Clone Name | bastl31h01 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ966349.1| Hordeum vulgare subsp. vulgare mRNA for lipoxygenase-like protein (lox gene) Length = 3123 Score = 482 bits (243), Expect = e-133 Identities = 249/251 (99%) Strand = Plus / Plus Query: 21 aaaacaggggggctgctactggtgtccggtccaaccgtccaagatccagagcgagaaaca 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aaaacaggggggctgctactggtgtccggtccaaccgtccaagatccagagcgagaaaca 60 Query: 81 tatccccctgcccggccagccgccctgacccatttcgtccccggcgagcgatcttaacct 140 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 61 tatccccctgcccggccagccgctctgacccatttcgtccccggcgagcgatcttaacct 120 Query: 141 tgctaatctgcgccgacgagggaggggagcttctttctacggtcatgccgccgatggagc 200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 tgctaatctgcgccgacgagggaggggagcttctttctacggtcatgccgccgatggagc 180 Query: 201 tgctggggagatccttcttgcaggcggcaggctctgccagcaccgcggcgcctcgcggcg 260 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 181 tgctggggagatccttcttgcaggcggcaggctctgccagcaccgcggcgcatcgcggcg 240 Query: 261 gccgggagcgc 271 ||||||||||| Sbjct: 241 gccgggagcgc 251
>gb|AC163741.3| Pan troglodytes BAC clone CH251-406E22 from chromosome unknown, complete sequence Length = 169655 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 98197 ccccctgcccggccagccgccctg 98220 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 99003 ctgcccggccagccgccctg 99022
>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome 19 Length = 413528 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 382826 ccccctgcccggccagccgccctg 382849 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 305704 ccccctgcccggccagccgccc 305725 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 168597 ccccctgcccggccagccgccc 168576 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 305152 ctgcccggccagccgccctg 305171 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 305025 ctgcccggccagccgccctg 305044
>gb|AC186184.1| Pan troglodytes chromosome UNKNOWN clone CH251-131M1, complete sequence Length = 135932 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 12837 ccccctgcccggccagccgccctg 12814 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12886 ccccctgcccggccagccgccc 12865 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 12451 ctgcccggccagccgccctg 12432
>gb|AC183617.3| Pan troglodytes BAC clone CH251-104G17 from chromosome 4, complete sequence Length = 172744 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 105745 ccccctgcccggccagccgccctg 105722 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 105342 ccccctgcccggccagccgccc 105321 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 105293 ccccccgcccggccagccgccctg 105270
>gb|AC183799.2| Pan troglodytes BAC clone CH251-329J7 from chromosome 7, complete sequence Length = 174044 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 153122 ccccctgcccggccagccgccctg 153145 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 153654 ctgcccggccagccgccctg 153673
>gb|AC183830.2| Pan troglodytes BAC clone CH251-267I9 from chromosome 7, complete sequence Length = 157720 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 108648 ccccctgcccggccagccgccctg 108625 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 108018 ctgcccggccagccgccctg 107999
>ref|XM_989388.1| PREDICTED: Mus musculus hypothetical protein LOC667261 (LOC667261), mRNA Length = 498 Score = 48.1 bits (24), Expect = 0.014 Identities = 30/32 (93%) Strand = Plus / Minus Query: 238 cagcaccgcggcgcctcgcggcggccgggagc 269 |||||||||||| ||||||||| ||||||||| Sbjct: 262 cagcaccgcggcccctcgcggccgccgggagc 231
>gb|AC146199.2| Pan troglodytes BAC clone RP43-25F11 from 7, complete sequence Length = 186750 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 54750 ccccctgcccggccagccgccctg 54727 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 54299 ccccccgcccggccagccgccctg 54276 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 54217 ctgcccggccagccgccctg 54198
>gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, complete sequence Length = 190680 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 46172 ccccctgcccggccagccgccctg 46195
>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence Length = 179509 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 148806 ccccctgcccggccagccgccctg 148783 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 149080 ccccctgcccggccagccgccc 149059
>gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, complete sequence Length = 183459 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 116475 ccccctgcccggccagccgccctg 116498
>gb|AC146166.2| Pan troglodytes BAC clone RP43-1B23 from 7, complete sequence Length = 165177 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 14323 ccccctgcccggccagccgccctg 14300 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 14015 ccccccgcccggccagccgccctg 13992
>gb|AC144512.1| Pan troglodytes BAC clone RP43-51G12 from 7, complete sequence Length = 161807 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 83005 ccccctgcccggccagccgccctg 82982 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 82506 ccccctgcccggccagccgccctg 82483 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 82070 ctgcccggccagccgccctg 82051
>gb|AC103849.3| Homo sapiens chromosome 8, clone RP11-75H14, complete sequence Length = 147107 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 45070 ccccctgcccggccagccgccctg 45047
>emb|AL929472.21| Human DNA sequence from clone RP11-109P14 on chromosome 1 Contains a pseudogene similar to part of actinin alpha4 (ACTN4), a novel pseudogene, two genes for novel proteins (FLJ31434, FLJ45459), the gene for ischemia/reperfusion inducible protein (FLJ23476), the MTF1 gene for metal-regulatory transcription factor 1, a ribosomal protein S2 (RPS2) pseudogene, the 3' end of the INPP5B gene for 75kDa nositol polyphosphate-5-phosphatase, two novel genes and four CpG islands, complete sequence Length = 143060 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 125515 ccccctgcccggccagccgccctg 125538 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 3077 ccccctgcccggccagccgccc 3056 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 2671 ccccctgcccggccagccgccc 2650
>emb|Z75889.1|HS267P19 Human DNA sequence from clone RP1-267P19 on chromosome 13 Contains part of the gene for androgen-induced prostate proliferative shutoff associated protein (AS3) (CG008, FLJ23236, KIAA0979) and two CpG islands, complete sequence Length = 113704 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 81398 ccccctgcccggccagccgccctg 81421
>emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chromosome 1 Contains the 5' end of one variant of the ZSWIM5 gene for zinc finger SWIM domain containing 5 and four CpG islands, complete sequence Length = 177710 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 151540 ccccctgcccggccagccgccctg 151563
>emb|AL590710.14| Human DNA sequence from clone RP11-153P4 on chromosome 9 Contains the 3' end of the VAV2 gene for vav 2 oncogene, the 5' end of the SARDH gene for sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) and a CpG island, complete sequence Length = 118671 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 68233 ccccctgcccggccagccgccctg 68256
>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1 gene for forkhead box E1 (thyroid transcription factor 2), HEMGN gene for hemogen, 2 novel genes and 5 CpG islands, complete sequence Length = 160796 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 15266 ccccctgcccggccagccgccctg 15289
>emb|AL365505.15| Human DNA sequence from clone RP11-382A12 on chromosome 20 Contains the 5' end of the SAMHD1 gene for SAM domain and HD domain 1, the 3' end of the RBL1 gene for retinoblastoma-like protein 1 (p107) and three CpG islands, complete sequence Length = 101500 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 66452 ccccctgcccggccagccgccctg 66429
>emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on chromosome 1 Contains the 5' end of a novel pseudogene, a profilin 1 (PFN1) pseudogene, six novel genes and a novel pseudogene, complete sequence Length = 204702 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 24333 ccccctgcccggccagccgccctg 24356 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 23756 ccccctgcccggccagccgccc 23777 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 89129 ccccccgcccggccagccgccctg 89152
>emb|AL354806.22| Human DNA sequence from clone RP11-521J24 on chromosome 13 Contains a novel gene, complete sequence Length = 198959 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 120188 ccccctgcccggccagccgccctg 120165
>gb|AC183592.2| Pan troglodytes BAC clone CH251-733I16 from chromosome 10, complete sequence Length = 167069 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 29167 ccccctgcccggccagccgccctg 29190 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 29472 ccccctgcccggccagccgccc 29493
>emb|AL161644.6| Human DNA sequence from clone RP5-997D24 on chromosome 1 Contains the 3' end of the MRPL37 gene for mitochondrial ribosomal protein L37, two novel genes, the 3' end of the SSBP3 gene for single stranded DNA binding protein 3, a novel protein (MSTP128) and a CpG island, complete sequence Length = 83463 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 19248 ccccctgcccggccagccgccctg 19271 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 19072 ccccctgcccggccagccgccc 19093
>emb|AL024507.7|HS191J18 Human DNA sequence from clone RP1-191J18 on chromosome 6q16.1-22.33 Contains the SEC63 gene for SEC63-like (S. cerevisiae), a 60S ribosomal protein 23A (RPL23A) pseudogene, a ribosomal protein L14 (RPL14) pseudogene, a pseudogene similar to part of methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase (MTHFD2) (NMDMC) and three CpG islands, complete sequence Length = 152408 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 45857 ccccctgcccggccagccgccctg 45834 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 64883 ccccctgcccggccagccgccc 64862 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 64610 ccccctgcccggccagccgccc 64589
>emb|AL034374.2|HS483K16 Human DNA sequence from clone RP3-483K16 on chromosome 6p12.1-21.1 Contains the gene for homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 (HELO1), a 40S Ribosomal protein (RPS16) pseudogene, a 60S Ribosomal protein (RPL31) pseudogene and CpG islands, complete sequence Length = 101270 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 40583 ccccctgcccggccagccgccctg 40560
>gb|AC107952.5| Homo sapiens chromosome 8, clone RP11-140I16, complete sequence Length = 142102 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 135827 ccccctgcccggccagccgccctg 135804
>gb|AC183687.3| Pan troglodytes BAC clone CH251-25N14 from chromosome 1, complete sequence Length = 192054 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 168767 ccccctgcccggccagccgccctg 168790 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 168894 ccccccgcccggccagccgccctg 168917
