ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl31h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ966349.1| Hordeum vulgare subsp. vulgare mRNA for lipoxyge... 482 e-133
2gb|AC163741.3| Pan troglodytes BAC clone CH251-406E22 from chrom... 48 0.014
3ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfami... 48 0.014
4gb|AC186184.1| Pan troglodytes chromosome UNKNOWN clone CH251-13... 48 0.014
5gb|AC183617.3| Pan troglodytes BAC clone CH251-104G17 from chrom... 48 0.014
6gb|AC183799.2| Pan troglodytes BAC clone CH251-329J7 from chromo... 48 0.014
7gb|AC183830.2| Pan troglodytes BAC clone CH251-267I9 from chromo... 48 0.014
8ref|XM_989388.1| PREDICTED: Mus musculus hypothetical protein LO... 48 0.014
9gb|AC146199.2| Pan troglodytes BAC clone RP43-25F11 from 7, comp... 48 0.014
10gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, comp... 48 0.014
11gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, com... 48 0.014
12gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, com... 48 0.014
13gb|AC146166.2| Pan troglodytes BAC clone RP43-1B23 from 7, compl... 48 0.014
14gb|AC144512.1| Pan troglodytes BAC clone RP43-51G12 from 7, comp... 48 0.014
15gb|AC103849.3| Homo sapiens chromosome 8, clone RP11-75H14, comp... 48 0.014
16emb|AL929472.21| Human DNA sequence from clone RP11-109P14 on ch... 48 0.014
17emb|Z75889.1|HS267P19 Human DNA sequence from clone RP1-267P19 o... 48 0.014
18emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chr... 48 0.014
19emb|AL590710.14| Human DNA sequence from clone RP11-153P4 on chr... 48 0.014
20emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chro... 48 0.014
21emb|AL365505.15| Human DNA sequence from clone RP11-382A12 on ch... 48 0.014
22emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on ch... 48 0.014
23emb|AL354806.22| Human DNA sequence from clone RP11-521J24 on ch... 48 0.014
24gb|AC183592.2| Pan troglodytes BAC clone CH251-733I16 from chrom... 48 0.014
25emb|AL161644.6| Human DNA sequence from clone RP5-997D24 on chro... 48 0.014
26emb|AL024507.7|HS191J18 Human DNA sequence from clone RP1-191J18... 48 0.014
27emb|AL034374.2|HS483K16 Human DNA sequence from clone RP3-483K16... 48 0.014
28gb|AC107952.5| Homo sapiens chromosome 8, clone RP11-140I16, com... 48 0.014
29gb|AC183687.3| Pan troglodytes BAC clone CH251-25N14 from chromo... 48 0.014
30gb|AC182637.3| Pan troglodytes BAC clone CH251-431A15 from chrom... 48 0.014
31gb|AC148926.4| Pan troglodytes BAC clone RP43-136P16 from chromo... 48 0.014
32gb|AC163739.2| Pan troglodytes BAC clone CH251-503F22 from chrom... 48 0.014
33gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, comp... 48 0.014
34gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, comple... 48 0.014
35gb|AC027088.8| Homo sapiens chromosome 15, clone RP11-809H16, co... 48 0.014
36gb|AC157480.3| Pan troglodytes BAC clone CH251-394P5 from chromo... 48 0.014
37gb|AC010355.7| Homo sapiens chromosome 5 clone CTD-2027K22, comp... 48 0.014
38gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, compl... 48 0.014
39gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome... 48 0.014
40gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F... 48 0.014
41gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, comp... 48 0.014
42gb|AC147282.3| Pan troglodytes BAC clone RP43-86L11 from chromos... 48 0.014
43gb|AC145873.3| Pan troglodytes BAC clone RP43-20K16 from chromos... 48 0.014
44gb|AC112510.9| Homo sapiens 3 BAC RP11-432A8 (Roswell Park Cance... 48 0.014
45gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195... 48 0.014
46gb|AC020550.4| Homo sapiens BAC clone RP11-198M19 from 2, comple... 48 0.014
47gb|AC159904.2| Pan troglodytes BAC clone CH251-488L1 from chromo... 48 0.014
48gb|AC145857.3| Pan troglodytes BAC clone RP43-6D4 from chromosom... 48 0.014
49gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete... 48 0.014
50gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence 48 0.014
51gb|AC010636.6|AC010636 Homo sapiens chromosome 19 clone CTD-2332... 48 0.014
52dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 48 0.014
53dbj|AP000842.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 48 0.014
54gb|AC006344.2|AC006344 Homo sapiens PAC clone RP4-726N20 from 7q... 48 0.014
55emb|CT009602.4| PTB-121B21, complete sequence 48 0.014
56emb|AL121790.4|CNS01DSI Human chromosome 14 DNA sequence BAC R-3... 48 0.014
57gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone... 48 0.014
58gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.26... 48 0.014
59gb|AC159020.2| Pan troglodytes BAC clone CH251-530A5 from chromo... 48 0.014
60gb|DQ314884.1| Homo sapiens NADPH oxidase, EF-hand calcium bindi... 48 0.014
61emb|AL353724.11| Human DNA sequence from clone RP11-448I13 on ch... 48 0.014
62gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, comple... 48 0.014
63gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, comp... 46 0.057
64gb|AC004885.2| Homo sapiens PAC clone RP4-781A18 from 7, complet... 46 0.057
65emb|AL512422.19| Human DNA sequence from clone RP11-472M19 on ch... 46 0.057
66emb|AL359512.15| Human DNA sequence from clone RP11-163B6 on chr... 46 0.057
67emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chr... 46 0.057
68emb|AL021918.1|HS34I8 Human DNA sequence from clone XXbac-34I8 o... 46 0.057
69gb|AC108743.6| Homo sapiens 3 BAC RP11-206J21 (Roswell Park Canc... 46 0.057
70gb|AC098484.2| Homo sapiens chromosome 1 clone RP5-994D16, compl... 46 0.057
71gb|AC021317.19| Homo sapiens chromosome 17, clone RP11-678G7, co... 46 0.057
72gb|AC020978.10| Homo sapiens chromosome 16 clone RP11-96D1, comp... 46 0.057
73gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, com... 46 0.057
74gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 46 0.057
75gb|AC115992.13| Homo sapiens chromosome 17, clone CTD-2022O14, c... 46 0.057
76gb|AC004073.1|AC004073 Human Chromosome X, complete sequence 46 0.057
77emb|AL133304.4|CNS01DUL Human chromosome 14 DNA sequence BAC R-1... 46 0.057
78gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 ... 44 0.23
79gb|L29074.1|HUMFMR1S Homo sapiens fragile X mental retardation s... 44 0.23
80gb|AC146398.4| Pan troglodytes BAC clone RP43-54K1 from 7, compl... 44 0.23
81gb|AC108879.3| Homo sapiens chromosome X clone RP11-265P11 map p... 44 0.23
82gb|AC145687.4| Pan troglodytes BAC clone CH251-281C1 from X, com... 44 0.23
83gb|AC142169.2| Homo sapiens fosmid clone XXFOS-81770D1 from 7, c... 44 0.23
84gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, comp... 44 0.23
85gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chrom... 44 0.23
86gb|AC009712.22| Homo sapiens chromosome 15, clone RP11-361M10, c... 44 0.23
87gb|AC149044.1| Pan troglodytes chromosome X clone PTB-089E19 map... 44 0.23
88gb|AC133330.3| Homo sapiens chromosome 8 clone RP11-134N2, compl... 44 0.23
89gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
90gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
91gb|AY663409.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
92gb|AY663407.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
93gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
94gb|AY663399.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
95gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA ... 44 0.23
96gb|AC069503.25| Homo sapiens 12 BAC RP11-87C12 (Roswell Park Can... 44 0.23
97gb|AC002065.2| Homo sapiens BAC clone CTB-21N8 from 7, complete ... 44 0.23
98gb|AC103703.5| Homo sapiens chromosome 17, clone RP11-764D10, co... 44 0.23
99gb|AC152064.3| Pan troglodytes BAC clone RP43-134I6 from chromos... 44 0.23
100gb|AY500996.1| Homo sapiens angiogenic factor VG5Q gene, complet... 44 0.23
101gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, comple... 44 0.23
102gb|AC073324.6| Homo sapiens BAC clone RP11-339F13 from 7, comple... 44 0.23
103gb|AC005192.1| Homo sapiens BAC clone CTB-163K11 from 7, complet... 44 0.23
104gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complet... 44 0.23
105gb|AY526322.1| Homo sapiens dopa decarboxylase (aromatic L-amino... 44 0.23
106gb|AC004008.2| Homo sapiens PAC clone RP5-899B21 from 7, complet... 44 0.23
107gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete... 44 0.23
108gb|AC018705.10| Homo sapiens BAC clone RP11-95E2 from 7, complet... 44 0.23
109gb|AC004079.1| Homo sapiens PAC clone RP1-167F23 from 7, complet... 44 0.23
110gb|AC146211.3| Pan troglodytes BAC clone RP43-33E10 from 7, comp... 44 0.23
111gb|AY203949.1| Homo sapiens LP3428 mRNA, complete cds 44 0.23
112gb|AC146176.2| Pan troglodytes BAC clone RP43-24N3 from 7, compl... 44 0.23
113emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chr... 44 0.23
114gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, com... 44 0.23
115gb|AC090001.19| Homo sapiens 12 BAC RP11-536G4 (Roswell Park Can... 44 0.23
116gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Can... 44 0.23
117gb|AC090107.16| Homo sapiens 12 BAC RP11-643D8 (Roswell Park Can... 44 0.23
118gb|AC091170.15| Homo sapiens chromosome 18, clone RP11-879D5, co... 44 0.23
119gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, com... 44 0.23
120gb|AC114801.4| Homo sapiens BAC clone RP11-777B9 from 4, complet... 44 0.23
121gb|AC004912.2| Homo sapiens PAC clone RP5-871B15 from 7, complet... 44 0.23
122gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete... 44 0.23
123gb|AC006451.5| Homo sapiens PAC clone RP4-562A11 from 7, complet... 44 0.23
124gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, comple... 44 0.23
125gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, comple... 44 0.23
126gb|AC093087.3| Homo sapiens BAC clone RP11-785H2 from 7, complet... 44 0.23
127gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complet... 44 0.23
128gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 44 0.23
129gb|AC144511.1| Pan troglodytes BAC clone RP43-45C15 from 7, comp... 44 0.23
130gb|AY388614.1| Homo sapiens polymerase (DNA directed), eta (POLH... 44 0.23
131gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gen... 44 0.23
132gb|AC114934.2| Homo sapiens chromosome 5 clone CTD-2029K19, comp... 44 0.23
133gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, comple... 44 0.23
134gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, comp... 44 0.23
135gb|DQ070893.1| Homo sapiens AGR2 (AGR2) gene, complete cds, alte... 44 0.23
136emb|AL731683.12| Human DNA sequence from clone XXbac-254C11 on c... 44 0.23
137emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chro... 44 0.23
138gb|AC018988.12| Homo sapiens chromosome 15, clone RP11-233C13, c... 44 0.23
139emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 ... 44 0.23
140emb|AL929470.20| Human DNA sequence from clone RP11-72M14 on chr... 44 0.23
141emb|AL732431.19| Human DNA sequence from clone XXyac-36GH4 on ch... 44 0.23
142emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on ch... 44 0.23
143emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221... 44 0.23
144emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on ... 44 0.23
145emb|Z84489.1|HS93N13 Human DNA sequence from clone RP1-93N13 on ... 44 0.23
146emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chrom... 44 0.23
147emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on ch... 44 0.23
148emb|BX004807.10| Human DNA sequence from clone RP11-565D17 on ch... 44 0.23
149emb|AL935026.4| Human DNA sequence from clone DAQB-109B10 on chr... 44 0.23
150emb|AL662924.24| Human DNA sequence from clone RP11-108J9 on chr... 44 0.23
151emb|AL662789.11| Human DNA sequence from clone XXbac-254F23 on c... 44 0.23
152emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on ch... 44 0.23
153emb|AL672220.6| Human DNA sequence from clone RP11-17C2 on chrom... 44 0.23
154emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on ch... 44 0.23
155emb|AL603890.14| Human DNA sequence from clone RP11-584P2 on chr... 44 0.23
156emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chr... 44 0.23
157emb|AL606491.19| Human DNA sequence from clone RP11-70P17 on chr... 44 0.23
158emb|AL606477.11| Human DNA sequence from clone RP11-190H11 on ch... 44 0.23
159emb|AL592046.7| Human DNA sequence from clone RP11-155O24 on chr... 44 0.23
160emb|AL590640.19| Human DNA sequence from clone RP11-40H20 on chr... 44 0.23
161emb|AL591043.11| Human DNA sequence from clone RP11-357J22 on ch... 44 0.23
162emb|AL589843.9| Human DNA sequence from clone RP11-535M15 on chr... 44 0.23
163emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on ch... 44 0.23
164emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on ch... 44 0.23
165emb|AL513044.13| Human DNA sequence from clone RP11-187D4 on chr... 44 0.23
166emb|AL513314.12| Human DNA sequence from clone RP11-358H9 on chr... 44 0.23
167emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chr... 44 0.23
168emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chro... 44 0.23
169emb|AL450309.14| Human DNA sequence from clone RP11-478H16 on ch... 44 0.23
170emb|AL445205.14| Human DNA sequence from clone RP11-24J23 on chr... 44 0.23
171emb|AL442646.14| Human DNA sequence from clone RP11-322A17 on ch... 44 0.23
172emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chr... 44 0.23
173emb|AL445427.23| Human DNA sequence from clone RP5-1091A7 on chr... 44 0.23
174emb|AL391809.21| Human DNA sequence from clone RP11-47A4 on chro... 44 0.23
175emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chr... 44 0.23
176emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on ch... 44 0.23
177emb|AL392104.19| Human DNA sequence from clone RP11-324E23 on ch... 44 0.23
178emb|AL392107.17| Human DNA sequence from clone RP11-114F7 on chr... 44 0.23
179emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on ch... 44 0.23
180emb|AL442123.12| Human DNA sequence from clone RP11-175O19 on ch... 44 0.23
181emb|AL392088.12| Human DNA sequence from clone RP5-964H19 on chr... 44 0.23
182emb|AL445587.10| Human DNA sequence from clone RP11-429D3 on chr... 44 0.23
183emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on ch... 44 0.23
184emb|AL445465.10| Human DNA sequence from clone RP11-415D17 on ch... 44 0.23
185emb|AL392103.6| Human DNA sequence from clone RP11-477L16 on chr... 44 0.23
186emb|AL365179.30| Human DNA sequence from clone RP13-34C21 on chr... 44 0.23
187emb|AL365182.27| Human DNA sequence from clone RP11-560O15 on ch... 44 0.23
188emb|AL390729.23| Human DNA sequence from clone RP3-522D1 on chro... 44 0.23
189emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chr... 44 0.23
190emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on ch... 44 0.23
191emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on ch... 44 0.23
192emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on ch... 44 0.23
193emb|AL365190.16| Human DNA sequence from clone RP11-512H14 on ch... 44 0.23
194emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chr... 44 0.23
195emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on ch... 44 0.23
196emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on ch... 44 0.23
197emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chr... 44 0.23
198emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chr... 44 0.23
199emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on ch... 44 0.23
200emb|AL357125.22| Human DNA sequence from clone RP11-293D12 on ch... 44 0.23
201emb|AL358072.21| Human DNA sequence from clone RP11-188D8 on chr... 44 0.23
202emb|AL356970.21| Human DNA sequence from clone RP11-465E14 on ch... 44 0.23
203emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chr... 44 0.23
204emb|AL357055.18| Human DNA sequence from clone RP11-389O22 on ch... 44 0.23
205gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, com... 44 0.23
206gb|AC116533.11| Homo sapiens chromosome 11, clone RP11-466H18, c... 44 0.23
207emb|AL355855.23| Human DNA sequence from clone RP11-302L10 on ch... 44 0.23
208emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on ch... 44 0.23
209emb|AL356652.19| Human DNA sequence from clone RP11-42O4 on chro... 44 0.23
210emb|AL355861.19| Human DNA sequence from clone RP11-567J24 on ch... 44 0.23
211emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chr... 44 0.23
212emb|AL355535.14| Human DNA sequence from clone RP11-494N1 on chr... 44 0.23
213emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chro... 44 0.23
214emb|AL354989.13| Human DNA sequence from clone RP11-537H15 on ch... 44 0.23
215emb|AL355305.9| Human DNA sequence from clone RP11-487F23 on chr... 44 0.23
216emb|AL354808.24| Human DNA sequence from clone RP11-523H24 on ch... 44 0.23
217emb|AL354707.17| Human DNA sequence from clone RP11-390F4 on chr... 44 0.23
218emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chr... 44 0.23
219emb|AL162498.12| Human DNA sequence from clone RP11-315A9 on chr... 44 0.23
220emb|AL354798.13| Human DNA sequence from clone RP11-756A22 on ch... 44 0.23
221emb|AL162584.9| Human DNA sequence from clone RP11-12A16 on chro... 44 0.23
222emb|AL161652.25| Human DNA sequence from clone RP11-543N17 on ch... 44 0.23
223emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chr... 44 0.23
224emb|AL160260.22| Human DNA sequence from clone RP11-519H8 on chr... 44 0.23
225emb|AL162389.21| Human DNA sequence from clone RP11-380I20 on ch... 44 0.23
226emb|AL161656.20| Human DNA sequence from clone RP11-12M19 on chr... 44 0.23
227emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on ch... 44 0.23
228emb|AL160157.17| Human DNA sequence from clone RP11-547C18 on ch... 44 0.23
229emb|AL161802.15| Human DNA sequence from clone RP11-96L6 on chro... 44 0.23
230emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chr... 44 0.23
231emb|AL161716.14| Human DNA sequence from clone RP11-266E6 on chr... 44 0.23
232emb|AL162416.13| Human DNA sequence from clone RP11-296H15 on ch... 44 0.23
233emb|AL158014.20| Human DNA sequence from clone RP11-88I10 on chr... 44 0.23
234emb|AL158206.8| Human DNA sequence from clone RP11-363E7 on chro... 44 0.23
235emb|AL139811.30| Human DNA sequence from clone RP11-75A9 on chro... 44 0.23
236gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, c... 44 0.23
237gb|AC099558.2| Homo sapiens chromosome 3 clone RP11-680P23, comp... 44 0.23
238emb|AL139326.15| Human DNA sequence from clone RP11-351K3 on chr... 44 0.23
239emb|AL138921.14| Human DNA sequence from clone RP11-316M21 on ch... 44 0.23
240emb|AL157777.5| Human DNA sequence from clone RP11-76H14 on chro... 44 0.23
241emb|AL138744.41| Human DNA sequence from clone RP13-257M1 on chr... 44 0.23
242emb|AL135907.21| Human DNA sequence from clone RP1-257C19 on chr... 44 0.23
243emb|AL137852.15| Human DNA sequence from clone RP11-131A5 on chr... 44 0.23
244gb|AC087442.13| Homo sapiens chromosome 11, clone RP11-495O11, c... 44 0.23
245emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chr... 44 0.23
246emb|AL135787.13| Human DNA sequence from clone RP11-16L21 on chr... 44 0.23
247emb|AL138728.12| Human DNA sequence from clone RP1-153N22 on chr... 44 0.23
248gb|AC011401.9| Homo sapiens chromosome 5 clone CTB-35K5, complet... 44 0.23
249gb|AC048348.25| Homo sapiens 3 BAC RP11-457E6 (Roswell Park Canc... 44 0.23
250emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chro... 44 0.23
251gb|AC126365.5| Homo sapiens chromosome 17, clone RP11-283C24, co... 44 0.23
252emb|AL118499.39|HS1168M15 Human DNA sequence from clone RP5-1168... 44 0.23
253emb|AL121890.34|HS1116H23 Human DNA sequence from clone RP5-1116... 44 0.23
