequence
          Length = 221548

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 23    tccatcttcactgaaaagtgaa 44
             ||||||||||| ||||||||||
Sbjct: 93451 tccatcttcaccgaaaagtgaa 93430
to top
>gb|AC174776.3| Mus musculus BAC clone RP23-349J24 from chromosome 12, complete sequence
          Length = 195214

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     atccatcttcactgaaaa 39
              ||||||||||||||||||
Sbjct: 125890 atccatcttcactgaaaa 125873



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    atccatcttcactgaaaa 39
             ||||||||||||||||||
Sbjct: 50826 atccatcttcactgaaaa 50809
to top
>gb|AC166323.5| Mus musculus BAC clone RP24-491I24 from chromosome 12, complete sequence
          Length = 143321

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     atccatcttcactgaaaa 39
              ||||||||||||||||||
Sbjct: 110199 atccatcttcactgaaaa 110182



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    atccatcttcactgaaaa 39
             ||||||||||||||||||
Sbjct: 36184 atccatcttcactgaaaa 36167
to top
>gb|AC174762.1| Gasterosteus aculeatus clone VMRC28-105C03, complete sequence
          Length = 136351

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 15    aacacacatccatcttcactga 36
             ||||||||||||||| ||||||
Sbjct: 68695 aacacacatccatctgcactga 68674
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 3      acacactcacgcaacacacatccatc 28
              |||||| || ||||||||||||||||
Sbjct: 725028 acacacacaggcaacacacatccatc 725053
to top
>gb|AC159636.3| Mus musculus BAC clone RP24-93H15 from chromosome 12, complete sequence
          Length = 184821

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     atccatcttcactgaaaa 39
              ||||||||||||||||||
Sbjct: 180854 atccatcttcactgaaaa 180871
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 3     acacactcacgcaacacacatccatc 28
             |||||| || ||||||||||||||||
Sbjct: 54106 acacacacaggcaacacacatccatc 54081
to top
>gb|AC145568.4| Mus musculus BAC clone RP24-473H20 from 6, complete sequence
          Length = 201210

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 1      acacacactcacgcaacacaca 22
              |||||||||||| |||||||||
Sbjct: 157606 acacacactcacacaacacaca 157627
to top
>emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on chromosome 17, complete
             sequence
          Length = 122522

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 22521 acacacactcacacaacacaca 22500
to top
>emb|BX004998.7| Mouse DNA sequence from clone RP23-402C17 on chromosome 4, complete
             sequence
          Length = 179875

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    tcactgaaaagtgaatat 47
             ||||||||||||||||||
Sbjct: 54066 tcactgaaaagtgaatat 54049
to top
>gb|AY861514.1| Malus x domestica clone MS11D10 microsatellite sequence
          Length = 317

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                
Query: 1  acacacactcacgcaacacaca 22
          |||||||||||| |||||||||
Sbjct: 22 acacacactcacacaacacaca 43
to top
>emb|AL606927.12| Mouse DNA sequence from clone RP23-144I6 on chromosome 4, complete
             sequence
          Length = 212373

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 27    tcttcactgaaaagtgaatatc 48
             ||||||||||||||| ||||||
Sbjct: 43600 tcttcactgaaaagtaaatatc 43579
to top
>emb|AL627122.18| Mouse DNA sequence from clone RP23-132E8 on chromosome 4, complete
             sequence
          Length = 166814

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 1     acacacactcacgcaacacaca 22
             |||||||||||| |||||||||
Sbjct: 88131 acacacactcacacaacacaca 88110
to top
>emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chromosome 2, complete
              sequence
          Length = 183985

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 25     catcttcactgaaaagtg 42
              ||||||||||||||||||
Sbjct: 102934 catcttcactgaaaagtg 102951
to top
>emb|AL808018.7| Mouse DNA sequence from clone RP23-473C10 on chromosome X, complete
             sequence
          Length = 172723

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    acacatccatcttcactg 35
             ||||||||||||||||||
Sbjct: 64711 acacatccatcttcactg 64728
to top
>emb|AL772173.16| Mouse DNA sequence from clone RP23-163P22 on chromosome 2, complete
              sequence
          Length = 203185

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 30     tcactgaaaagtgaatat 47
              ||||||||||||||||||
Sbjct: 192790 tcactgaaaagtgaatat 192807
to top
>dbj|AB047297.1| Rattus norvegicus gene for sst2 somatostatin receptor, 5'UTR and
            partial cds
          Length = 9492

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1    acacacactcacgcaacacaca 22
            |||||||| |||||||||||||
Sbjct: 9026 acacacacacacgcaacacaca 9047


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 579,239
Number of Sequences: 3902068
Number of extensions: 579239
Number of successful extensions: 194558
Number of sequences better than 10.0: 141
Number of HSP's better than 10.0 without gapping: 141
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 193749
Number of HSP's gapped (non-prelim): 809
length of query: 48
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 28
effective length of database: 17,155,003,908
effective search space: 480340109424
effective search space used: 480340109424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top