>gb|AC182637.3| Pan troglodytes BAC clone CH251-431A15 from chromosome 7, complete sequence Length = 186750 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 135330 ccccctgcccggccagccgccctg 135307 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 135379 ccccccgcccggccagccgccctg 135356 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgc 103 |||||||||||||||||||| Sbjct: 135024 ccccctgcccggccagccgc 135005 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 134830 ccccccgcccggccagccgccctg 134807 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 134621 ctgcccggccagccgccctg 134602
>gb|AC148926.4| Pan troglodytes BAC clone RP43-136P16 from chromosome 7, complete sequence Length = 178320 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 63880 ccccctgcccggccagccgccctg 63857 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 63279 ccccctgcccggccagccgccctg 63256 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 62795 ctgcccggccagccgccctg 62776 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 62751 ccccccgcccggccagccgccctg 62728 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 62667 ctgcccggccagccgccctg 62648 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 62169 ctgcccggccagccgccctg 62150
>gb|AC163739.2| Pan troglodytes BAC clone CH251-503F22 from chromosome unknown, complete sequence Length = 220347 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 108079 ccccctgcccggccagccgccctg 108056 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 107579 ccccccgcccggccagccgccctg 107556 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 107370 ctgcccggccagccgccctg 107351
>gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, complete sequence Length = 128501 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 24646 ccccctgcccggccagccgccctg 24623 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 24374 ccccctgcccggccagccgccc 24353 Score = 42.1 bits (21), Expect = 0.89 Identities = 24/25 (96%) Strand = Plus / Minus Query: 83 tccccctgcccggccagccgccctg 107 |||| |||||||||||||||||||| Sbjct: 25018 tccctctgcccggccagccgccctg 24994 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 25095 ccccccgcccggccagccgccctg 25072
>gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, complete sequence Length = 152039 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 77769 ccccctgcccggccagccgccctg 77792 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 77542 ccccctgcccggccagccgccc 77563 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 77264 ccccctgcccggccagccgccc 77285 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 77138 ccccctgcccggccagccgccc 77159
>gb|AC027088.8| Homo sapiens chromosome 15, clone RP11-809H16, complete sequence Length = 187712 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 150398 ccccctgcccggccagccgccctg 150421
>gb|AC157480.3| Pan troglodytes BAC clone CH251-394P5 from chromosome unknown, complete sequence Length = 179883 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 112132 ccccctgcccggccagccgccctg 112155 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 113118 ctgcccggccagccgccctg 113137 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 112909 ccccccgcccggccagccgccctg 112932
>gb|AC010355.7| Homo sapiens chromosome 5 clone CTD-2027K22, complete sequence Length = 198396 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 66980 ccccctgcccggccagccgccctg 67003
>gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, complete sequence Length = 107137 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 61806 ccccctgcccggccagccgccctg 61829 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 62079 ccccctgcccggccagccgccc 62100 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 61357 ccccccgcccggccagccgccctg 61380
>gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome 13, complete sequence Length = 223130 Score = 48.1 bits (24), Expect = 0.014 Identities = 30/32 (93%) Strand = Plus / Plus Query: 238 cagcaccgcggcgcctcgcggcggccgggagc 269 |||||||||||| ||||||||| ||||||||| Sbjct: 177584 cagcaccgcggcccctcgcggccgccgggagc 177615
>gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F5, complete sequence Length = 103115 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 79620 ccccctgcccggccagccgccctg 79643
>gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, complete sequence Length = 166873 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 139428 ccccctgcccggccagccgccctg 139405 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 13530 ccccctgcccggccagccgccc 13551 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 13352 ccccctgcccggccagccgccc 13373 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 13175 ccccccgcccggccagccgccctg 13198
>gb|AC147282.3| Pan troglodytes BAC clone RP43-86L11 from chromosome 7, complete sequence Length = 223086 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 123496 ccccctgcccggccagccgccctg 123473 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 85 cccctgcccggccagccgccc 105 ||||||||||||||||||||| Sbjct: 42008 cccctgcccggccagccgccc 41988
>gb|AC145873.3| Pan troglodytes BAC clone RP43-20K16 from chromosome 7, complete sequence Length = 149916 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 113227 ccccctgcccggccagccgccctg 113250
>gb|AC112510.9| Homo sapiens 3 BAC RP11-432A8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192749 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 5466 ccccctgcccggccagccgccctg 5489 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 4628 ccccctgcccggccagccgccc 4649
>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence Length = 129402 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 9298 ccccctgcccggccagccgccctg 9321
>gb|AC020550.4| Homo sapiens BAC clone RP11-198M19 from 2, complete sequence Length = 172813 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 47551 ccccctgcccggccagccgccctg 47528
>gb|AC159904.2| Pan troglodytes BAC clone CH251-488L1 from chromosome unknown, complete sequence Length = 177340 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 159221 ccccctgcccggccagccgccctg 159244 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 160207 ctgcccggccagccgccctg 160226 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 159998 ccccccgcccggccagccgccctg 160021
>gb|AC145857.3| Pan troglodytes BAC clone RP43-6D4 from chromosome 7, complete sequence Length = 208516 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 141857 ccccctgcccggccagccgccctg 141834 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 141083 ccccctgcccggccagccgccctg 141060 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 141324 ctgcccggccagccgccctg 141305 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 141280 ccccccgcccggccagccgccctg 141257 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 140226 ctgcccggccagccgccctg 140207
>gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete sequence Length = 169741 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 11498 ccccctgcccggccagccgccctg 11521 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 11277 ccccctgcccggccagccgccc 11298
>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence Length = 172761 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 101174 ccccctgcccggccagccgccctg 101197 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 102060 ctgcccggccagccgccctg 102079 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 101851 ccccccgcccggccagccgccctg 101874
>gb|AC010636.6|AC010636 Homo sapiens chromosome 19 clone CTD-2332E11, complete sequence Length = 179393 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 133145 ccccctgcccggccagccgccctg 133168
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region Length = 1750601 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 268292 ccccctgcccggccagccgccctg 268315 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 267693 ccccctgcccggccagccgccctg 267716 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 268891 ccccccgcccggccagccgccctg 268914
>dbj|AP000842.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-680F20riken, complete sequence Length = 179848 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 26015 ccccctgcccggccagccgccctg 26038 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 26323 ccccctgcccggccagccgccc 26344
>gb|AC006344.2|AC006344 Homo sapiens PAC clone RP4-726N20 from 7q32-q34, complete sequence Length = 127447 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 80100 ccccctgcccggccagccgccctg 80077
>emb|CT009602.4| PTB-121B21, complete sequence Length = 236109 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 92208 ccccctgcccggccagccgccctg 92185 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 91659 ccccccgcccggccagccgccctg 91636 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 91450 ctgcccggccagccgccctg 91431 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 91356 ccccccgcccggccagccgccctg 91333
>emb|AL121790.4|CNS01DSI Human chromosome 14 DNA sequence BAC R-356O9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 203650 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 84084 ccccctgcccggccagccgccctg 84061
>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete sequence Length = 194818 Score = 48.1 bits (24), Expect = 0.014 Identities = 30/32 (93%) Strand = Plus / Plus Query: 238 cagcaccgcggcgcctcgcggcggccgggagc 269 |||||||||||| ||||||||| ||||||||| Sbjct: 3512 cagcaccgcggcccctcgcggccgccgggagc 3543
>gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.269_G_24, complete sequence Length = 163685 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 159901 ccccctgcccggccagccgccctg 159924 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 159627 ccccctgcccggccagccgccc 159648
>gb|AC159020.2| Pan troglodytes BAC clone CH251-530A5 from chromosome unknown, complete sequence Length = 219428 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 215284 ccccctgcccggccagccgccctg 215261
>gb|DQ314884.1| Homo sapiens NADPH oxidase, EF-hand calcium binding domain 5 (NOX5) gene, complete cds Length = 128159 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 34745 ccccctgcccggccagccgccctg 34722
>emb|AL353724.11| Human DNA sequence from clone RP11-448I13 on chromosome 13, complete sequence Length = 120652 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 100539 ccccctgcccggccagccgccctg 100562
>gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, complete sequence Length = 127326 Score = 48.1 bits (24), Expect = 0.014 Identities = 24/24 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||||||||| Sbjct: 25493 ccccctgcccggccagccgccctg 25470 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 26025 ccccctgcccggccagccgccc 26004 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 25138 ccccctgcccggccagccgccc 25117
>gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, complete sequence Length = 215644 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccct 106 ||||||||||||||||||||||| Sbjct: 11552 ccccctgcccggccagccgccct 11530 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 11894 ccccctgcccggccagccgccc 11873
>gb|AC004885.2| Homo sapiens PAC clone RP4-781A18 from 7, complete sequence Length = 190842 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccctg 107 ||||||||||||||||||||||| Sbjct: 17505 cccctgcccggccagccgccctg 17527