254emb|AL121602.34|HSDJ636H5 Human DNA sequence from clone RP4-636H... 44 0.23
255emb|AL133347.28| Human DNA sequence from clone RP1-274L14 on chr... 44 0.23
256emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C... 44 0.23
257emb|AL121905.23|HSDJ534B8 Human DNA sequence from clone RP4-534B... 44 0.23
258emb|AL121972.17|HSJ397H23 Human DNA sequence from clone RP3-397H... 44 0.23
259emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416... 44 0.23
260emb|AL121751.12|HS1093G12 Human DNA sequence from clone RP5-1093... 44 0.23
261emb|AL133297.1| Human DNA sequence from clone LA16c-425C2 on chr... 44 0.23
262emb|AL096855.48|HS1115A15 Human DNA sequence from clone RP5-1115... 44 0.23
263emb|AL078586.35|HSJ323P13 Human DNA sequence from clone RP3-323P... 44 0.23
264emb|AL080249.26|HSJ564F22 Human DNA sequence from clone RP4-564F... 44 0.23
265emb|AL049539.21|HSJ836N17 Human DNA sequence from clone RP5-836N... 44 0.23
266emb|AL049868.20|HSJ927M24 Human DNA sequence from clone RP5-927M... 44 0.23
267emb|AL050343.17|HSJ657D16 Human DNA sequence from clone RP4-657D... 44 0.23
268emb|AL096703.14|HSJ735G18 Human DNA sequence from clone RP4-735G... 44 0.23
269emb|AL049653.7|HSJ647M16 Human DNA sequence from clone RP4-647M1... 44 0.23
270emb|AL109802.6|HSBA163M1 Human DNA sequence from clone RP11-163M... 44 0.23
271emb|AL049594.4|HSDJ860P4 Human DNA sequence from clone RP5-860P4... 44 0.23
272emb|AL031669.28|HS661I20 Human DNA sequence from clone RP4-661I2... 44 0.23
273emb|AL034380.26|HS50O24 Human DNA sequence from clone RP1-50O24 ... 44 0.23
274emb|AL031668.23|HS64K7 Human DNA sequence from clone RP1-64K7 on... 44 0.23
275emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K2... 44 0.23
276emb|AL031430.2|HS406M12 Human DNA sequence from clone RP3-406M12... 44 0.23
277emb|AL031391.1|HS276K20 Human DNA sequence from clone RP1-276K20... 44 0.23
278emb|AL022723.4|HS377H14 Human DNA sequence from clone RP3-377H14... 44 0.23
279gb|AC092933.21| Homo sapiens 3 BAC RP11-200I19 (Roswell Park Can... 44 0.23
280emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16... 44 0.23
281gb|AY294312.1|AY294311S2 Homo sapiens retrotransposon, 3' sequence 44 0.23
282gb|AC079313.35| Homo sapiens 12q BAC RP11-753H16 (Roswell Park C... 44 0.23
283gb|AC087499.12| Homo sapiens chromosome 17, clone RP11-218E15, c... 44 0.23
284gb|AC141002.8| Homo sapiens 3 BAC RP11-572O6 (Roswell Park Cance... 44 0.23
285gb|AC139103.3| Homo sapiens chromosome 8, clone, complete sequence 44 0.23
286emb|CR936850.1| Human DNA sequence from clone XX-HCC1954_35G04, ... 44 0.23
287emb|CR753846.4| Human DNA sequence from clone DADB-249P12 on chr... 44 0.23
288gb|AC092906.11| Homo sapiens 3 BAC RP11-731M17 (Roswell Park Can... 44 0.23
289gb|AC024257.25| Homo sapiens 12 BAC RP11-370I10 (Roswell Park Ca... 44 0.23
290gb|AC090329.6| Homo sapiens chromosome 18, clone RP11-793M6, com... 44 0.23
291gb|AC018653.29| Homo sapiens 12 BAC RP11-273B20 (Roswell Park Ca... 44 0.23
292gb|AC015813.12| Homo sapiens, clone RP11-159D12, complete sequence 44 0.23
293gb|AC044840.9| Homo sapiens chromosome , clone RP11-30L3, comple... 44 0.23
294gb|AC018628.13| Homo sapiens chromosome 17, clone RP11-342K2, co... 44 0.23
295gb|AC107909.5| Homo sapiens chromosome 8, clone CTD-2340D6, comp... 44 0.23
296gb|AC087487.14| Homo sapiens chromosome 15, clone RP11-698F12, c... 44 0.23
297emb|CR753901.9| Human DNA sequence from clone DADB-166N19 on chr... 44 0.23
298gb|AC105195.5| Homo sapiens chromosome 8, clone RP11-480J6, comp... 44 0.23
299gb|AC103874.2| Homo sapiens chromosome 15, clone RP11-907B8, com... 44 0.23
300gb|AE006467.1| Homo sapiens 16p13.3 sequence section 6 of 8 44 0.23
301gb|AC044839.16| Homo sapiens chromosome 11, clone CTD-2210P24, c... 44 0.23
302gb|AC016883.14| Homo sapiens chromosome 8, clone RP11-327N12, co... 44 0.23
303gb|AC099677.2| Homo sapiens chromosome 1 clone RP4-631H13, compl... 44 0.23
304gb|AC117532.2| Homo sapiens chromosome 5 clone RP11-648M2, compl... 44 0.23
305gb|AC022144.8| Homo sapiens chromosome 19 clone CTD-2540F13, com... 44 0.23
306gb|AC096640.2| Homo sapiens chromosome 1 clone RP11-332J14, comp... 44 0.23
307gb|AC090470.9| Homo sapiens chromosome 11, clone RP11-617E11, co... 44 0.23
308gb|AC027793.9| Homo sapiens chromosome 17, clone RP11-229K15, co... 44 0.23
309gb|AC091991.2| Homo sapiens chromosome 5 clone RP11-86C20, compl... 44 0.23
310gb|AC011447.7| Homo sapiens chromosome 19 clone CTC-260E6, compl... 44 0.23
311gb|AC108685.4| Homo sapiens X BAC RP11-323F16 (Roswell Park Canc... 44 0.23
312gb|AC022145.8| Homo sapiens chromosome 19 clone CTD-2579N5, comp... 44 0.23
313gb|AC016587.9| Homo sapiens chromosome 19 clone CTD-2632B17, com... 44 0.23
314gb|AC010422.7| Homo sapiens chromosome 19 clone CTD-2192J16, com... 44 0.23
315gb|AC008798.10| Homo sapiens chromosome 19 clone CTD-2057D4, com... 44 0.23
316gb|AC118465.2| Homo sapiens chromosome 5 clone RP11-950K24, comp... 44 0.23
317gb|AC092070.2| Homo sapiens chromosome 19 clone CTD-2245F17, com... 44 0.23
318gb|AC093462.11| Homo sapiens chromosome 18, clone RP11-850A17, c... 44 0.23
319gb|AC114495.2| Homo sapiens chromosome 1 clone RP11-490K7, compl... 44 0.23
320gb|AC119750.2| Homo sapiens chromosome 1 clone RP11-459K23, comp... 44 0.23
321gb|AC087297.13| Homo sapiens chromosome 17, clone RP11-362P24, c... 44 0.23
322gb|AC113169.2| Homo sapiens chromosome 3 clone RP11-322K13, comp... 44 0.23
323emb|CR753309.2| Human DNA sequence from clone DADB-102D14 on chr... 44 0.23
324emb|CR759738.1| Human DNA sequence from clone XX-NCIH2171_16J17,... 44 0.23
325gb|AC011611.26| Homo sapiens 12 BAC RP11-290L1 (Roswell Park Can... 44 0.23
326dbj|AK128230.1| Homo sapiens cDNA FLJ46363 fis, clone TESTI4050954 44 0.23
327dbj|AK126186.1| Homo sapiens cDNA FLJ44198 fis, clone THYMU30005... 44 0.23
328dbj|AK127582.1| Homo sapiens cDNA FLJ45677 fis, clone ERLTF10000... 44 0.23
329gb|AC115539.4| Homo sapiens BAC clone RP11-359D11 from 4, comple... 44 0.23
330gb|AF469043.1| Homo sapiens hepatocellular carcinoma-associated ... 44 0.23
331gb|AC011399.6| Homo sapiens chromosome 5 clone CTB-25P15, comple... 44 0.23
332gb|AC008438.6| Homo sapiens chromosome 5 clone CTC-329D1, comple... 44 0.23
333gb|AC010617.8| Homo sapiens chromosome 19 clone CTD-2607J13, com... 44 0.23
334gb|AC097268.10| Pan troglodytes BAC RP43-43O8 (Roswell Park Can... 44 0.23
335gb|AC104808.4| Homo sapiens BAC clone RP11-636J1 from 4, complet... 44 0.23
336gb|AC087721.4| Homo sapiens chromosome 15 clone RP11-16O9 map 15... 44 0.23
337gb|AC073370.7| Homo sapiens chromosome 10 clone RP11-472G21, com... 44 0.23
338gb|AC106713.3| Homo sapiens X BAC RP11-770A12 (Roswell Park Canc... 44 0.23
339gb|AC175319.3| Pan troglodytes BAC clone CH251-258C23 from chrom... 44 0.23
340gb|AC112213.2| Homo sapiens chromosome 3 clone RP11-223D18, comp... 44 0.23
341gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, comple... 44 0.23
342gb|AC015779.8| Homo sapiens chromosome , clone RP11-2I13, comple... 44 0.23
343gb|AC025178.8| Homo sapiens chromosome 5 clone CTD-2152M20, comp... 44 0.23
344gb|AC078785.22| Homo sapiens 3 BAC RP11-572M11 (Roswell Park Can... 44 0.23
345gb|AC103834.2| Homo sapiens chromosome 8, clone RP11-1081K18, co... 44 0.23
346gb|AC092111.9| Homo sapiens 12 BAC RP11-266K4 (Roswell Park Canc... 44 0.23
347gb|AC084881.19| Homo sapiens 12 BAC RP11-768F21 (Roswell Park Ca... 44 0.23
348gb|AC069542.7| Homo sapiens chromosome 10 clone RP11-390B4, comp... 44 0.23
349gb|AC079322.5| Homo sapiens chromosome 15, clone RP11-1007O24, c... 44 0.23
350gb|AC010997.12| Homo sapiens chromosome 10 clone RP11-399K21, co... 44 0.23
351gb|AC109357.3| Homo sapiens BAC clone RP11-636M7 from 4, complet... 44 0.23
352gb|AC093817.3| Homo sapiens BAC clone RP11-364P22 from 4, comple... 44 0.23
353gb|AC099329.2| Homo sapiens chromosome 3 clone RP11-70C1, comple... 44 0.23
354gb|AC079995.5| Homo sapiens BAC clone RP11-629N4 from 4, complet... 44 0.23
355gb|AC008158.16| Homo sapiens chromosome 17, clone RP11-42F20, co... 44 0.23
356gb|AC011921.14| Homo sapiens chromosome 17, clone RP11-15E18, co... 44 0.23
357gb|AC099793.2| Homo sapiens chromosome 1 clone RP11-565N2, compl... 44 0.23
358gb|AC026248.7| Homo sapiens chromosome 8, clone RP11-263C20, com... 44 0.23
359gb|AC098873.3| Homo sapiens BAC clone RP11-793H20 from 4, comple... 44 0.23
360gb|AC021305.9| Homo sapiens chromosome 8, clone RP11-140B16, com... 44 0.23
361gb|AC004655.1| Homo sapiens Xp22-140-141 BAC GSHB-128G5 (Genome ... 44 0.23
362gb|AC020629.6| Homo sapiens 12q BAC RP11-76E16 (Roswell Park Can... 44 0.23
363gb|AC091814.10| Homo sapiens 12p BAC RP11-290C10 (Roswell Park C... 44 0.23
364gb|AC084032.23| Homo sapiens 12q BAC RP11-320P7 (Roswell Park Ca... 44 0.23
365gb|AC002553.2| Homo sapiens chromosome , clone CTC-529I10, compl... 44 0.23
366gb|AC025919.8| Homo sapiens chromosome 15 clone RP11-947O24 map ... 44 0.23
367gb|AC008404.8| Homo sapiens chromosome 5 clone CTC-273K4, comple... 44 0.23
368gb|AC009690.17| Homo sapiens chromosome 15, clone RP11-106M3, co... 44 0.23
369gb|AC097522.4| Homo sapiens BAC clone RP11-588F10 from 4, comple... 44 0.23
370gb|AC093864.3| Homo sapiens BAC clone RP11-557J10 from 4, comple... 44 0.23
371gb|AC106779.3| Homo sapiens chromosome 16 clone RP11-343H19, com... 44 0.23
372gb|AC007860.6| Homo sapiens 8 BAC RP11-709E21 (Roswell Park Canc... 44 0.23
373gb|AC010621.7| Homo sapiens chromosome 5 clone CTD-2034J20, comp... 44 0.23
374gb|AC013476.9| Homo sapiens BAC clone RP11-525G12 from 2, comple... 44 0.23
375gb|AC073840.8| Homo sapiens BAC clone RP11-429O22 from 4, comple... 44 0.23
376gb|AC018714.4| Homo sapiens BAC clone RP11-382A18 from 8, comple... 44 0.23
377gb|AC004873.3| Homo sapiens PAC clone RP4-742P4 from 1, complete... 44 0.23
