ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl32f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY111501.1| Zea mays CL31834_1 mRNA sequence 64 3e-07
2ref|NM_126047.1| Arabidopsis thaliana unknown protein AT5G66490 ... 42 1.1
3ref|NM_126078.1| Arabidopsis thaliana unknown protein AT5G66800 ... 42 1.1
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.1
5gb|AY183459.1| Lupinus angustifolius putative pectin methylester... 42 1.1
6gb|AY209001.1| Lupinus angustifolius pectin methylesterase mRNA,... 42 1.1
7gb|BT004996.1| Arabidopsis thaliana clone U50603 unknown protein... 42 1.1
8gb|AY088729.1| Arabidopsis thaliana clone 93374 mRNA, complete s... 42 1.1
9gb|AY084283.1| Arabidopsis thaliana clone 102248 mRNA, complete ... 42 1.1
10dbj|AP006061.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.1
11dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.1
12dbj|AK117559.1| Arabidopsis thaliana At5g66490 mRNA for unknown ... 42 1.1
13dbj|AB010700.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.1
14ref|XM_709765.1| Candida albicans SC5314 putative protein kinase... 40 4.5
15ref|XM_709703.1| Candida albicans SC5314 putative protein kinase... 40 4.5
16emb|AL589765.19| Human DNA sequence from clone RP11-98D18 on chr... 40 4.5
17ref|XM_776502.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.5
18gb|AY702899.1| Tetraodon nigroviridis XK-related protein 2b (XRG... 40 4.5
19gb|AY702898.1| Tetraodon nigroviridis XK-related protein 2a (XRG... 40 4.5
20emb|AL596163.1| Listeria innocua Clip11262 complete genome, segm... 40 4.5
21dbj|AK125876.1| Homo sapiens cDNA FLJ43888 fis, clone TESTI40093... 40 4.5
22gb|AC005396.3| Arabidopsis thaliana chromosome 2 clone T26I20 ma... 40 4.5
23dbj|AP004011.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
24dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
25gb|U51918.1|PSU51918 Pisum sativum mitochondrial pyruvate dehydr... 40 4.5

>gb|AY111501.1| Zea mays CL31834_1 mRNA sequence
          Length = 621

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 catgcctgcgttccacgcgtacggagatggcgggtgcctcgtctctgccccggccgagct 331
           |||||||||| || |||| |||||||||| ||||||||||||||| || ||||| |||||
Sbjct: 407 catgcctgcgctctacgcttacggagatgacgggtgcctcgtctcggcgccggctgagct 348



to top

>ref|NM_126047.1| Arabidopsis thaliana unknown protein AT5G66490 mRNA, complete cds
          Length = 542

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 gtcgtgctcttcttcttcttc 240
           |||||||||||||||||||||
Sbjct: 249 gtcgtgctcttcttcttcttc 229



to top

>ref|NM_126078.1| Arabidopsis thaliana unknown protein AT5G66800 mRNA, complete cds
          Length = 960

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 tcttcttcttcttccaaggga 247
           |||||||||||||||||||||
Sbjct: 383 tcttcttcttcttccaaggga 403



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
              complete sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    tcttcttcttcttccaaggga 247
              |||||||||||||||||||||
Sbjct: 361049 tcttcttcttcttccaaggga 361069



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 221     tcgtgctcttcttcttcttc 240
               ||||||||||||||||||||
Sbjct: 7166131 tcgtgctcttcttcttcttc 7166150



to top

>gb|AY183459.1| Lupinus angustifolius putative pectin methylesterase mRNA, complete
           cds
          Length = 1112

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 238 ttccaagggatcccatccttc 258
           |||||||||||||||||||||
Sbjct: 808 ttccaagggatcccatccttc 788



to top

>gb|AY209001.1| Lupinus angustifolius pectin methylesterase mRNA, complete cds
          Length = 1111

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 238 ttccaagggatcccatccttc 258
           |||||||||||||||||||||
Sbjct: 808 ttccaagggatcccatccttc 788



to top

>gb|BT004996.1| Arabidopsis thaliana clone U50603 unknown protein (At5g66490) mRNA,
           complete cds
          Length = 361

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 gtcgtgctcttcttcttcttc 240
           |||||||||||||||||||||
Sbjct: 233 gtcgtgctcttcttcttcttc 213



to top

>gb|AY088729.1| Arabidopsis thaliana clone 93374 mRNA, complete sequence
          Length = 542

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 gtcgtgctcttcttcttcttc 240
           |||||||||||||||||||||
Sbjct: 249 gtcgtgctcttcttcttcttc 229



to top

>gb|AY084283.1| Arabidopsis thaliana clone 102248 mRNA, complete sequence
          Length = 960

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 tcttcttcttcttccaaggga 247
           |||||||||||||||||||||
Sbjct: 383 tcttcttcttcttccaaggga 403



to top

>dbj|AP006061.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0414D03
          Length = 169823

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    tcttcttcttcttccaaggga 247
              |||||||||||||||||||||
Sbjct: 109648 tcttcttcttcttccaaggga 109668



to top

>dbj|AB013389.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1F13
          Length = 83511