>emb|AL512422.19| Human DNA sequence from clone RP11-472M19 on chromosome 6 Contains part of the BPAG1 gene for bullous pemphigoid antigen 1 (230/240kD), a novel gene, a ribosomal protein L17 (RPL17) pseudogene and three CpG islands, complete sequence Length = 157918 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccct 106 ||||||||||||||||||||||| Sbjct: 119737 ccccctgcccggccagccgccct 119715 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 120139 ccccctgcccggccagccgccc 120118 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 gcctcgcggcggccgggagc 269 |||||||||||||||||||| Sbjct: 69674 gcctcgcggcggccgggagc 69655
>emb|AL359512.15| Human DNA sequence from clone RP11-163B6 on chromosome 9 Contains the PDCL gene for phosducin-like, a keratin 18 (KRT18) pseudogene, the 3' end of the gene for membrane-associated nucleic acid binding protein (MNAB) (FLJ23389 FLJ20301 FLJ20713) the gene for a novel olfactory (seven transmembrane helix) receptor and two CpG islands, complete sequence Length = 58884 Score = 46.1 bits (23), Expect = 0.057 Identities = 26/27 (96%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctgacc 110 ||||| ||||||||||||||||||||| Sbjct: 55459 cccccggcccggccagccgccctgacc 55485
>emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chromosome 9 Contains the 5' end of the GLDC gene for glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P), a ribosomal protein L23a (RPL23A) pseudogene, a ribosomal protein S3A (RPS3A) pseudogene, the 3' end of a ring finger protein 2 (RNF2) pseudogene, the 5' end of a novel gene and 3 CpG islands, complete sequence Length = 59964 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccctg 107 ||||||||||||||||||||||| Sbjct: 13278 cccctgcccggccagccgccctg 13300
>emb|AL021918.1|HS34I8 Human DNA sequence from clone XXbac-34I8 on chromosome 6p21.3-22.1 Contains the 5' end of the ZNF184 gene for Kruppel-like zinc finger protein 184, a heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene, a CD83 antigen pseudogene, ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 159506 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tccccctgcccggccagccgccc 105 ||||||||||||||||||||||| Sbjct: 33818 tccccctgcccggccagccgccc 33796 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 33638 ccccctgcccggccagccgccc 33617
>gb|AC108743.6| Homo sapiens 3 BAC RP11-206J21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 143682 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 85 cccctgcccggccagccgccctg 107 ||||||||||||||||||||||| Sbjct: 82692 cccctgcccggccagccgccctg 82670 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 86 ccctgcccggccagccgccctg 107 |||||||||||||||||||||| Sbjct: 82644 ccctgcccggccagccgccctg 82623
>gb|AC098484.2| Homo sapiens chromosome 1 clone RP5-994D16, complete sequence Length = 161835 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccct 106 ||||||||||||||||||||||| Sbjct: 98807 ccccctgcccggccagccgccct 98829
>gb|AC021317.19| Homo sapiens chromosome 17, clone RP11-678G7, complete sequence Length = 180876 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tccccctgcccggccagccgccc 105 ||||||||||||||||||||||| Sbjct: 46861 tccccctgcccggccagccgccc 46839
>gb|AC020978.10| Homo sapiens chromosome 16 clone RP11-96D1, complete sequence Length = 164293 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccctg 107 ||||||||||||||||||||||| Sbjct: 62074 cccctgcccggccagccgccctg 62096
>gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, complete sequence Length = 235968 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 83 tccccctgcccggccagccgccc 105 ||||||||||||||||||||||| Sbjct: 225593 tccccctgcccggccagccgccc 225571 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 226047 ccccctgcccggccagccgccc 226026 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 225868 ccccctgcccggccagccgccc 225847
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 243 ccgcggcgcctcgcggcggccgg 265 ||||||||||||||||||||||| Sbjct: 2515072 ccgcggcgcctcgcggcggccgg 2515050
>gb|AC115992.13| Homo sapiens chromosome 17, clone CTD-2022O14, complete sequence Length = 139475 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 83 tccccctgcccggccagccgccc 105 ||||||||||||||||||||||| Sbjct: 25424 tccccctgcccggccagccgccc 25446
>gb|AC004073.1|AC004073 Human Chromosome X, complete sequence Length = 79612 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Minus Query: 85 cccctgcccggccagccgccctg 107 ||||||||||||||||||||||| Sbjct: 15403 cccctgcccggccagccgccctg 15381
>emb|AL133304.4|CNS01DUL Human chromosome 14 DNA sequence BAC R-116N8 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 141905 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccct 106 ||||||||||||||||||||||| Sbjct: 102129 ccccctgcccggccagccgccct 102151 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 101680 ccccctgcccggccagccgccc 101701
>gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 containing NUP155 gene, complete sequence Length = 165617 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 23806 ccccctgcccggccagccgccc 23827 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 143301 ccccccgcccggccagccgccctg 143278
>gb|L29074.1|HUMFMR1S Homo sapiens fragile X mental retardation syndrome protein (FMR1) gene, alternative splice products, complete cds; and pseudogene, complete sequence Length = 185775 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 94122 ccccctgcccggccagccgccc 94101 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 94071 ccccctgcccggccagccgccc 94050
>gb|AC146398.4| Pan troglodytes BAC clone RP43-54K1 from 7, complete sequence Length = 185645 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 101097 ccccctgcccggccagccgccc 101076 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 100651 ctgcccggccagccgccctg 100632
>gb|AC108879.3| Homo sapiens chromosome X clone RP11-265P11 map p11.4, complete sequence Length = 174766 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 104540 ccccctgcccggccagccgccc 104561 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 104364 ccccctgcccggccagccgccc 104385
>gb|AC145687.4| Pan troglodytes BAC clone CH251-281C1 from X, complete sequence Length = 138000 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 49919 ccccctgcccggccagccgccc 49940 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 50707 ccccccgcccggccagccgccctg 50730
>gb|AC142169.2| Homo sapiens fosmid clone XXFOS-81770D1 from 7, complete sequence Length = 37728 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 2507 ccccctgcccggccagccgccc 2528
>gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, complete sequence Length = 208817 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 168126 ccccctgcccggccagccgccc 168147
>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete sequence Length = 199482 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 157716 ccccctgcccggccagccgccc 157695 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 57955 ccccctgcccggccagccgccc 57934
>gb|AC009712.22| Homo sapiens chromosome 15, clone RP11-361M10, complete sequence Length = 213746 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 192616 ccccctgcccggccagccgccc 192595
>gb|AC149044.1| Pan troglodytes chromosome X clone PTB-089E19 map human ortholog q27.1, complete sequence Length = 193569 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 56041 ccccctgcccggccagccgccc 56062 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 55816 ccccctgcccggccagccgccc 55837
>gb|AC133330.3| Homo sapiens chromosome 8 clone RP11-134N2, complete sequence Length = 164916 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 10310 ccccctgcccggccagccgccc 10331
>gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA03715 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0103 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 118048 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 103281 ccccctgcccggccagccgccc 103302 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 102974 ccccctgcccggccagccgccc 102995
>gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14663 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 99966 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 74868 ccccctgcccggccagccgccc 74889 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 74510 ccccctgcccggccagccgccc 74531 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 74231 ccccctgcccggccagccgccc 74252 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 73778 ccccctgcccggccagccgccc 73799
>gb|AY663409.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA04535 MHC class II antigen (HLA-DQB1) gene and MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, complete cds; and MHC class II antigen (HLA-DRB1) gene, partial cds Length = 77506 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 68584 ccccctgcccggccagccgccc 68605 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 68226 ccccctgcccggccagccgccc 68247 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 67820 ccccctgcccggccagccgccc 67841
>gb|AY663407.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 106318 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 24686 ccccctgcccggccagccgccc 24707
>gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*150101 allele, complete cds Length = 103395 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 85431 ccccctgcccggccagccgccc 85452 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 85073 ccccctgcccggccagccgccc 85094 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 84794 ccccctgcccggccagccgccc 84815
>gb|AY663399.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01018 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*050101 allele, and MHC class II antigen (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds Length = 105464 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 18001 ccccctgcccggccagccgccc 18022
>gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14660 MHC class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602 allele, MHC class II antigen (HLA-DQA1) gene, HLA-DQA1-DQA1*010201 allele, and MHC class II antigen (HLA-DRB1) gene, complete cds Length = 104996 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 74395 ccccctgcccggccagccgccc 74416 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 74037 ccccctgcccggccagccgccc 74058 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 73758 ccccctgcccggccagccgccc 73779 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 73630 ccccctgcccggccagccgccc 73651
>gb|AC069503.25| Homo sapiens 12 BAC RP11-87C12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186580 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 63390 ccccctgcccggccagccgccc 63369
>gb|AC002065.2| Homo sapiens BAC clone CTB-21N8 from 7, complete sequence Length = 117954 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12752 ccccctgcccggccagccgccc 12731
>gb|AC103703.5| Homo sapiens chromosome 17, clone RP11-764D10, complete sequence Length = 144240 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 64986 ccccctgcccggccagccgccc 64965
>gb|AC152064.3| Pan troglodytes BAC clone RP43-134I6 from chromosome 7, complete sequence Length = 179272 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 71080 ccccctgcccggccagccgccc 71101
>gb|AY500996.1| Homo sapiens angiogenic factor VG5Q gene, complete cds Length = 40275 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 15835 ccccctgcccggccagccgccc 15814 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 16257 ccccccgcccggccagccgccctg 16234