378gb|AC013603.17| Homo sapiens, clone RP11-10D7, complete sequence 44 0.23
379gb|AC091199.6| Homo sapiens chromosome 17, clone RP11-697E22, co... 44 0.23
380gb|AC096644.2| Homo sapiens chromosome 1 clone RP11-410C4, compl... 44 0.23
381gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, compl... 44 0.23
382gb|AC011037.8| Homo sapiens chromosome 8, clone RP11-7F18, compl... 44 0.23
383gb|AC090196.5| Homo sapiens chromosome 8, clone RP11-766A10, com... 44 0.23
384gb|AC067805.9| Homo sapiens chromosome 15, clone RP11-63A23, com... 44 0.23
385gb|AC061975.6| Homo sapiens chromosome 17, clone CTD-2008P7, com... 44 0.23
386gb|AC026330.12| Homo sapiens 3 BAC RP11-414D23 (Roswell Park Can... 44 0.23
387gb|AC008614.6| Homo sapiens chromosome 5 clone CTB-138E24, compl... 44 0.23
388gb|AC020904.7| Homo sapiens chromosome 19 clone CTB-52I2, comple... 44 0.23
389gb|AY046055.1| Homo sapiens zonadhesin (ZAN) gene, complete cds,... 44 0.23
390gb|AC025570.43| Homo sapiens 12 BAC RP11-681G7 (Roswell Park Can... 44 0.23
391gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, comp... 44 0.23
392gb|AC092043.3| Homo sapiens chromosome 3 clone RP11-141M3, compl... 44 0.23
393gb|AC130343.7| Homo sapiens chromosome 17, clone RP11-961A15, co... 44 0.23
394emb|BX927168.11| Human DNA sequence from clone DAMA-367I24 on ch... 44 0.23
395gb|AC034204.6| Homo sapiens chromosome 5 clone CTB-192J21, compl... 44 0.23
396gb|AC025171.8| Homo sapiens chromosome 5 clone CTD-2035E11, comp... 44 0.23
397gb|AC163760.3| Pan troglodytes BAC clone CH251-180O13 from chrom... 44 0.23
398gb|AC009488.5| Homo sapiens BAC clone RP11-336D7 from 7, complet... 44 0.23
399gb|AC073333.5| Homo sapiens BAC clone RP11-455J15 from 7, comple... 44 0.23
400gb|AC008536.7| Homo sapiens chromosome 5 clone CTC-487M23, compl... 44 0.23
401gb|AC004922.2| Homo sapiens PAC clone RP5-900K19 from 7, complet... 44 0.23
402gb|AC159023.4| Pan troglodytes BAC clone CH251-506L16 from chrom... 44 0.23
403gb|AC148315.3| Pan troglodytes BAC clone CH251-530M14 from chrom... 44 0.23
404gb|AY275833.1| Homo sapiens polymerase (DNA directed), alpha (PO... 44 0.23
405gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, comp... 44 0.23
406gb|AC010244.6| Homo sapiens chromosome 5 clone CTC-364B20, compl... 44 0.23
407gb|AC093179.1| Homo sapiens chromosome 3 clone RP11-983J7 map 3p... 44 0.23
408gb|AC008686.8| Homo sapiens chromosome 19 clone CTB-5E10, comple... 44 0.23
409gb|AC017109.5| Homo sapiens chromosome 4 clone RP11-568O24, comp... 44 0.23
410gb|AC015917.30| Homo sapiens chromosome 17, clone CTD-2350C19, c... 44 0.23
411gb|AC012146.25| Homo sapiens chromosome 17, clone RP11-46I8, com... 44 0.23
412gb|AC090954.3| Homo sapiens chromosome 3 clone RP11-616M11 map 3... 44 0.23
413gb|AC008962.9| Homo sapiens chromosome 19 clone CTD-2356P16, com... 44 0.23
414gb|AC008956.8| Homo sapiens chromosome 16 clone CTD-2343L5, comp... 44 0.23
415gb|AC034243.7| Homo sapiens chromosome 5 clone RP1-204O11, compl... 44 0.23
416gb|AC011541.7| Homo sapiens chromosome 19 clone LLNLR-258F7, com... 44 0.23
417gb|AF336886.1|AF336886 Homo sapiens FKSG59 (FKSG59) mRNA, comple... 44 0.23
418gb|AF336876.1|AF336876 Homo sapiens FKSG49 (FKSG49) mRNA, comple... 44 0.23
419gb|AC000353.27| Homo sapiens Chromosome 11q13 BAC Clone 18h3, co... 44 0.23
420ref|NG_001558.1| Homo sapiens signal recognition particle 72kD p... 44 0.23
421gb|AC018926.10|AC018926 Homo sapiens chromosome 15 clone RP11-13... 44 0.23
422emb|CR376760.1| Pan troglodytes chromosome X BAC PTB-056G20, com... 44 0.23
423gb|AC138207.3| Homo sapiens chromosome 17, clone RP11-848P1, com... 44 0.23
424gb|AC139493.3| Homo sapiens chromosome 5 clone RP11-844P9, compl... 44 0.23
425gb|AC138956.3| Homo sapiens chromosome 5 clone RP11-843P14, comp... 44 0.23
426gb|AC138865.3| Homo sapiens chromosome 5 clone RP11-1407J20, com... 44 0.23
427gb|AC138819.3| Homo sapiens chromosome 5 clone RP11-1101H11, com... 44 0.23
428gb|AC108483.3| Homo sapiens chromosome 16 clone RP11-170P24, com... 44 0.23
429gb|AC005798.10|AC005798 Homo sapiens chromosome 4 clone RP11-442... 44 0.23
430gb|AC106045.5| Homo sapiens BAC clone RP11-29H20 from 4, complet... 44 0.23
431gb|AC104687.3| Homo sapiens BAC clone RP11-123J14 from 4, comple... 44 0.23
432gb|AC008178.3| Homo sapiens BAC clone RP11-551O2 from 2, complet... 44 0.23
433gb|AC010907.10| Homo sapiens BAC clone RP11-568H24 from 2, compl... 44 0.23
434gb|AC007256.5| Homo sapiens BAC clone RP11-575C6 from 2, complet... 44 0.23
435gb|AC074099.6| Homo sapiens BAC clone RP11-605B16 from 2, comple... 44 0.23
436gb|AC064834.5| Homo sapiens BAC clone RP11-666B15 from 2, comple... 44 0.23
437gb|AC068039.6| Homo sapiens BAC clone RP11-703L16 from 2, comple... 44 0.23
438gb|AC073892.6| Homo sapiens BAC clone RP11-696G20 from 2, comple... 44 0.23
439gb|AC097532.3| Homo sapiens BAC clone RP11-725P16 from 2, comple... 44 0.23
440gb|AC109829.4| Homo sapiens BAC clone RP11-1217F14 from 2, compl... 44 0.23
441gb|AC016845.14| Homo sapiens chromosome 11, clone RP11-5E23, com... 44 0.23
442gb|AC011503.4|AC011503 Homo sapiens chromosome 19 clone CTB-92J2... 44 0.23
443gb|AC012313.7| Homo sapiens chromosome 19 clone CTD-2619J13, com... 44 0.23
444gb|AC146055.4| Pan troglodytes BAC clone RP43-80G9 from chromoso... 44 0.23
445gb|AC146071.3| Pan troglodytes BAC clone RP43-64L21 from chromos... 44 0.23
446gb|AC022079.16|AC022079 Homo sapiens 12 BAC RP11-425D17 (Roswell... 44 0.23
447gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, com... 44 0.23
448gb|AC066615.7|AC066615 Homo sapiens chromosome 15 clone RP11-90J... 44 0.23
449gb|AC084783.2|AC084783 Homo sapiens chromosome 15 clone RP11-5N1... 44 0.23
450gb|AC009118.11| Homo sapiens chromosome 16 clone RP11-481J2, com... 44 0.23
451gb|AC010359.5|AC010359 Homo sapiens chromosome 5 clone CTD-2033C... 44 0.23
452gb|AC117382.10| Homo sapiens 3 BAC RP11-102M11 (Roswell Park Can... 44 0.23
453gb|AC121758.14| Homo sapiens 12 BAC RP11-74M13 (Roswell Park Can... 44 0.23
454gb|AC125611.4| Homo sapiens 12 BAC RP11-161H23 (Roswell Park Can... 44 0.23
455gb|AC093802.3| Homo sapiens BAC clone RP11-315F22 from 2, comple... 44 0.23
456gb|AC016142.22| Homo sapiens 3 BAC RP11-166N6 (Roswell Park Canc... 44 0.23
457gb|AC092636.3| Homo sapiens BAC clone RP11-353K11 from 2, comple... 44 0.23
458gb|AC009967.8| Homo sapiens BAC clone RP11-401O19 from 2, comple... 44 0.23
459gb|AC074117.7| Homo sapiens BAC clone RP11-413M20 from 2, comple... 44 0.23
460gb|AC010150.3| Homo sapiens BAC clone RP11-404P12 from 2, comple... 44 0.23
461gb|AC009413.2| Homo sapiens BAC clone RP11-459K11 from 2, comple... 44 0.23
462gb|AC068547.7| Homo sapiens BAC clone RP11-458J7 from 2, complet... 44 0.23
463gb|AC017081.8| Homo sapiens BAC clone RP11-470J24 from 2, comple... 44 0.23
464gb|AC008280.4| Homo sapiens BAC clone RP11-477N3 from 2, complet... 44 0.23
465gb|AC013277.9| Homo sapiens BAC clone RP11-480N9 from 2, complet... 44 0.23
466gb|AC105036.14| Homo sapiens chromosome 15, clone CTD-2323K18, c... 44 0.23
467gb|AC093384.4| Homo sapiens BAC clone RP11-490P22 from 2, comple... 44 0.23
468gb|AC139795.3| Homo sapiens chromosome 5 clone RP11-1277A3, comp... 44 0.23
469gb|AC083861.2|AC083861 Homo sapiens chromosome 7 clone RP11-164E... 44 0.23
470gb|AC099796.2| Homo sapiens chromosome 1 clone RP5-866L20, compl... 44 0.23
471gb|AC139705.4| Homo sapiens X BAC RP11-102M2 (Roswell Park Cance... 44 0.23
472gb|AC115994.24| Homo sapiens chromosome 17, clone CTD-2535L24, c... 44 0.23
473gb|AC076966.25| Homo sapiens 3 BAC RP11-245C23 (Roswell Park Can... 44 0.23
474gb|AC135050.3| Homo sapiens chromosome 16 clone RP11-196G11, com... 44 0.23
475gb|AC008278.3|AC008278 Homo sapiens BAC clone RP11-422A6 from 2,... 44 0.23
476gb|AC092599.3| Homo sapiens BAC clone RP11-118B7 from 2, complet... 44 0.23
477gb|AC002351.2| Homo sapiens 12 PAC RP1-46F2 (Roswell Park Cancer... 44 0.23
478gb|AC016712.6| Homo sapiens BAC clone RP11-266F17 from 2, comple... 44 0.23
479gb|AC007285.3|AC007285 Homo sapiens BAC clone RP11-576P10 from 7... 44 0.23
480gb|AC105448.5| Homo sapiens BAC clone RP11-1197E19 from 4, compl... 44 0.23
481gb|AC104938.7| Homo sapiens chromosome 15, clone CTD-2524L6, com... 44 0.23
482gb|AC027176.22| Homo sapiens chromosome 15, clone RP11-493E3, co... 44 0.23
483gb|AC124916.3| Homo sapiens chromosome 3 clone RP11-1029M24, com... 44 0.23
484gb|AC004757.2| Homo sapiens chromosome 17, clone CTB-117K16, com... 44 0.23
485gb|AC137781.2| Homo sapiens chromosome 5 clone RP11-1108I11, com... 44 0.23
486gb|AC114480.2| Homo sapiens chromosome 3 clone RP11-755B10, comp... 44 0.23
487gb|AC068769.19| Homo sapiens 3 BAC RP11-14I2 (Roswell Park Cance... 44 0.23
488gb|AC108045.3| Homo sapiens BAC clone RP11-307L18 from 4, comple... 44 0.23
489gb|AC112484.8| Homo sapiens 3 BAC RP11-723O4 (Roswell Park Cance... 44 0.23
490gb|AC110921.9| Homo sapiens chromosome 17, clone CTD-2653B5, com... 44 0.23
491gb|AC064847.4| Homo sapiens BAC clone RP11-63C2 from 2, complete... 44 0.23
492gb|AC068056.7| Homo sapiens BAC clone RP11-84M3 from 2, complete... 44 0.23
493gb|AC131281.7| Homo sapiens chromosome 8, clone RP11-585F1, comp... 44 0.23
494gb|AC104981.9| Homo sapiens chromosome 17, clone RP11-316M20, co... 44 0.23
495gb|AC131206.2| Homo sapiens 12 BAC RP11-157G21 (Roswell Park Can... 44 0.23
496gb|AC008555.5|AC008555 Homo sapiens chromosome 19 clone CTC-523E... 44 0.23
497gb|AC068570.23| Homo sapiens chromosome 8, clone RP11-126N1, com... 44 0.23
498gb|AC025181.8| Homo sapiens chromosome 5 clone CTD-2186M15, comp... 44 0.23
499gb|AC105267.3| Homo sapiens chromosome 3 clone CTD-3211M3, compl... 44 0.23
500gb|AC104190.3| Homo sapiens chromosome 3 clone RP11-502L5, compl... 44 0.23