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 220   gtcgtgctcttcttcttcttc 240
             |||||||||||||||||||||
Sbjct: 36436 gtcgtgctcttcttcttcttc 36456



to top

>dbj|AK117559.1| Arabidopsis thaliana At5g66490 mRNA for unknown protein, complete
           cds, clone: RAFL17-21-B17
          Length = 438

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 220 gtcgtgctcttcttcttcttc 240
           |||||||||||||||||||||
Sbjct: 244 gtcgtgctcttcttcttcttc 224



to top

>dbj|AB010700.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUD21
          Length = 69850

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   tcttcttcttcttccaaggga 247
             |||||||||||||||||||||
Sbjct: 14283 tcttcttcttcttccaaggga 14303



to top

>ref|XM_709765.1| Candida albicans SC5314 putative protein kinase (CaO19.2268), mRNA
          Length = 1770

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 221  tcgtgctcttcttcttcttc 240
            ||||||||||||||||||||
Sbjct: 1589 tcgtgctcttcttcttcttc 1570



to top

>ref|XM_709703.1| Candida albicans SC5314 putative protein kinase (CaO19.9808), mRNA
          Length = 1770

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 221  tcgtgctcttcttcttcttc 240
            ||||||||||||||||||||
Sbjct: 1589 tcgtgctcttcttcttcttc 1570



to top

>emb|AL589765.19| Human DNA sequence from clone RP11-98D18 on chromosome 1 Contains the
             3' end of the SNX27 gene for sorting nexin family member
             27, the TNRC4 gene for trinucleotide repeat containing 4,
             five novel genes, a ribosomal protein S11 (RPS11)
             pseudogene, the MRPL9 gene for mitochondrial ribosomal
             protein L9, the OAZ3 gene for ornithine decarboxylase
             antizyme 3, a novel gene (FLJ36032)  the TDRKH gene for
             tudor and KH domain containing, the RORC gene for
             RAR-related orphan receptor C and four CpG islands,
             complete sequence
          Length = 163389

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   ttccaagggatcccatcctt 257
             ||||||||||||||||||||
Sbjct: 86254 ttccaagggatcccatcctt 86235



to top

>ref|XM_776502.1| PREDICTED: Strongylocentrotus purpuratus similar to senescence
           downregulated leo1-like (LOC576164), partial mRNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 221 tcgtgctcttcttcttcttc 240
           ||||||||||||||||||||
Sbjct: 149 tcgtgctcttcttcttcttc 130



to top

>gb|AY702899.1| Tetraodon nigroviridis XK-related protein 2b (XRG2b) mRNA, complete
           cds
          Length = 2083

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 tgctcttcttcttcttccaa 243
           ||||||||||||||||||||
Sbjct: 897 tgctcttcttcttcttccaa 916



to top

>gb|AY702898.1| Tetraodon nigroviridis XK-related protein 2a (XRG2a) mRNA, complete
           cds
          Length = 1466

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 tgctcttcttcttcttccaa 243
           ||||||||||||||||||||
Sbjct: 868 tgctcttcttcttcttccaa 887



to top

>emb|AL596163.1| Listeria innocua Clip11262 complete genome, segment 1/12
          Length = 231450

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 218    tggtcgtgctcttcttcttc 237
              ||||||||||||||||||||
Sbjct: 181404 tggtcgtgctcttcttcttc 181385



to top

>dbj|AK125876.1| Homo sapiens cDNA FLJ43888 fis, clone TESTI4009306, moderately
           similar to Homo sapiens ornithine decarboxylase antizyme
           3 (OAZ3)
          Length = 3786

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 ttccaagggatcccatcctt 257
           ||||||||||||||||||||
Sbjct: 300 ttccaagggatcccatcctt 281



to top

>gb|AC005396.3| Arabidopsis thaliana chromosome 2 clone T26I20 map mi398, complete
             sequence
          Length = 85214

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 226   ctcttcttcttcttccaagg 245
             ||||||||||||||||||||
Sbjct: 34713 ctcttcttcttcttccaagg 34694



to top

>dbj|AP004011.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1381_H04
          Length = 130961

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   tcgtgctcttcttcttcttc 240
             ||||||||||||||||||||
Sbjct: 18236 tcgtgctcttcttcttcttc 18255



to top

>dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0592C05
          Length = 150478

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 221    tcgtgctcttcttcttcttc 240
              ||||||||||||||||||||
Sbjct: 118210 tcgtgctcttcttcttcttc 118229



to top

>gb|U51918.1|PSU51918 Pisum sativum mitochondrial pyruvate dehydrogenase E1 alpha subunit
           mRNA, complete cds
          Length = 1630

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 227 tcttcttcttcttccaagggatcc 250
           ||||||||||||||||| ||||||
Sbjct: 251 tcttcttcttcttccaacggatcc 274


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,450,707
Number of Sequences: 3902068
Number of extensions: 2450707
Number of successful extensions: 607496
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 607371
Number of HSP's gapped (non-prelim): 125
length of query: 342
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 320
effective length of database: 17,147,199,772
effective search space: 5487103927040
effective search space used: 5487103927040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top