>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence Length = 148689 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 71199 ccccctgcccggccagccgccc 71220
>gb|AC073324.6| Homo sapiens BAC clone RP11-339F13 from 7, complete sequence Length = 125253 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 32192 ccccctgcccggccagccgccc 32171 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 32014 ccccctgcccggccagccgccc 31993
>gb|AC005192.1| Homo sapiens BAC clone CTB-163K11 from 7, complete sequence Length = 128600 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 90604 ccccctgcccggccagccgccc 90625
>gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complete sequence Length = 106172 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 21788 ccccctgcccggccagccgccc 21809
>gb|AY526322.1| Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) (DDC) gene, complete cds Length = 106328 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 102868 ccccctgcccggccagccgccc 102847 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 102389 ccccctgcccggccagccgccc 102368
>gb|AC004008.2| Homo sapiens PAC clone RP5-899B21 from 7, complete sequence Length = 90389 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 87216 ccccctgcccggccagccgccc 87237 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 86585 ctgcccggccagccgccctg 86604
>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence Length = 196954 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 151342 ccccctgcccggccagccgccc 151363
>gb|AC018705.10| Homo sapiens BAC clone RP11-95E2 from 7, complete sequence Length = 174970 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 52935 ccccctgcccggccagccgccc 52956 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 52456 ccccctgcccggccagccgccc 52477
>gb|AC004079.1| Homo sapiens PAC clone RP1-167F23 from 7, complete sequence Length = 102717 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 27930 ccccctgcccggccagccgccc 27951 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgc 103 |||||||||||||||||||| Sbjct: 27754 ccccctgcccggccagccgc 27773
>gb|AC146211.3| Pan troglodytes BAC clone RP43-33E10 from 7, complete sequence Length = 164849 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 85449 ccccctgcccggccagccgccc 85428 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 85001 ccccctgcccggccagccgccc 84980
>gb|AY203949.1| Homo sapiens LP3428 mRNA, complete cds Length = 1269 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 312 ccccctgcccggccagccgccc 333 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 488 ccccccgcccggccagccgccctg 511
>gb|AC146176.2| Pan troglodytes BAC clone RP43-24N3 from 7, complete sequence Length = 138742 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 94410 ccccctgcccggccagccgccc 94431
>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete sequence Length = 154563 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 125365 ccccctgcccggccagccgccc 125386 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 125673 ctgcccggccagccgccctg 125692 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 125545 ctgcccggccagccgccctg 125564
>gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, complete sequence Length = 166843 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 33586 ccccctgcccggccagccgccc 33565 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 34035 ccccccgcccggccagccgccctg 34012
>gb|AC090001.19| Homo sapiens 12 BAC RP11-536G4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 207366 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 153237 ccccctgcccggccagccgccc 153216
>gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 88686 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 54411 ccccctgcccggccagccgccc 54432 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 14327 ccccctgcccggccagccgccc 14306 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 55099 ccccccgcccggccagccgccctg 55122 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 54874 ccccccgcccggccagccgccctg 54897 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 54825 ccccccgcccggccagccgccctg 54848
>gb|AC090107.16| Homo sapiens 12 BAC RP11-643D8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 83755 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 59848 ccccctgcccggccagccgccc 59869
>gb|AC091170.15| Homo sapiens chromosome 18, clone RP11-879D5, complete sequence Length = 198586 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42354 ccccctgcccggccagccgccc 42375 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42029 ccccctgcccggccagccgccc 42050
>gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, complete sequence Length = 142265 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 31538 ccccctgcccggccagccgccc 31559 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 |||||||||||||||||| ||||| Sbjct: 31134 ccccctgcccggccagcctccctg 31157
>gb|AC114801.4| Homo sapiens BAC clone RP11-777B9 from 4, complete sequence Length = 69745 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42484 ccccctgcccggccagccgccc 42463
>gb|AC004912.2| Homo sapiens PAC clone RP5-871B15 from 7, complete sequence Length = 157321 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 157250 ccccctgcccggccagccgccc 157229
>gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete sequence Length = 176929 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 115456 ccccctgcccggccagccgccc 115435
>gb|AC006451.5| Homo sapiens PAC clone RP4-562A11 from 7, complete sequence Length = 145966 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 29737 ccccctgcccggccagccgccc 29716 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 5471 ccccctgcccggccagccgccc 5492
>gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, complete sequence Length = 178670 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 121710 ccccctgcccggccagccgccc 121731 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 121309 ccccctgcccggccagccgccc 121330
>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence Length = 140861 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 58166 ccccctgcccggccagccgccc 58145 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 33684 ccccctgcccggccagccgccc 33705 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 33636 ccccctgcccggccagccgccc 33657 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccc 105 ||||||||||||||||||||| Sbjct: 105055 cccctgcccggccagccgccc 105075
>gb|AC093087.3| Homo sapiens BAC clone RP11-785H2 from 7, complete sequence Length = 123039 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 75524 ccccctgcccggccagccgccc 75545
>gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complete sequence Length = 57554 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 51033 ccccctgcccggccagccgccc 51012 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 50982 ccccctgcccggccagccgccc 50961
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103 genomic sequence Length = 341361 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 134647 ccccctgcccggccagccgccc 134668 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 134520 ccccctgcccggccagccgccc 134541 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 134391 ccccctgcccggccagccgccc 134412 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 132248 ccccccgcccggccagccgccctg 132225
>gb|AC144511.1| Pan troglodytes BAC clone RP43-45C15 from 7, complete sequence Length = 153510 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 92694 ccccctgcccggccagccgccc 92715
>gb|AY388614.1| Homo sapiens polymerase (DNA directed), eta (POLH) gene, complete cds Length = 40997 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 5652 ccccctgcccggccagccgccc 5631
>gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gene, complete cds Length = 66886 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 38439 ccccctgcccggccagccgccc 38418
>gb|AC114934.2| Homo sapiens chromosome 5 clone CTD-2029K19, complete sequence Length = 114356 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 37117 ccccctgcccggccagccgccc 37096 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 36939 ccccctgcccggccagccgccc 36918 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 36888 ccccctgcccggccagccgccc 36867 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 36710 ccccctgcccggccagccgccc 36689 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 36532 ccccctgcccggccagccgccc 36511
>gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, complete sequence Length = 161421 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 39099 ccccctgcccggccagccgccc 39078 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 39047 ccccctgcccggccagccgccc 39026 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 38689 ccccctgcccggccagccgccc 38668 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 39375 ccccccgcccggccagccgccctg 39352
>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence Length = 198564 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 57582 ccccctgcccggccagccgccc 57561 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 58004 ccccccgcccggccagccgccctg 57981
>gb|DQ070893.1| Homo sapiens AGR2 (AGR2) gene, complete cds, alternatively spliced Length = 62498 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 54626 ccccctgcccggccagccgccc 54647 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 54353 ccccctgcccggccagccgccc 54374
>emb|AL731683.12| Human DNA sequence from clone XXbac-254C11 on chromosome 6, complete sequence Length = 83878 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 13823 ccccctgcccggccagccgccc 13802
>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete sequence Length = 153012 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 97702 ccccctgcccggccagccgccc 97681
>gb|AC018988.12| Homo sapiens chromosome 15, clone RP11-233C13, complete sequence Length = 116727 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 107981 ccccctgcccggccagccgccc 108002
>emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 on chromosome X Contains a chondroitin beta 1,4 N-acetylgalactosaminyltransferase (ChGn) pseudogene, a novel gene similar to ADP-ribosylation factor-like 2 (ARL2), variant 1, a novel gene, the 3' end of a novel gene (FLJ12687) and a CpG island, complete sequence Length = 82517 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 31949 ccccctgcccggccagccgccc 31928
>emb|AL929470.20| Human DNA sequence from clone RP11-72M14 on chromosome 1 Contains the 5' end of the WNT2B gene for wingless-type MMTV integration site family, member 2B, the 5' end of the CAPZA1 gene for capping protein (actin filament) muscle Z-line, alpha 1 and a mitochondrial ribosomal protein L53 (MRPL53) pseudogene, complete sequence Length = 34919 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 26038 ccccctgcccggccagccgccc 26059
>emb|AL732431.19| Human DNA sequence from clone XXyac-36GH4 on chromosome 6 Contains the gene for acid sphingomyelinase-like phosphodiesterase 3a (ASML3A), an H+ transporting mitochondrial F0 complex ATP synthase subunit g (ATP5L) pseudogene and two CpG islands, complete sequence Length = 164746 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 62640 ccccctgcccggccagccgccc 62619
>emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on chromosome 9, complete sequence Length = 100719 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 83915 ccccctgcccggccagccgccc 83936
>emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221F2 on chromosome X Contains the NXF3 gene for nuclear RNA export factor 3 and a novel pseudogene, complete sequence Length = 37764 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7769 ccccctgcccggccagccgccc 7790
>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete sequence Length = 117939 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 66365 ccccctgcccggccagccgccc 66344 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 66037 ccccctgcccggccagccgccc 66016 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 65810 ccccctgcccggccagccgccc 65789
>emb|Z84489.1|HS93N13 Human DNA sequence from clone RP1-93N13 on chromosome 6p21 Contains the HLA-DRB1*03011 and HLA-DQA1*05011 genes for major histocompatibility complex class II DR beta 1 and DQ alpha 1, a CpG island, ESTs, STSs and GSSs, complete sequence Length = 86896 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 4483 ccccctgcccggccagccgccc 4504
>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete sequence Length = 86882 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 8989 ccccctgcccggccagccgccc 9010 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 8743 ccccctgcccggccagccgccc 8764 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 9297 ctgcccggccagccgccctg 9316
>emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on chromosome X Contains a mitochondrial ribosomal protein S18C (MRPS18C) pseudogene, the 3' end of the gene for a novel protein similar to PHD finger protein 2 PHF2 and a CpG island, complete sequence Length = 224187 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 152943 ccccctgcccggccagccgccc 152964
>emb|BX004807.10| Human DNA sequence from clone RP11-565D17 on chromosome 1 Contains the 5' end of the ITGB3BP gene for integrin beta 3 binding protein (beta3-endonexin), the 5' end of a novel gene (KIAA1799) and a CpG island, complete sequence Length = 78203 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 24764 ccccctgcccggccagccgccc 24785
>emb|AL935026.4| Human DNA sequence from clone DAQB-109B10 on chromosome 6 Contains the HLA-DQA1 gene for the major histocompatibility complex, class II, DQ alpha 1 protein, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1 protein and one CpG island, complete sequence Length = 39179 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 16500 ccccctgcccggccagccgccc 16479
>emb|AL662924.24| Human DNA sequence from clone RP11-108J9 on chromosome 1 Contains the 3' end of the CLIC4 gene for chloride intracellular channel 4 and three CpG islands, complete sequence Length = 82931 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 49941 ccccctgcccggccagccgccc 49920 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 49415 ccccctgcccggccagccgccc 49394 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 49366 ccccctgcccggccagccgccc 49345 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 16434 ccccctgcccggccagccgccc 16455
>emb|AL662789.11| Human DNA sequence from clone XXbac-254F23 on chromosome 6 contains the 5' end of the HLA-DRB1 gene for major histocompatibility complex, class II, DR beta 1, the HLA-DQA1 gene for major histocompatibility complex, class II, DQ alpha 1, the HLA-DQB1 gene for major histocompatibility complex, class II, DQ beta 1, a cytochrome C oxidase polypeptide III pseudogene, a major histocompatibility complex, class II, beta polypeptide pseudogene and two CpG islands, complete sequence Length = 147557 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7795 ccccctgcccggccagccgccc 7774 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7342 ccccctgcccggccagccgccc 7321 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7063 ccccctgcccggccagccgccc 7042 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 6705 ccccctgcccggccagccgccc 6684
>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the 5' end of the gene for alpha-catenin-like protein (MGC26194) (VR22), a aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10) pseudogene and a CpG island, complete sequence Length = 121210 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 61183 ccccctgcccggccagccgccc 61204
>emb|AL672220.6| Human DNA sequence from clone RP11-17C2 on chromosome 1 Contains a CpG island, complete sequence Length = 104417 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 15528 ccccctgcccggccagccgccc 15507 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 15397 ctgcccggccagccgccctg 15378
>emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on chromosome 6 contains two P5-1 pseudogenes, the HLA-F gene for major histocompatibility complex, class I, F, a ribosomal protein L23A (RPL23A) pseudogene, a MHC class 1 polypeptide-related sequence B (MICB) pseudogene, a HCGIX pseudogene, a interferon-induced transmembrane protein 3 (IFITM3) pseudogene, a HLA (MHC class 1) pseudogene, a putative novel MHC class 1 (HLA) protein, a 60S ribosomal protein L7A (RPL7A) pseudogene and five CpG islands, complete sequence Length = 123768 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 16233 ccccctgcccggccagccgccc 16254
>emb|AL603890.14| Human DNA sequence from clone RP11-584P2 on chromosome 1 Contains the 3' end of a novel gene similar to preferentially expressed antigen in melanoma (PRAME), two novel proteins similar to preferentially expressed antigen in melanoma (PRAME), a novel gene and a CpG island, complete sequence Length = 88806 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 32558 ccccctgcccggccagccgccc 32579
>emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chromosome 1 Contains part of the CAMTA1 gene for calmodulin binding transcription activator 1, complete sequence Length = 107112 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 47413 ccccctgcccggccagccgccc 47392
>emb|AL606491.19| Human DNA sequence from clone RP11-70P17 on chromosome 1 Contains the 3' end of the gene for LDL receptor adaptor protein (ARH) and a novel gene, complete sequence Length = 49875 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42038 ccccctgcccggccagccgccc 42059
>emb|AL606477.11| Human DNA sequence from clone RP11-190H11 on chromosome 1 Contains the 5' end of the gene for HP1-BP74, the 3' end of the EIF4G3 gene for eukaryotic translation initiation factor 4 gamma, 3 and three CpG islands, complete sequence Length = 139961 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 61232 ccccctgcccggccagccgccc 61253 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 60833 ccccctgcccggccagccgccc 60854 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 atccccctgcccggccagccgccc 105 ||||| |||||||||||||||||| Sbjct: 60957 atccctctgcccggccagccgccc 60980
>emb|AL592046.7| Human DNA sequence from clone RP11-155O24 on chromosome X Contains part of the gene for upstream regulatory element binding protein 1 (UREB1) and a CpG island, complete sequence Length = 86196 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 43986 ccccctgcccggccagccgccc 44007
>emb|AL590640.19| Human DNA sequence from clone RP11-40H20 on chromosome 1 Contains the 5' end of the SLC9A1 gene for solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive), a ribosomal protein L18a (RPL18A) pseudogene, a novel pseudogene (FLJ20420), a nucleophosmin (nucleolar phosphoprotein B23, numatrin)(NPM1) pseudogene, a mall nuclear ribonucleoprotein polypeptide E (SNRPE) pseudogene, a novel gene, the 5' end of a novel gene (KIAA1037) and a CpG island, complete sequence Length = 147052 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 9425 ccccctgcccggccagccgccc 9446
>emb|AL591043.11| Human DNA sequence from clone RP11-357J22 on chromosome 1 Contains a proteolipid protein 2 (colonic epithelium-enriched) (PLP2) pseudogene, a mortality factor 4 (MORF4) pseudogene and a CPG island, complete sequence Length = 147109 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 93061 ccccctgcccggccagccgccc 93040
>emb|AL589843.9| Human DNA sequence from clone RP11-535M15 on chromosome 9 Contains a novel gene, a makorin, ring finger protein, 2 (MKRN2) pseudogene, a novel gene (KIAA0972) and five CpG islands, complete sequence Length = 142527 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 47938 ccccctgcccggccagccgccc 47917
>emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on chromosome 10 Contains part of the gene for CamKI-like protein kinase (CKLiK) (LOC221042 LOC283070) and two CpG islands, complete sequence Length = 113920 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 72966 ccccctgcccggccagccgccc 72945 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 72567 ccccctgcccggccagccgccc 72546 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 82 atccccctgcccggccagccgccc 105 ||||| |||||||||||||||||| Sbjct: 72842 atccctctgcccggccagccgccc 72819 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 72743 ccccccgcccggccagccgccctg 72720
>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains the 3' end of a breast cancer antigen (NY-BR-1) pseudogene, the 3' end of a novel gene, a pseudogene similar to part of cubilin (intrinsic factor-cobalamin receptor, CUBN), a seven transmembrane helix receptor (FLJ31393) pseudogene, the OR13A1 gene for olfactory receptor family 13 subfamily A member 1 and two CpG islands, complete sequence Length = 168473 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 87151 ccccctgcccggccagccgccc 87172
>emb|AL513044.13| Human DNA sequence from clone RP11-187D4 on chromosome 1 Contains a CpG island, complete sequence Length = 111901 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 86945 ccccctgcccggccagccgccc 86966 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 86818 ccccctgcccggccagccgccc 86839 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 86642 ccccctgcccggccagccgccc 86663 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 86367 ccccccgcccggccagccgccctg 86390
>emb|AL513314.12| Human DNA sequence from clone RP11-358H9 on chromosome 1 Contains a novel gene, a capicua homolog (Drosophila) (CIC) pseudogene and a CpG island, complete sequence Length = 58205 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 48607 ccccctgcccggccagccgccc 48628
>emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chromosome X Contains a heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3) pseudogene, a WW domain binding protein 11 (WBP11) pseudogene, a hexokinase 2 (HK2) pseudogene, a proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1) pseudogene, the 3' end of the gene for a novel WD repeat domain protein and three CpG islands, complete sequence Length = 223078 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 213920 ccccctgcccggccagccgccc 213941
>emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chromosome 1 Contains part of the RPS6KC1 gene for ribosomal protein S6 kinase 52kDa polypeptide 1 and a CpG island, complete sequence Length = 176690 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 87741 ccccctgcccggccagccgccc 87720 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 86406 ccccctgcccggccagccgccc 86385