>emb|AJ966349.1| Hordeum vulgare subsp. vulgare mRNA for lipoxygenase-like protein
           (lox gene)
          Length = 3123

 Score =  482 bits (243), Expect = e-133
 Identities = 249/251 (99%)
 Strand = Plus / Plus

                                                                       
Query: 21  aaaacaggggggctgctactggtgtccggtccaaccgtccaagatccagagcgagaaaca 80
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   aaaacaggggggctgctactggtgtccggtccaaccgtccaagatccagagcgagaaaca 60

                                                                       
Query: 81  tatccccctgcccggccagccgccctgacccatttcgtccccggcgagcgatcttaacct 140
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 61  tatccccctgcccggccagccgctctgacccatttcgtccccggcgagcgatcttaacct 120

                                                                       
Query: 141 tgctaatctgcgccgacgagggaggggagcttctttctacggtcatgccgccgatggagc 200
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 tgctaatctgcgccgacgagggaggggagcttctttctacggtcatgccgccgatggagc 180

                                                                       
Query: 201 tgctggggagatccttcttgcaggcggcaggctctgccagcaccgcggcgcctcgcggcg 260
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 181 tgctggggagatccttcttgcaggcggcaggctctgccagcaccgcggcgcatcgcggcg 240

                      
Query: 261 gccgggagcgc 271
           |||||||||||
Sbjct: 241 gccgggagcgc 251



to top

>gb|AC163741.3| Pan troglodytes BAC clone CH251-406E22 from chromosome unknown,
             complete sequence
          Length = 169655

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 98197 ccccctgcccggccagccgccctg 98220



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 99003 ctgcccggccagccgccctg 99022



to top

>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome
              19
          Length = 413528

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 382826 ccccctgcccggccagccgccctg 382849



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 305704 ccccctgcccggccagccgccc 305725



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 168597 ccccctgcccggccagccgccc 168576



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 305152 ctgcccggccagccgccctg 305171



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 305025 ctgcccggccagccgccctg 305044



to top

>gb|AC186184.1| Pan troglodytes chromosome UNKNOWN clone CH251-131M1, complete sequence
          Length = 135932

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 12837 ccccctgcccggccagccgccctg 12814



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12886 ccccctgcccggccagccgccc 12865



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 12451 ctgcccggccagccgccctg 12432



to top

>gb|AC183617.3| Pan troglodytes BAC clone CH251-104G17 from chromosome 4, complete
              sequence
          Length = 172744

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 105745 ccccctgcccggccagccgccctg 105722



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 105342 ccccctgcccggccagccgccc 105321



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 105293 ccccccgcccggccagccgccctg 105270



to top

>gb|AC183799.2| Pan troglodytes BAC clone CH251-329J7 from chromosome 7, complete
              sequence
          Length = 174044

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 153122 ccccctgcccggccagccgccctg 153145



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 153654 ctgcccggccagccgccctg 153673



to top

>gb|AC183830.2| Pan troglodytes BAC clone CH251-267I9 from chromosome 7, complete
              sequence
          Length = 157720

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 108648 ccccctgcccggccagccgccctg 108625



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 108018 ctgcccggccagccgccctg 107999



to top

>ref|XM_989388.1| PREDICTED: Mus musculus hypothetical protein LOC667261 (LOC667261),
           mRNA
          Length = 498

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 238 cagcaccgcggcgcctcgcggcggccgggagc 269
           |||||||||||| ||||||||| |||||||||
Sbjct: 262 cagcaccgcggcccctcgcggccgccgggagc 231



to top

>gb|AC146199.2| Pan troglodytes BAC clone RP43-25F11 from 7, complete sequence
          Length = 186750

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 54750 ccccctgcccggccagccgccctg 54727



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 54299 ccccccgcccggccagccgccctg 54276



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 54217 ctgcccggccagccgccctg 54198



to top

>gb|AC147575.1| Homo sapiens chromosome 5 clone RP11-998B18, complete sequence
          Length = 190680

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 46172 ccccctgcccggccagccgccctg 46195



to top

>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence
          Length = 179509

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 148806 ccccctgcccggccagccgccctg 148783



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 149080 ccccctgcccggccagccgccc 149059



to top

>gb|AC142525.2| Homo sapiens chromosome 5 clone RP11-1275J23, complete sequence
          Length = 183459

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 116475 ccccctgcccggccagccgccctg 116498



to top

>gb|AC146166.2| Pan troglodytes BAC clone RP43-1B23 from 7, complete sequence
          Length = 165177

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 14323 ccccctgcccggccagccgccctg 14300



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 14015 ccccccgcccggccagccgccctg 13992



to top

>gb|AC144512.1| Pan troglodytes BAC clone RP43-51G12 from 7, complete sequence
          Length = 161807

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 83005 ccccctgcccggccagccgccctg 82982



 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 82506 ccccctgcccggccagccgccctg 82483



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 82070 ctgcccggccagccgccctg 82051



to top

>gb|AC103849.3| Homo sapiens chromosome 8, clone RP11-75H14, complete sequence
          Length = 147107

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 45070 ccccctgcccggccagccgccctg 45047



to top

>emb|AL929472.21| Human DNA sequence from clone RP11-109P14 on chromosome 1 Contains a
              pseudogene similar to part of actinin alpha4 (ACTN4), a
              novel pseudogene, two genes for novel proteins (FLJ31434,
              FLJ45459), the gene for ischemia/reperfusion inducible
              protein (FLJ23476), the MTF1 gene for metal-regulatory
              transcription factor 1, a ribosomal protein S2 (RPS2)
              pseudogene, the 3' end of the INPP5B gene for 75kDa nositol
              polyphosphate-5-phosphatase, two novel genes and four CpG
              islands, complete sequence
          Length = 143060

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 125515 ccccctgcccggccagccgccctg 125538



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 3077 ccccctgcccggccagccgccc 3056



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 2671 ccccctgcccggccagccgccc 2650



to top

>emb|Z75889.1|HS267P19 Human DNA sequence from clone RP1-267P19 on chromosome 13 Contains part
             of the gene for androgen-induced prostate proliferative
             shutoff associated protein (AS3) (CG008, FLJ23236,
             KIAA0979) and two CpG islands, complete sequence
          Length = 113704

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 81398 ccccctgcccggccagccgccctg 81421



to top

>emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chromosome 1 Contains the 5'
              end of one variant of the ZSWIM5 gene for zinc finger SWIM
              domain containing 5 and four CpG islands, complete sequence
          Length = 177710

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 151540 ccccctgcccggccagccgccctg 151563



to top

>emb|AL590710.14| Human DNA sequence from clone RP11-153P4 on chromosome 9 Contains the
             3' end of the VAV2 gene for vav 2 oncogene, the 5' end of
             the SARDH gene for sarcosine dehydrogenase (SAR, SDH,
             SARD, DMGDHL1) and a CpG island, complete sequence
          Length = 118671

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 68233 ccccctgcccggccagccgccctg 68256



to top

>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1
             gene for forkhead box E1 (thyroid transcription factor 2),
             HEMGN gene for hemogen, 2 novel genes and 5 CpG islands,
             complete sequence
          Length = 160796

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 15266 ccccctgcccggccagccgccctg 15289



to top

>emb|AL365505.15| Human DNA sequence from clone RP11-382A12 on chromosome 20 Contains the
             5' end of the SAMHD1 gene for SAM domain and HD domain 1,
             the 3' end of the RBL1 gene for retinoblastoma-like
             protein 1 (p107) and three CpG islands, complete sequence
          Length = 101500

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 66452 ccccctgcccggccagccgccctg 66429



to top

>emb|AL356957.27| Human DNA sequence from clone RP11-403I13 on chromosome 1 Contains the
             5' end of a novel pseudogene, a profilin 1 (PFN1)
             pseudogene, six novel genes and a novel pseudogene,
             complete sequence
          Length = 204702

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 24333 ccccctgcccggccagccgccctg 24356



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 23756 ccccctgcccggccagccgccc 23777



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 89129 ccccccgcccggccagccgccctg 89152



to top

>emb|AL354806.22| Human DNA sequence from clone RP11-521J24 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 198959

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 120188 ccccctgcccggccagccgccctg 120165



to top

>gb|AC183592.2| Pan troglodytes BAC clone CH251-733I16 from chromosome 10, complete
             sequence
          Length = 167069