>emb|AL450309.14| Human DNA sequence from clone RP11-478H16 on chromosome 1 Contains the 5' end of the ERO1LB gene for ERO1-like beta (S. cerevisiae), an FK506 binding protein 3, 25kDa (FKBP3) pseudogene, the 5' UTR of a variant of the EDARADD gene for EDAR-associated death domain and three CpG islands, complete sequence Length = 166647 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 160915 ccccctgcccggccagccgccc 160936
>emb|AL445205.14| Human DNA sequence from clone RP11-24J23 on chromosome 1 Contains a novel gene (FLJ38972), the 3' end of the ROR1 gene for receptor tyrosine kinase-like orphan receptor 1, the 5' end of gene MGC35130 and a CpG island, complete sequence Length = 115936 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 106030 ccccctgcccggccagccgccc 106051
>emb|AL442646.14| Human DNA sequence from clone RP11-322A17 on chromosome X Contains a novel pseudogene and a lactate dehydrogenase B pseudogene, complete sequence Length = 155885 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7485 ccccctgcccggccagccgccc 7464 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7336 ccccctgcccggccagccgccc 7315 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 6980 ccccctgcccggccagccgccc 6959
>emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chromosome 1 Contains part of the MACF1 gene for microtubule-actin crosslinking factor 1, a novel gene, a heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) pseudogene and a CpG island, complete sequence Length = 121295 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 8328 ccccctgcccggccagccgccc 8307
>emb|AL445427.23| Human DNA sequence from clone RP5-1091A7 on chromosome 1p22.2-31.1 Contains the 5' end of the COL24A1 gene for collagen type XXIV alpha 1 and two CpG islands, complete sequence Length = 111132 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 69247 ccccctgcccggccagccgccc 69268 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 69118 ccccctgcccggccagccgccc 69139
>emb|AL391809.21| Human DNA sequence from clone RP11-47A4 on chromosome 1 Contains the 5' end of the RYR2 gene for ryanodine receptor 2 (cardiac) and three CpG islands, complete sequence Length = 167548 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 87360 ccccctgcccggccagccgccc 87339
>emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chromosome 1 Contains the 3' end of a novel gene and a CpG island, complete sequence Length = 159117 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 155177 ccccctgcccggccagccgccc 155198
>emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on chromosome 6 Contains part of a novel gene, complete sequence Length = 174678 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 14038 ccccctgcccggccagccgccc 14017
>emb|AL392104.19| Human DNA sequence from clone RP11-324E23 on chromosome 10 Contains the 3' end of a novel gene (DKFZp761L0424) (KIAA1217), the 3' end of the gene for Rho-GTPase activating protein 10 (ARHGAP10) and a CpG island, complete sequence Length = 166643 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 114374 ccccctgcccggccagccgccc 114395 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 114196 ccccctgcccggccagccgccc 114217 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 113770 ccccccgcccggccagccgccctg 113793 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 atccccctgcccggccagccgccc 105 ||||||| |||||||||||||||| Sbjct: 113464 atccccccgcccggccagccgccc 113487
>emb|AL392107.17| Human DNA sequence from clone RP11-114F7 on chromosome 10 Contains the 3' end of the ABCC2 gene for ATP-binding cassette sub-family C (CFTR/MRP) member 2, gene KIAA1010 and two CpG islands, complete sequence Length = 95018 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 83548 ccccctgcccggccagccgccc 83569 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 83294 ccccctgcccggccagccgccc 83315 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 30451 ccccctgcccggccagccgccc 30430 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 29694 ccccctgcccggccagccgccc 29673 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 29467 ccccctgcccggccagccgccc 29446
>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part of the CDK5RAP2 gene for CDK5 regulatory subunit associated protein 2 (C48) and a CpG island, complete sequence Length = 46372 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42796 ccccctgcccggccagccgccc 42817 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42696 ccccctgcccggccagccgccc 42717 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 42164 ccccccgcccggccagccgccctg 42187
>emb|AL442123.12| Human DNA sequence from clone RP11-175O19 on chromosome 10 Contains the 3' end of the MLR2 gene for a novel protein (likely ortholog of mouse transcription factor MLR2), the gene for a novel protein novel protein (DKFZP564P1916)(FLJ13022), the 3' end of the SLIT1 gene for slit homolog 1 (Drosophila) and a CpG island, complete sequence Length = 96660 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 5867 ccccctgcccggccagccgccc 5846
>emb|AL392088.12| Human DNA sequence from clone RP5-964H19 on chromosome 1 Contains the 3' end of the gene for a novel protein similar to FLJ32883 containing DUF1220 domains, a suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13) pseudogene, a novel pseudogene and two CpG islands, complete sequence Length = 74877 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 24427 ccccctgcccggccagccgccc 24406
>emb|AL445587.10| Human DNA sequence from clone RP11-429D3 on chromosome 9 Contains part of a novel gene (LOC158135) and a CpG island, complete sequence Length = 173062 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 121743 ccccctgcccggccagccgccc 121764
>emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on chromosome 10 Contains part of the gene for VPS10 domain receptor protein SORCS 3 (SORCS3), complete sequence Length = 149248 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 58874 ccccctgcccggccagccgccc 58853
>emb|AL445465.10| Human DNA sequence from clone RP11-415D17 on chromosome 6 Contains two novel genes, part of a novel gene, a ubiquitin-conjugating enzyme E2 family pseudogene and a CpG island, complete sequence Length = 126388 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 89997 ccccctgcccggccagccgccc 89976
>emb|AL392103.6| Human DNA sequence from clone RP11-477L16 on chromosome 10 Contains a pseudogene similar to part of nuclease sensitive element binding protein 1 (NSEP1, part of the gene for SEC15 (S. cerevisiae)-like (SEC15L), and one CpG island, complete sequence Length = 125087 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 123059 ccccctgcccggccagccgccc 123080
>emb|AL365179.30| Human DNA sequence from clone RP13-34C21 on chromosome Xq24-25 Contains a chromobox homolog 1 (HP1 beta homolog Drosophila) (CBX1) pseudogene and a CpG island, complete sequence Length = 180851 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 44376 ccccctgcccggccagccgccc 44397
>emb|AL365182.27| Human DNA sequence from clone RP11-560O15 on chromosome 1 Contains a protein phosphatase 1, regulatory (inhibitor) subunit 11 (PPP1R11) pseudogene and a CpG island, complete sequence Length = 56883 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34779 ccccctgcccggccagccgccc 34800 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34557 ccccctgcccggccagccgccc 34578 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34430 ccccctgcccggccagccgccc 34451 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34209 ccccctgcccggccagccgccc 34230 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34082 ccccctgcccggccagccgccc 34103 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 33906 ccccccgcccggccagccgccctg 33929
>emb|AL390729.23| Human DNA sequence from clone RP3-522D1 on chromosome 1 Contains the 5' end of a novel gene, a novel gene, a ribosomal protein L39 (RPL39) pseudogene and a CpG island, complete sequence Length = 69656 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 58487 ccccctgcccggccagccgccc 58466
>emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chromosome 10 Contains the ARHGAP12 gene for Rho GTPase activating protein 12 and two CpG islands, complete sequence Length = 189161 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 182747 ccccctgcccggccagccgccc 182768
>emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on chromosome Xq25-27.1 Contains the 3' end of a novel gene, a serine/arginine repetitive matrix 1 (SRRM1) pseudogene (LOC347480), the GPR101 gene for G protein-coupled receptor 101 and four CpG islands, complete sequence Length = 172280 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 80451 ccccctgcccggccagccgccc 80430 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 80175 ccccctgcccggccagccgccc 80154
>emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on chromosome 6 Contains the 5' end of the gene for tubby super-family protein (TUSP, KIAA1397), a novel gene, part of a novel gene and two CpG islands, complete sequence Length = 180635 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 168062 ccccctgcccggccagccgccc 168083
>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six novel genes similar to preferentially expressed antigen in melanoma (PRAME), two novel genes, two preferentially expressed antigen in melanoma (PRAME) pseudogenes and a CpG island, complete sequence Length = 184591 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 122564 ccccctgcccggccagccgccc 122543
>emb|AL365190.16| Human DNA sequence from clone RP11-512H14 on chromosome 9 Contains the 5' end of the TLE1 gene for transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1), the 5' end of a novel gene and two CpG isalnds, complete sequence Length = 89468 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 84865 ccccctgcccggccagccgccc 84886 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 84765 ccccccgcccggccagccgccctg 84788 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 84539 ccccccgcccggccagccgccctg 84562
>emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chromosome X Contains a CpG island, complete sequence Length = 116800 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 34391 ccccctgcccggccagccgccc 34370
>emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on chromosome 1 Contains the 5' end of the SPATA6 gene for spermatogenesis associated 6, an amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 (ALS2CR2) pseudogene, a ribosomal protein L21 (RPL21) pseudogene and a CpG island, complete sequence Length = 173373 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 56548 ccccctgcccggccagccgccc 56527
>emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on chromosome 10 Contains the 5' end of the MMS19L gene for MMS19-like (MET18 homolog, S. cerevisiae), the gene for a novel protein (FLJ11807), the 5' end of the ANKRD2 gene for ankyrin repeat domain 2 (stretch responsive muscle) and two CpG islands, complete sequence Length = 86299 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 41599 ccccctgcccggccagccgccc 41578 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 41375 ccccctgcccggccagccgccc 41354 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 41472 ccccccgcccggccagccgccctg 41449
>emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chromosome 10 Contains the gene for a novel protein (MGC14258), a CD164 antigen, sialomucin (CD164) pseudogene and two CpG islands, complete sequence Length = 99408 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 76127 ccccctgcccggccagccgccc 76148 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 75848 ccccccgcccggccagccgccctg 75871 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 75627 ccccccgcccggccagccgccctg 75650
>emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chromosome 6 Contains the CDYL gene for a Y chromosome-like chromodomain protein, a ribosomal protein S18 (RPS18) pseudogene, the gene for ribonuclease P 40kD subunit (RPP40) and CpG islands, complete sequence Length = 166863 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 143806 ccccctgcccggccagccgccc 143785
>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the 5' end of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, the 5' end of the PBX3 gene for pre-B-cell leukemia transcription factor 3 and three CpG islands, complete sequence Length = 109081 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 98477 ccccctgcccggccagccgccc 98456 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 99187 ccccccgcccggccagccgccctg 99164
>emb|AL357125.22| Human DNA sequence from clone RP11-293D12 on chromosome 10 Contains part of the EGR2 gene for early growth response 2 (Krox-20 homolog, Drosophila), complete sequence Length = 116948 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 84050 ccccctgcccggccagccgccc 84071
>emb|AL358072.21| Human DNA sequence from clone RP11-188D8 on chromosome 1 Contains the 5' end of the MAN1A2 gene for mannosidase alpha class 1A member 2 and two CpG islands, complete sequence Length = 129725 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 70698 ccccctgcccggccagccgccc 70677
>emb|AL356970.21| Human DNA sequence from clone RP11-465E14 on chromosome 6, complete sequence Length = 53086 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 19347 ccccctgcccggccagccgccc 19326
>emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chromosome 6 Contains a novel gene and a CpG island, complete sequence Length = 140630 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 33666 ccccctgcccggccagccgccc 33645
>emb|AL357055.18| Human DNA sequence from clone RP11-389O22 on chromosome 1 Contains the 3' end of a novel gene, the 5' end of a novel gene, the LRIG2 gene for leucine-rich repeats and immunoglobulin-like domains 2, a ring finger protein 12 (RNF12) pseudogene, a ribosomal protein S19 (RPS19) pseudogene, a ribosomal protein S15 (RPS15) pseudogene and a CpG island, complete sequence Length = 188812 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42914 ccccctgcccggccagccgccc 42935 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 42724 ccccctgcccggccagccgccc 42745
>gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, complete sequence Length = 161803 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 127962 ccccctgcccggccagccgccc 127983 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 127238 ccccccgcccggccagccgccctg 127261
>gb|AC116533.11| Homo sapiens chromosome 11, clone RP11-466H18, complete sequence Length = 189143 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 105590 ccccctgcccggccagccgccc 105611 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 105461 ccccctgcccggccagccgccc 105482
>emb|AL355855.23| Human DNA sequence from clone RP11-302L10 on chromosome 6 Contains the 5' end of the NUDT3 gene for nudix (nucleoside diphosphate linked moiety X)-type motif 3 and CpG islands, complete sequence Length = 29442 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12964 ccccctgcccggccagccgccc 12985 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12913 ccccctgcccggccagccgccc 12934 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 12737 ccccccgcccggccagccgccctg 12760
>emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on chromosome 1 Contains the 5' end of the gene for GPP34-related protein (GPP34R), the gene for a novel protein (DKFZp434A1315), the CTSS gene for cathepsin S, a pseudogene similar to part of short coiled-coil protein (SCOC) and the 3' end of the CTSK gene for cathepsin K (pycnodysostosis), complete sequence Length = 154068 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 134576 ccccctgcccggccagccgccc 134597 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 81742 ccccccgcccggccagccgccctg 81719
>emb|AL356652.19| Human DNA sequence from clone RP11-42O4 on chromosome 20 Contains part of the gene for a novel glycosyl hydrolase family 47 protein and the PROCR gene for endothelial protein C receptor (EPCR), complete sequence Length = 50217 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 14272 ccccctgcccggccagccgccc 14293
>emb|AL355861.19| Human DNA sequence from clone RP11-567J24 on chromosome 10 Contains the 5' end of a novel gene, the PRDX3 gene for peroxiredoxin 3 (AOP1, MER5, AOP-1, SP-22), the 5' end of the GPRK5 gene for G protein-coupled receptor kinase 5 (GRK5), a novel gene and four CpG islands, complete sequence Length = 168528 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 101963 ccccctgcccggccagccgccc 101942
>emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chromosome 13 Contains the KATNAL1 gene for katanin p60 subunit A-like 1, a peroxiredoxin 2 (PRDX2) pseudogene, two novel genes and two CpG islands, complete sequence Length = 182303 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 71430 ccccctgcccggccagccgccc 71451
>emb|AL355535.14| Human DNA sequence from clone RP11-494N1 on chromosome 9 Contains the 5' end of the GNA14 gene for guanine nucleotide binding protein (G protein) alpha 14, the 3' end of the GNAQ gene for guanine nucleotide binding protein (G protein) q polypeptide and two CpG islands, complete sequence Length = 186658 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 176476 ccccctgcccggccagccgccc 176497
>emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chromosome 6 Contains the 3' part of a novel gene, three novel genes, the gene for RNA polymerase I 40 kDa subunit (RPA40) (RPA39), the gene for exportin 5 (KIAA1291) (XPO5), a 40S ribosomal protein S2 (RPS2) pseudogene, the 5' part of the POLH gene for DNA directed polymerase eta and four CpG islands, complete sequence Length = 105935 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 93421 ccccctgcccggccagccgccc 93400
>emb|AL354989.13| Human DNA sequence from clone RP11-537H15 on chromosome 9 Contains the 5' end of a novel gene (KIAA1491, FLJ22435 FLJ21704, FLJ22148), two novel genes (including DKFZP434O125 (KIAA1892, FLJ20347)), a tubulin beta pseudogene, an IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene and four CpG islands, complete sequence Length = 151990 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 150023 ccccctgcccggccagccgccc 150044
>emb|AL355305.9| Human DNA sequence from clone RP11-487F23 on chromosome 6 Contains the 5' end of the gene for p53 regulated PA26 nuclear protein (PA26-T1), a novel gene and part of a novel gene, complete sequence Length = 185257 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 11307 ccccctgcccggccagccgccc 11328 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 11180 ccccctgcccggccagccgccc 11201 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 10829 ccccctgcccggccagccgccc 10850
>emb|AL354808.24| Human DNA sequence from clone RP11-523H24 on chromosome 13 Contains the 3' end of a novel gene, the gene for paraspeckle protein 1 (PSP1) (FLJ10955), two novel genes, a sialyltransferase 7D (SIAT7D) pseudogene, the 3' end of a variant of the ZNF237 gene for zinc finger protein 237 and two CpG islands, complete sequence Length = 169303 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 114924 ccccctgcccggccagccgccc 114945
>emb|AL354707.17| Human DNA sequence from clone RP11-390F4 on chromosome 9 Contains the 5' end of a ring finger protein 2 (RNF2) pseudogene, the 3' end of a novel gene, a 60S ribosomal protein L35a (RPL35A) pseudogene, three novel genes, a gene similar to small nuclear ribonucleoprotein polypeptide E (SNRPE), the 5' end of the JMJD2C gene for jumonji domain containing 2C, a chromosome 20 open reading frame 45 (C20orf45) pseudogene and six CpG islands, complete sequence Length = 170970 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 140313 ccccctgcccggccagccgccc 140334
>emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chromosome 6 Contains part of the DNAH8 gene for dynein axonemal heavy polypeptide 8 and the 5' part of a novel gene, complete sequence Length = 56509 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 17900 ccccctgcccggccagccgccc 17879
>emb|AL162498.12| Human DNA sequence from clone RP11-315A9 on chromosome 13 Contains a CpG island, complete sequence Length = 24565 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 1811 ccccctgcccggccagccgccc 1790
>emb|AL354798.13| Human DNA sequence from clone RP11-756A22 on chromosome 13 Contains the 3' end of a novel gene, the CENJP gene for centromere protein J (LAP, CPAP, LIP1, BM032), 2 novel genes, a pseudogene similar to part of solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15), a TPTE and PTEN homologous inositol lipid phosphatase (TPIP) pseudogene, a 60S ribisomal protein L34 (RPL34) pseudogene and 2 CpG islands, complete sequence Length = 167319 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 132062 ccccctgcccggccagccgccc 132041
>emb|AL162584.9| Human DNA sequence from clone RP11-12A16 on chromosome 9 Contains part of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, a heterogeneous nuclear ribonucleoprotein A1 (HNRP1) pseudogene and two CpG islands, complete sequence Length = 160178 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 101220 ccccctgcccggccagccgccc 101241 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 100763 ccccccgcccggccagccgccctg 100786
>emb|AL161652.25| Human DNA sequence from clone RP11-543N17 on chromosome 10 Contains the 3' end of a novel gene (FLJ20445) and a MAP/microtubule affinity-regulating kinase 2 (MARK2) pseudogene, complete sequence Length = 156949 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 82254 ccccctgcccggccagccgccc 82275 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 81639 ccccctgcccggccagccgccc 81660 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 81279 ccccctgcccggccagccgccc 81300 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccc 105 ||||||||||||||||||||| Sbjct: 82044 cccctgcccggccagccgccc 82064 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 80953 ccccccgcccggccagccgccctg 80976
>emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chromosome 10 Contains a novel gene and a pseudogene similar to part of FLJ10581, complete sequence Length = 132327 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 92312 ccccctgcccggccagccgccc 92333
>emb|AL160260.22| Human DNA sequence from clone RP11-519H8 on chromosome 6 Contains a CpG island, complete sequence Length = 75778 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12814 ccccctgcccggccagccgccc 12793 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 12493 ccccctgcccggccagccgccc 12472
>emb|AL162389.21| Human DNA sequence from clone RP11-380I20 on chromosome 9 Contains a small EDRK-rich factor 2 (SERF2) pseudogene, a ribosomal protein L36a pseudogene 6 (RPL36AP6) and two CpG islands, complete sequence Length = 157017 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 64288 ccccctgcccggccagccgccc 64309 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 64110 ccccctgcccggccagccgccc 64131 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 63932 ccccctgcccggccagccgccc 63953 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 63881 ccccctgcccggccagccgccc 63902 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 63703 ccccctgcccggccagccgccc 63724
>emb|AL161656.20| Human DNA sequence from clone RP11-12M19 on chromosome 20 Contains the C20orf81 gene, the VSP16 gene for vacuolar protein sorting 16 (yeast), the 5' end of the PTPRA gene for protein tyrosine phosphatase receptor type A and four CpG islands, complete sequence Length = 103370 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 5165 ccccctgcccggccagccgccc 5186 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 5648 ctgcccggccagccgccctg 5667
>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the PPIP11 gene for peptidylprolyl isomerase (cyclophilin) pseudogene 11 and a CpG island, complete sequence Length = 81304 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 66757 ccccctgcccggccagccgccc 66736
>emb|AL160157.17| Human DNA sequence from clone RP11-547C18 on chromosome 13 Contains the 5' end of the GUCY1B2 gene for guanylate cyclase 1 soluble beta 2 and part of a novel gene, complete sequence Length = 127227 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 78470 ccccctgcccggccagccgccc 78491
>emb|AL161802.15| Human DNA sequence from clone RP11-96L6 on chromosome 20 Contains the 5' part of the KIAA0980 gene ESTs, STSs, GSSs and two CpG islands, complete sequence Length = 57115 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 25609 ccccctgcccggccagccgccc 25630
>emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chromosome 13 Contains the 3' end of the KLF12 gene for Kruppel-like factor 12, a novel gene and the 5' end of a novel gene and a CpG island, complete sequence Length = 181324 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 48111 ccccctgcccggccagccgccc 48132 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 48011 ccccctgcccggccagccgccc 48032 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 48060 ccccccgcccggccagccgccctg 48083
>emb|AL161716.14| Human DNA sequence from clone RP11-266E6 on chromosome 13 Contains the 3' end of a novel gene, a guanidinoacetate N-methyltransferase (GAMT) pseudogene and a CpG island, complete sequence Length = 164345 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 18481 ccccctgcccggccagccgccc 18502
>emb|AL162416.13| Human DNA sequence from clone RP11-296H15 on chromosome 9 Contains the 3' end of the TMC1 gene for transmembrane cochlear-expressed 1 and three CpG islands, complete sequence Length = 75609 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 45181 ccccctgcccggccagccgccc 45160 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 10926 ccccctgcccggccagccgccc 10905 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 55756 ccccccgcccggccagccgccctg 55733 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 45537 ccccccgcccggccagccgccctg 45514
>emb|AL158014.20| Human DNA sequence from clone RP11-88I10 on chromosome 10q25.2-26.2 Contains the 5' end of a novel gene, the 5' end of the SAC2 gene for Sac domain-containing inositol phosphatase 2 and three CpG islands, complete sequence Length = 114244 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 38491 ccccctgcccggccagccgccc 38512 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Plus Query: 85 cccctgcccggccagccgccc 105 ||||||||||||||||||||| Sbjct: 38443 cccctgcccggccagccgccc 38463
>emb|AL158206.8| Human DNA sequence from clone RP11-363E7 on chromosome 9 Contains the 3' end of a novel gene, possible ortholog of mouse cancer related gene-liver 1 (CRG-L1), a tmicortubule-associated protein pseudogene, the 3' end of the SLC24A2 gene for solute carrier family 24 (sodium/potassium/calcium exchanger) member 2 (NCKX2) and 2 CpG islands, complete sequence Length = 163542 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 830 ccccctgcccggccagccgccc 809
>emb|AL139811.30| Human DNA sequence from clone RP11-75A9 on chromosome Xp11.23-11.4 Contains a catenin, beta like 1 (NAP, P14L, C20orf33, FLJ21108, NYD-SP19) (CTNNBL1) pseudogene, a glyceraldehyde-3-phosphate dehydrogenase (G3PD, GAPDH) (GAPD) pseudogene, a transmembrane protein vezatin pseudogene, a novel gene (FLJ20344) and two CpG islands, complete sequence Length = 141469 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 57033 ccccctgcccggccagccgccc 57012 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 56632 ccccctgcccggccagccgccc 56611
>gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, complete sequence Length = 63480 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 28678 ccccctgcccggccagccgccc 28657
>gb|AC099558.2| Homo sapiens chromosome 3 clone RP11-680P23, complete sequence Length = 180049 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 107142 ccccctgcccggccagccgccc 107163 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 106913 ccccccgcccggccagccgccctg 106936
>emb|AL139326.15| Human DNA sequence from clone RP11-351K3 on chromosome 13 Contains the 3' end of the COG3 gene for component of oligomeric golgi complex 3, a novel gene (FLJ32682),a translocase of inner mitochondrial membrane 9 homolog (yeast) (TIMM9) pseudogene and a CpG island, complete sequence Length = 175588 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 17986 ccccctgcccggccagccgccc 17965
>emb|AL138921.14| Human DNA sequence from clone RP11-316M21 on chromosome 10 Contains the 3' end of gene FLJ30135, the CHUK gene for conserved helix-loop ubiquitous kinase, a novel gene (FLJ32012), a novel gene containing FLJ10998, FLJ40576, FLJ3922, FLJ30751, a prohibitin (PHB) pseudogene, a tropomyosin (TPM4) pseudogene and three CpG islands, complete sequence Length = 194916 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7859 ccccctgcccggccagccgccc 7880 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7680 ccccctgcccggccagccgccc 7701 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 7655 ccccctgcccggccagccgccc 7676 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 192077 ctgcccggccagccgccctg 192096
>emb|AL157777.5| Human DNA sequence from clone RP11-76H14 on chromosome 6 Contains the HTR1E gene for 5-hydroxytryptamine (serotonin) receptor, a pseudogene similar to the 5' end of ST13 (suppression of tumorigenicity 13, a Hsp70-interacting protein), a pseudogene similar to the 5' end of a Tec protein-tyrosine kinase, a pseudogene similar to 60S ribosomal protein L7,a pseudogene similar to the bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase mitochondria and two CpG islands, complete sequence Length = 169669 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 140335 ccccctgcccggccagccgccc 140314 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 140290 ctgcccggccagccgccctg 140271
>emb|AL138744.41| Human DNA sequence from clone RP13-257M1 on chromosome Xp11.23-11.4 Contains part of the UTX gene for ubiquitously transcribed tetratricopeptide repeat gene X chromosome and a CpG island, complete sequence Length = 143968 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 98809 ccccctgcccggccagccgccc 98788
>emb|AL135907.21| Human DNA sequence from clone RP1-257C19 on chromosome 6 Contains the 3' end of the gene for hypothetical protein FLJ14917 (contains FLJ13594), complete sequence Length = 45627 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 27727 ccccctgcccggccagccgccc 27748
>emb|AL137852.15| Human DNA sequence from clone RP11-131A5 on chromosome 9q32-34.11 Contains the RAD23B gene for RA23B homolog B (S. cerevisiae) and three CpG islands, complete sequence Length = 162509 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 18091 ccccctgcccggccagccgccc 18070 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 ctgcccggccagccgccctg 107 |||||||||||||||||||| Sbjct: 33215 ctgcccggccagccgccctg 33234 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 18369 ccccccgcccggccagccgccctg 18346
>gb|AC087442.13| Homo sapiens chromosome 11, clone RP11-495O11, complete sequence Length = 200269 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 163318 ccccctgcccggccagccgccc 163297
>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the 3' end of the TACC2 gene for transforming, acidic coiled-coil containing protein 2 (AZU-1), the gene for a novel protein (FLJ25359) and two CpG islands, complete sequence Length = 213861 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 45411 ccccctgcccggccagccgccc 45390
>emb|AL135787.13| Human DNA sequence from clone RP11-16L21 on chromosome 9 Contains the 3' end of a variant of the gene for KIAA1962 protein similar to zinc finger protein HIT-10, the LTB4DH gene for leukotriene B4 12-hydroxydehydrogenase (MGC34943), the gene for KIAA0563-related gene (LOC286331), the GNG10 gene for guanine nucleotide binding protein (G protein), gamma 10, a novel gene, the 3' end of a novel gene and six CpG islands, complete sequence Length = 161448 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 84861 ccccctgcccggccagccgccc 84882 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 84228 ccccccgcccggccagccgccctg 84251
>emb|AL138728.12| Human DNA sequence from clone RP1-153N22 on chromosome 6q21-22.1 Contains a CpG island, complete sequence Length = 26999 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 9772 ccccctgcccggccagccgccc 9751
>gb|AC011401.9| Homo sapiens chromosome 5 clone CTB-35K5, complete sequence Length = 199275 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 135630 ccccctgcccggccagccgccc 135651 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 ccccctgcccggccagccgccctg 107 ||||| |||||||||||||||||| Sbjct: 135405 ccccccgcccggccagccgccctg 135428
>gb|AC048348.25| Homo sapiens 3 BAC RP11-457E6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 100869 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 51535 ccccctgcccggccagccgccc 51514
>emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chromosome 1q25.1-31.1 Contains the 3' end of the RGSL1 gene for regulator of G-protein signalling like 1, the RNASEL gene for ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) and a CpG island, complete sequence Length = 100549 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 84 ccccctgcccggccagccgccc 105 |||||||||||||||||||||| Sbjct: 15900 ccccctgcccggccagccgccc 15879 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,357,941 Number of Sequences: 3902068 Number of extensions: 2357941 Number of successful extensions: 59913 Number of sequences better than 10.0: 897 Number of HSP's better than 10.0 without gapping: 897 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 50207 Number of HSP's gapped (non-prelim): 9706 length of query: 271 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 249 effective length of database: 17,147,199,772 effective search space: 4269652743228 effective search space used: 4269652743228 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)