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 29167 ccccctgcccggccagccgccctg 29190



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 29472 ccccctgcccggccagccgccc 29493



to top

>emb|AL161644.6| Human DNA sequence from clone RP5-997D24 on chromosome 1 Contains the
             3' end of the MRPL37 gene for mitochondrial ribosomal
             protein L37, two novel genes, the 3' end of the SSBP3 gene
             for single stranded DNA binding protein 3, a novel protein
             (MSTP128) and a CpG island, complete sequence
          Length = 83463

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 19248 ccccctgcccggccagccgccctg 19271



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 19072 ccccctgcccggccagccgccc 19093



to top

>emb|AL024507.7|HS191J18 Human DNA sequence from clone RP1-191J18 on chromosome 6q16.1-22.33
             Contains the SEC63 gene for SEC63-like (S. cerevisiae), a
             60S ribosomal protein 23A (RPL23A) pseudogene, a ribosomal
             protein L14 (RPL14) pseudogene, a pseudogene similar to
             part of methylene tetrahydrofolate dehydrogenase (NAD+
             dependent), methenyltetrahydrofolate cyclohydrolase
             (MTHFD2) (NMDMC) and three CpG islands, complete sequence
          Length = 152408

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 45857 ccccctgcccggccagccgccctg 45834



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 64883 ccccctgcccggccagccgccc 64862



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 64610 ccccctgcccggccagccgccc 64589



to top

>emb|AL034374.2|HS483K16 Human DNA sequence from clone RP3-483K16 on chromosome 6p12.1-21.1
             Contains the gene for homolog of yeast long chain
             polyunsaturated fatty acid elongation enzyme 2 (HELO1), a
             40S Ribosomal protein (RPS16) pseudogene, a 60S Ribosomal
             protein (RPL31) pseudogene and CpG islands, complete
             sequence
          Length = 101270

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 40583 ccccctgcccggccagccgccctg 40560



to top

>gb|AC107952.5| Homo sapiens chromosome 8, clone RP11-140I16, complete sequence
          Length = 142102

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 135827 ccccctgcccggccagccgccctg 135804



to top

>gb|AC183687.3| Pan troglodytes BAC clone CH251-25N14 from chromosome 1, complete
              sequence
          Length = 192054

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 168767 ccccctgcccggccagccgccctg 168790



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 168894 ccccccgcccggccagccgccctg 168917



to top

>gb|AC182637.3| Pan troglodytes BAC clone CH251-431A15 from chromosome 7, complete
              sequence
          Length = 186750

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 135330 ccccctgcccggccagccgccctg 135307



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 135379 ccccccgcccggccagccgccctg 135356



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     ccccctgcccggccagccgc 103
              ||||||||||||||||||||
Sbjct: 135024 ccccctgcccggccagccgc 135005



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 134830 ccccccgcccggccagccgccctg 134807



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 134621 ctgcccggccagccgccctg 134602



to top

>gb|AC148926.4| Pan troglodytes BAC clone RP43-136P16 from chromosome 7, complete
             sequence
          Length = 178320

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 63880 ccccctgcccggccagccgccctg 63857



 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 63279 ccccctgcccggccagccgccctg 63256



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 62795 ctgcccggccagccgccctg 62776



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 62751 ccccccgcccggccagccgccctg 62728



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 62667 ctgcccggccagccgccctg 62648



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 62169 ctgcccggccagccgccctg 62150



to top

>gb|AC163739.2| Pan troglodytes BAC clone CH251-503F22 from chromosome unknown, complete
              sequence
          Length = 220347

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 108079 ccccctgcccggccagccgccctg 108056



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 107579 ccccccgcccggccagccgccctg 107556



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 107370 ctgcccggccagccgccctg 107351



to top

>gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, complete sequence
          Length = 128501

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 24646 ccccctgcccggccagccgccctg 24623



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 24374 ccccctgcccggccagccgccc 24353



 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 83    tccccctgcccggccagccgccctg 107
             |||| ||||||||||||||||||||
Sbjct: 25018 tccctctgcccggccagccgccctg 24994



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 25095 ccccccgcccggccagccgccctg 25072



to top

>gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, complete sequence
          Length = 152039

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 77769 ccccctgcccggccagccgccctg 77792



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 77542 ccccctgcccggccagccgccc 77563



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 77264 ccccctgcccggccagccgccc 77285



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 77138 ccccctgcccggccagccgccc 77159



to top

>gb|AC027088.8| Homo sapiens chromosome 15, clone RP11-809H16, complete sequence
          Length = 187712

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 150398 ccccctgcccggccagccgccctg 150421



to top

>gb|AC157480.3| Pan troglodytes BAC clone CH251-394P5 from chromosome unknown, complete
              sequence
          Length = 179883

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 112132 ccccctgcccggccagccgccctg 112155



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 113118 ctgcccggccagccgccctg 113137



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 112909 ccccccgcccggccagccgccctg 112932



to top

>gb|AC010355.7| Homo sapiens chromosome 5 clone CTD-2027K22, complete sequence
          Length = 198396

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 66980 ccccctgcccggccagccgccctg 67003



to top

>gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, complete sequence
          Length = 107137

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 61806 ccccctgcccggccagccgccctg 61829



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 62079 ccccctgcccggccagccgccc 62100



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 61357 ccccccgcccggccagccgccctg 61380



to top

>gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome 13, complete sequence
          Length = 223130

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 238    cagcaccgcggcgcctcgcggcggccgggagc 269
              |||||||||||| ||||||||| |||||||||
Sbjct: 177584 cagcaccgcggcccctcgcggccgccgggagc 177615



to top

>gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F5, complete sequence
          Length = 103115

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 79620 ccccctgcccggccagccgccctg 79643



to top

>gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, complete sequence
          Length = 166873

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 139428 ccccctgcccggccagccgccctg 139405



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 13530 ccccctgcccggccagccgccc 13551



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 13352 ccccctgcccggccagccgccc 13373



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 13175 ccccccgcccggccagccgccctg 13198



to top

>gb|AC147282.3| Pan troglodytes BAC clone RP43-86L11 from chromosome 7, complete sequence
          Length = 223086

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 123496 ccccctgcccggccagccgccctg 123473



 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 85    cccctgcccggccagccgccc 105
             |||||||||||||||||||||
Sbjct: 42008 cccctgcccggccagccgccc 41988



to top

>gb|AC145873.3| Pan troglodytes BAC clone RP43-20K16 from chromosome 7, complete sequence
          Length = 149916

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 113227 ccccctgcccggccagccgccctg 113250



to top

>gb|AC112510.9| Homo sapiens 3 BAC RP11-432A8 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 192749

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 84   ccccctgcccggccagccgccctg 107
            ||||||||||||||||||||||||
Sbjct: 5466 ccccctgcccggccagccgccctg 5489



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 4628 ccccctgcccggccagccgccc 4649



to top

>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence
          Length = 129402

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 84   ccccctgcccggccagccgccctg 107
            ||||||||||||||||||||||||
Sbjct: 9298 ccccctgcccggccagccgccctg 9321



to top

>gb|AC020550.4| Homo sapiens BAC clone RP11-198M19 from 2, complete sequence
          Length = 172813

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 47551 ccccctgcccggccagccgccctg 47528



to top

>gb|AC159904.2| Pan troglodytes BAC clone CH251-488L1 from chromosome unknown, complete
              sequence
          Length = 177340

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 159221 ccccctgcccggccagccgccctg 159244



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 160207 ctgcccggccagccgccctg 160226



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 159998 ccccccgcccggccagccgccctg 160021



to top

>gb|AC145857.3| Pan troglodytes BAC clone RP43-6D4 from chromosome 7, complete sequence
          Length = 208516

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 141857 ccccctgcccggccagccgccctg 141834



 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 141083 ccccctgcccggccagccgccctg 141060



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 141324 ctgcccggccagccgccctg 141305



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 141280 ccccccgcccggccagccgccctg 141257



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 140226 ctgcccggccagccgccctg 140207



to top

>gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete sequence
          Length = 169741

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 11498 ccccctgcccggccagccgccctg 11521



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 11277 ccccctgcccggccagccgccc 11298



to top

>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence
          Length = 172761

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 101174 ccccctgcccggccagccgccctg 101197



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 102060 ctgcccggccagccgccctg 102079



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 101851 ccccccgcccggccagccgccctg 101874



to top

>gb|AC010636.6|AC010636 Homo sapiens chromosome 19 clone CTD-2332E11, complete sequence
          Length = 179393

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 133145 ccccctgcccggccagccgccctg 133168



to top

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 268292 ccccctgcccggccagccgccctg 268315



 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 267693 ccccctgcccggccagccgccctg 267716



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 268891 ccccccgcccggccagccgccctg 268914



to top

>dbj|AP000842.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-680F20riken,
             complete sequence
          Length = 179848

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 26015 ccccctgcccggccagccgccctg 26038



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 26323 ccccctgcccggccagccgccc 26344



to top

>gb|AC006344.2|AC006344 Homo sapiens PAC clone RP4-726N20 from 7q32-q34, complete sequence
          Length = 127447

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 80100 ccccctgcccggccagccgccctg 80077



to top

>emb|CT009602.4| PTB-121B21, complete sequence
          Length = 236109

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 92208 ccccctgcccggccagccgccctg 92185



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 91659 ccccccgcccggccagccgccctg 91636



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 91450 ctgcccggccagccgccctg 91431



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 91356 ccccccgcccggccagccgccctg 91333



to top

>emb|AL121790.4|CNS01DSI Human chromosome 14 DNA sequence BAC R-356O9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 203650

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 84084 ccccctgcccggccagccgccctg 84061



to top

>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete
            sequence
          Length = 194818

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 238  cagcaccgcggcgcctcgcggcggccgggagc 269
            |||||||||||| ||||||||| |||||||||
Sbjct: 3512 cagcaccgcggcccctcgcggccgccgggagc 3543



to top

>gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.269_G_24, complete sequence
          Length = 163685

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 159901 ccccctgcccggccagccgccctg 159924



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 159627 ccccctgcccggccagccgccc 159648



to top

>gb|AC159020.2| Pan troglodytes BAC clone CH251-530A5 from chromosome unknown, complete
              sequence
          Length = 219428

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 215284 ccccctgcccggccagccgccctg 215261



to top

>gb|DQ314884.1| Homo sapiens NADPH oxidase, EF-hand calcium binding domain 5 (NOX5)
             gene, complete cds
          Length = 128159

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 34745 ccccctgcccggccagccgccctg 34722



to top

>emb|AL353724.11| Human DNA sequence from clone RP11-448I13 on chromosome 13, complete
              sequence
          Length = 120652

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||||||||||||||||||||||
Sbjct: 100539 ccccctgcccggccagccgccctg 100562



to top

>gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, complete sequence
          Length = 127326

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||||||||||||||||||||||
Sbjct: 25493 ccccctgcccggccagccgccctg 25470



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 26025 ccccctgcccggccagccgccc 26004



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 25138 ccccctgcccggccagccgccc 25117



to top

>gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, complete sequence
          Length = 215644

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 84    ccccctgcccggccagccgccct 106
             |||||||||||||||||||||||
Sbjct: 11552 ccccctgcccggccagccgccct 11530



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 11894 ccccctgcccggccagccgccc 11873



to top

>gb|AC004885.2| Homo sapiens PAC clone RP4-781A18 from 7, complete sequence
          Length = 190842

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 85    cccctgcccggccagccgccctg 107
             |||||||||||||||||||||||
Sbjct: 17505 cccctgcccggccagccgccctg 17527



to top

>emb|AL512422.19| Human DNA sequence from clone RP11-472M19 on chromosome 6 Contains part
              of the BPAG1 gene for bullous pemphigoid antigen 1
              (230/240kD), a novel gene, a ribosomal protein L17 (RPL17)
              pseudogene and three CpG islands, complete sequence
          Length = 157918

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 84     ccccctgcccggccagccgccct 106
              |||||||||||||||||||||||
Sbjct: 119737 ccccctgcccggccagccgccct 119715



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 120139 ccccctgcccggccagccgccc 120118



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   gcctcgcggcggccgggagc 269
             ||||||||||||||||||||
Sbjct: 69674 gcctcgcggcggccgggagc 69655



to top

>emb|AL359512.15| Human DNA sequence from clone RP11-163B6 on chromosome 9 Contains the
             PDCL gene for phosducin-like, a keratin 18 (KRT18)
             pseudogene, the 3' end of the gene for membrane-associated
             nucleic acid binding protein (MNAB) (FLJ23389 FLJ20301
             FLJ20713) the gene for a novel olfactory (seven
             transmembrane helix) receptor and two CpG islands,
             complete sequence
          Length = 58884

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 84    ccccctgcccggccagccgccctgacc 110
             ||||| |||||||||||||||||||||
Sbjct: 55459 cccccggcccggccagccgccctgacc 55485



to top

>emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chromosome 9 Contains the
             5' end of the GLDC gene for glycine dehydrogenase
             (decarboxylating; glycine decarboxylase, glycine cleavage
             system protein P), a ribosomal protein L23a (RPL23A)
             pseudogene, a ribosomal protein S3A (RPS3A) pseudogene,
             the 3' end of a ring finger protein 2 (RNF2) pseudogene,
             the 5' end of a novel gene and 3 CpG islands, complete
             sequence
          Length = 59964

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 85    cccctgcccggccagccgccctg 107
             |||||||||||||||||||||||
Sbjct: 13278 cccctgcccggccagccgccctg 13300



to top

>emb|AL021918.1|HS34I8 Human DNA sequence from clone XXbac-34I8 on chromosome 6p21.3-22.1
             Contains the 5' end of the ZNF184 gene for Kruppel-like
             zinc finger protein 184, a heterogeneous nuclear
             ribonucleoprotein A1 (HNRPA1) pseudogene, a CD83 antigen
             pseudogene, ESTs, STSs, GSSs and three CpG islands,
             complete sequence
          Length = 159506

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 83    tccccctgcccggccagccgccc 105
             |||||||||||||||||||||||
Sbjct: 33818 tccccctgcccggccagccgccc 33796



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 33638 ccccctgcccggccagccgccc 33617



to top

>gb|AC108743.6| Homo sapiens 3 BAC RP11-206J21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 143682

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 85    cccctgcccggccagccgccctg 107
             |||||||||||||||||||||||
Sbjct: 82692 cccctgcccggccagccgccctg 82670



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 86    ccctgcccggccagccgccctg 107
             ||||||||||||||||||||||
Sbjct: 82644 ccctgcccggccagccgccctg 82623



to top

>gb|AC098484.2| Homo sapiens chromosome 1 clone RP5-994D16, complete sequence
          Length = 161835

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 84    ccccctgcccggccagccgccct 106
             |||||||||||||||||||||||
Sbjct: 98807 ccccctgcccggccagccgccct 98829



to top

>gb|AC021317.19| Homo sapiens chromosome 17, clone RP11-678G7, complete sequence
          Length = 180876

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 83    tccccctgcccggccagccgccc 105
             |||||||||||||||||||||||
Sbjct: 46861 tccccctgcccggccagccgccc 46839



to top

>gb|AC020978.10| Homo sapiens chromosome 16 clone RP11-96D1, complete sequence
          Length = 164293

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 85    cccctgcccggccagccgccctg 107
             |||||||||||||||||||||||
Sbjct: 62074 cccctgcccggccagccgccctg 62096



to top

>gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, complete sequence
          Length = 235968

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 83     tccccctgcccggccagccgccc 105
              |||||||||||||||||||||||
Sbjct: 225593 tccccctgcccggccagccgccc 225571



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 226047 ccccctgcccggccagccgccc 226026



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 225868 ccccctgcccggccagccgccc 225847



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 243     ccgcggcgcctcgcggcggccgg 265
               |||||||||||||||||||||||
Sbjct: 2515072 ccgcggcgcctcgcggcggccgg 2515050



to top

>gb|AC115992.13| Homo sapiens chromosome 17, clone CTD-2022O14, complete sequence
          Length = 139475

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 83    tccccctgcccggccagccgccc 105
             |||||||||||||||||||||||
Sbjct: 25424 tccccctgcccggccagccgccc 25446



to top

>gb|AC004073.1|AC004073 Human Chromosome X, complete sequence
          Length = 79612

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 85    cccctgcccggccagccgccctg 107
             |||||||||||||||||||||||
Sbjct: 15403 cccctgcccggccagccgccctg 15381



to top

>emb|AL133304.4|CNS01DUL Human chromosome 14 DNA sequence BAC R-116N8 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 141905

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 84     ccccctgcccggccagccgccct 106
              |||||||||||||||||||||||
Sbjct: 102129 ccccctgcccggccagccgccct 102151



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 101680 ccccctgcccggccagccgccc 101701



to top

>gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 containing NUP155
             gene, complete sequence
          Length = 165617

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 23806 ccccctgcccggccagccgccc 23827



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 143301 ccccccgcccggccagccgccctg 143278



to top

>gb|L29074.1|HUMFMR1S Homo sapiens fragile X mental retardation syndrome protein (FMR1) gene,
             alternative splice products, complete cds; and
             pseudogene, complete sequence
          Length = 185775

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 94122 ccccctgcccggccagccgccc 94101



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 94071 ccccctgcccggccagccgccc 94050



to top

>gb|AC146398.4| Pan troglodytes BAC clone RP43-54K1 from 7, complete sequence
          Length = 185645

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 101097 ccccctgcccggccagccgccc 101076



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 100651 ctgcccggccagccgccctg 100632



to top

>gb|AC108879.3| Homo sapiens chromosome X clone RP11-265P11 map p11.4, complete sequence
          Length = 174766

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 104540 ccccctgcccggccagccgccc 104561



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 104364 ccccctgcccggccagccgccc 104385



to top

>gb|AC145687.4| Pan troglodytes BAC clone CH251-281C1 from X, complete sequence
          Length = 138000

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 49919 ccccctgcccggccagccgccc 49940



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 50707 ccccccgcccggccagccgccctg 50730



to top

>gb|AC142169.2| Homo sapiens fosmid clone XXFOS-81770D1 from 7, complete sequence
          Length = 37728

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 2507 ccccctgcccggccagccgccc 2528



to top

>gb|AC145992.2| Pan troglodytes BAC clone RP43-172K3 from 7, complete sequence
          Length = 208817

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 168126 ccccctgcccggccagccgccc 168147



to top

>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete
              sequence
          Length = 199482

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 157716 ccccctgcccggccagccgccc 157695



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 57955 ccccctgcccggccagccgccc 57934



to top

>gb|AC009712.22| Homo sapiens chromosome 15, clone RP11-361M10, complete sequence
          Length = 213746

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 192616 ccccctgcccggccagccgccc 192595



to top

>gb|AC149044.1| Pan troglodytes chromosome X clone PTB-089E19 map human ortholog q27.1,
             complete sequence
          Length = 193569

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 56041 ccccctgcccggccagccgccc 56062



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 55816 ccccctgcccggccagccgccc 55837



to top

>gb|AC133330.3| Homo sapiens chromosome 8 clone RP11-134N2, complete sequence
          Length = 164916

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 10310 ccccctgcccggccagccgccc 10331



to top

>gb|AY663414.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA03715 MHC class
              II antigen (HLA-DQB1) gene and MHC class II antigen
              (HLA-DQA1) gene, HLA-DQA1-DQA1*0103 allele, complete cds;
              and MHC class II antigen (HLA-DRB1) gene, partial cds
          Length = 118048

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 103281 ccccctgcccggccagccgccc 103302



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 102974 ccccctgcccggccagccgccc 102995



to top

>gb|AY663411.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14663 MHC
             class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602
             allele, MHC class II antigen (HLA-DQA1) gene,
             HLA-DQA1-DQA1*010201 allele, and MHC class II antigen
             (HLA-DRB1) gene, complete cds
          Length = 99966

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 74868 ccccctgcccggccagccgccc 74889



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 74510 ccccctgcccggccagccgccc 74531



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 74231 ccccctgcccggccagccgccc 74252



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 73778 ccccctgcccggccagccgccc 73799



to top

>gb|AY663409.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA04535 MHC
             class II antigen (HLA-DQB1) gene and MHC class II antigen
             (HLA-DQA1) gene, HLA-DQA1-DQA1*0505 allele, complete cds;
             and MHC class II antigen (HLA-DRB1) gene, partial cds
          Length = 77506

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 68584 ccccctgcccggccagccgccc 68605



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 68226 ccccctgcccggccagccgccc 68247



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 67820 ccccctgcccggccagccgccc 67841



to top

>gb|AY663407.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC
             class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101
             allele, MHC class II antigen (HLA-DQA1) gene,
             HLA-DQA1-DQA1*050101 allele, and MHC class II antigen
             (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds
          Length = 106318

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 24686 ccccctgcccggccagccgccc 24707



to top

>gb|AY663406.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA10923 MHC
             class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602
             allele, MHC class II antigen (HLA-DQA1) gene,
             HLA-DQA1-DQA1*010201 allele, and MHC class II antigen
             (HLA-DRB1) gene, HLA-DRB1-DRB1*150101 allele, complete cds
          Length = 103395

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 85431 ccccctgcccggccagccgccc 85452



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 85073 ccccctgcccggccagccgccc 85094



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 84794 ccccctgcccggccagccgccc 84815



to top

>gb|AY663399.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA01018 MHC
             class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*020101
             allele, MHC class II antigen (HLA-DQA1) gene,
             HLA-DQA1-DQA1*050101 allele, and MHC class II antigen
             (HLA-DRB1) gene, HLA-DRB1-DRB1*030101 allele, complete cds
          Length = 105464

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 18001 ccccctgcccggccagccgccc 18022



to top

>gb|AY663395.1| Homo sapiens voucher Coriell Cell Repository DNA sample NA14660 MHC
             class II antigen (HLA-DQB1) gene, HLA-DQB1-DQB1*0602
             allele, MHC class II antigen (HLA-DQA1) gene,
             HLA-DQA1-DQA1*010201 allele, and MHC class II antigen
             (HLA-DRB1) gene, complete cds
          Length = 104996

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 74395 ccccctgcccggccagccgccc 74416



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 74037 ccccctgcccggccagccgccc 74058



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 73758 ccccctgcccggccagccgccc 73779



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 73630 ccccctgcccggccagccgccc 73651



to top

>gb|AC069503.25| Homo sapiens 12 BAC RP11-87C12 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 186580

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 63390 ccccctgcccggccagccgccc 63369



to top

>gb|AC002065.2| Homo sapiens BAC clone CTB-21N8 from 7, complete sequence
          Length = 117954

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12752 ccccctgcccggccagccgccc 12731



to top

>gb|AC103703.5| Homo sapiens chromosome 17, clone RP11-764D10, complete sequence
          Length = 144240

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 64986 ccccctgcccggccagccgccc 64965



to top

>gb|AC152064.3| Pan troglodytes BAC clone RP43-134I6 from chromosome 7, complete
             sequence
          Length = 179272

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 71080 ccccctgcccggccagccgccc 71101



to top

>gb|AY500996.1| Homo sapiens angiogenic factor VG5Q gene, complete cds
          Length = 40275

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 15835 ccccctgcccggccagccgccc 15814



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 16257 ccccccgcccggccagccgccctg 16234



to top

>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence
          Length = 148689

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 71199 ccccctgcccggccagccgccc 71220



to top

>gb|AC073324.6| Homo sapiens BAC clone RP11-339F13 from 7, complete sequence
          Length = 125253

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 32192 ccccctgcccggccagccgccc 32171



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 32014 ccccctgcccggccagccgccc 31993



to top

>gb|AC005192.1| Homo sapiens BAC clone CTB-163K11 from 7, complete sequence
          Length = 128600

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 90604 ccccctgcccggccagccgccc 90625



to top

>gb|AC004111.1| Homo sapiens BAC clone CTB-103H13 from 7, complete sequence
          Length = 106172

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 21788 ccccctgcccggccagccgccc 21809



to top

>gb|AY526322.1| Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase)
              (DDC) gene, complete cds
          Length = 106328

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 102868 ccccctgcccggccagccgccc 102847



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 102389 ccccctgcccggccagccgccc 102368



to top

>gb|AC004008.2| Homo sapiens PAC clone RP5-899B21 from 7, complete sequence
          Length = 90389

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 87216 ccccctgcccggccagccgccc 87237



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 86585 ctgcccggccagccgccctg 86604



to top

>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence
          Length = 196954

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 151342 ccccctgcccggccagccgccc 151363



to top

>gb|AC018705.10| Homo sapiens BAC clone RP11-95E2 from 7, complete sequence
          Length = 174970

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 52935 ccccctgcccggccagccgccc 52956



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 52456 ccccctgcccggccagccgccc 52477



to top

>gb|AC004079.1| Homo sapiens PAC clone RP1-167F23 from 7, complete sequence
          Length = 102717

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 27930 ccccctgcccggccagccgccc 27951



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    ccccctgcccggccagccgc 103
             ||||||||||||||||||||
Sbjct: 27754 ccccctgcccggccagccgc 27773



to top

>gb|AC146211.3| Pan troglodytes BAC clone RP43-33E10 from 7, complete sequence
          Length = 164849

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 85449 ccccctgcccggccagccgccc 85428



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 85001 ccccctgcccggccagccgccc 84980



to top

>gb|AY203949.1| Homo sapiens LP3428 mRNA, complete cds
          Length = 1269

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 84  ccccctgcccggccagccgccc 105
           ||||||||||||||||||||||
Sbjct: 312 ccccctgcccggccagccgccc 333



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 84  ccccctgcccggccagccgccctg 107
           ||||| ||||||||||||||||||
Sbjct: 488 ccccccgcccggccagccgccctg 511



to top

>gb|AC146176.2| Pan troglodytes BAC clone RP43-24N3 from 7, complete sequence
          Length = 138742

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 94410 ccccctgcccggccagccgccc 94431



to top

>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete
              sequence
          Length = 154563

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 125365 ccccctgcccggccagccgccc 125386



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 125673 ctgcccggccagccgccctg 125692



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 125545 ctgcccggccagccgccctg 125564



to top

>gb|AC090821.13| Homo sapiens chromosome 8, clone CTD-2309H9, complete sequence
          Length = 166843

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 33586 ccccctgcccggccagccgccc 33565



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 34035 ccccccgcccggccagccgccctg 34012



to top

>gb|AC090001.19| Homo sapiens 12 BAC RP11-536G4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 207366

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 153237 ccccctgcccggccagccgccc 153216



to top

>gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 88686

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 54411 ccccctgcccggccagccgccc 54432



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 14327 ccccctgcccggccagccgccc 14306



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 55099 ccccccgcccggccagccgccctg 55122



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 54874 ccccccgcccggccagccgccctg 54897



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 54825 ccccccgcccggccagccgccctg 54848



to top

>gb|AC090107.16| Homo sapiens 12 BAC RP11-643D8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 83755

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 59848 ccccctgcccggccagccgccc 59869



to top

>gb|AC091170.15| Homo sapiens chromosome 18, clone RP11-879D5, complete sequence
          Length = 198586

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42354 ccccctgcccggccagccgccc 42375



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42029 ccccctgcccggccagccgccc 42050



to top

>gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, complete sequence
          Length = 142265

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 31538 ccccctgcccggccagccgccc 31559



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             |||||||||||||||||| |||||
Sbjct: 31134 ccccctgcccggccagcctccctg 31157



to top

>gb|AC114801.4| Homo sapiens BAC clone RP11-777B9 from 4, complete sequence
          Length = 69745

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42484 ccccctgcccggccagccgccc 42463



to top

>gb|AC004912.2| Homo sapiens PAC clone RP5-871B15 from 7, complete sequence
          Length = 157321

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 157250 ccccctgcccggccagccgccc 157229



to top

>gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete sequence
          Length = 176929

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 115456 ccccctgcccggccagccgccc 115435



to top

>gb|AC006451.5| Homo sapiens PAC clone RP4-562A11 from 7, complete sequence
          Length = 145966

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 29737 ccccctgcccggccagccgccc 29716



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 5471 ccccctgcccggccagccgccc 5492



to top

>gb|AC104073.3| Homo sapiens BAC clone RP11-328P23 from 7, complete sequence
          Length = 178670

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 121710 ccccctgcccggccagccgccc 121731



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 121309 ccccctgcccggccagccgccc 121330



to top

>gb|AC073349.11| Homo sapiens BAC clone RP11-797H7 from 7, complete sequence
          Length = 140861

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 58166 ccccctgcccggccagccgccc 58145



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 33684 ccccctgcccggccagccgccc 33705



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 33636 ccccctgcccggccagccgccc 33657



 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 85     cccctgcccggccagccgccc 105
              |||||||||||||||||||||
Sbjct: 105055 cccctgcccggccagccgccc 105075



to top

>gb|AC093087.3| Homo sapiens BAC clone RP11-785H2 from 7, complete sequence
          Length = 123039

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 75524 ccccctgcccggccagccgccc 75545



to top

>gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complete sequence
          Length = 57554

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 51033 ccccctgcccggccagccgccc 51012



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 50982 ccccctgcccggccagccgccc 50961



to top

>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
              genomic sequence
          Length = 341361

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 134647 ccccctgcccggccagccgccc 134668



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 134520 ccccctgcccggccagccgccc 134541



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 134391 ccccctgcccggccagccgccc 134412



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 132248 ccccccgcccggccagccgccctg 132225



to top

>gb|AC144511.1| Pan troglodytes BAC clone RP43-45C15 from 7, complete sequence
          Length = 153510

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 92694 ccccctgcccggccagccgccc 92715



to top

>gb|AY388614.1| Homo sapiens polymerase (DNA directed), eta (POLH) gene, complete cds
          Length = 40997

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 5652 ccccctgcccggccagccgccc 5631



to top

>gb|DQ157758.1| Homo sapiens thioredoxin reductase 1 (TXNRD1) gene, complete cds
          Length = 66886

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 38439 ccccctgcccggccagccgccc 38418



to top

>gb|AC114934.2| Homo sapiens chromosome 5 clone CTD-2029K19, complete sequence
          Length = 114356

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 37117 ccccctgcccggccagccgccc 37096



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 36939 ccccctgcccggccagccgccc 36918



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 36888 ccccctgcccggccagccgccc 36867



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 36710 ccccctgcccggccagccgccc 36689



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 36532 ccccctgcccggccagccgccc 36511



to top

>gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, complete sequence
          Length = 161421

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 39099 ccccctgcccggccagccgccc 39078



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 39047 ccccctgcccggccagccgccc 39026



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 38689 ccccctgcccggccagccgccc 38668



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 39375 ccccccgcccggccagccgccctg 39352



to top

>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence
          Length = 198564

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 57582 ccccctgcccggccagccgccc 57561



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 58004 ccccccgcccggccagccgccctg 57981



to top

>gb|DQ070893.1| Homo sapiens AGR2 (AGR2) gene, complete cds, alternatively spliced
          Length = 62498

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 54626 ccccctgcccggccagccgccc 54647



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 54353 ccccctgcccggccagccgccc 54374



to top

>emb|AL731683.12| Human DNA sequence from clone XXbac-254C11 on chromosome 6, complete
             sequence
          Length = 83878

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 13823 ccccctgcccggccagccgccc 13802



to top

>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete
             sequence
          Length = 153012

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 97702 ccccctgcccggccagccgccc 97681



to top

>gb|AC018988.12| Homo sapiens chromosome 15, clone RP11-233C13, complete sequence
          Length = 116727

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 107981 ccccctgcccggccagccgccc 108002



to top

>emb|Z97985.16|HS341D10 Human DNA sequence from clone RP3-341D10 on chromosome X Contains a
             chondroitin beta 1,4 N-acetylgalactosaminyltransferase
             (ChGn) pseudogene, a novel gene similar to
             ADP-ribosylation factor-like 2 (ARL2), variant 1, a novel
             gene, the 3' end of a novel gene (FLJ12687) and a CpG
             island, complete sequence
          Length = 82517

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 31949 ccccctgcccggccagccgccc 31928



to top

>emb|AL929470.20| Human DNA sequence from clone RP11-72M14 on chromosome 1 Contains the
             5' end of the WNT2B gene for wingless-type MMTV
             integration site family, member 2B, the 5' end of the
             CAPZA1 gene for capping protein (actin filament) muscle
             Z-line, alpha 1 and a mitochondrial ribosomal protein L53
             (MRPL53) pseudogene, complete sequence
          Length = 34919

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 26038 ccccctgcccggccagccgccc 26059



to top

>emb|AL732431.19| Human DNA sequence from clone XXyac-36GH4 on chromosome 6 Contains the
             gene for acid sphingomyelinase-like phosphodiesterase 3a
             (ASML3A), an H+ transporting mitochondrial F0 complex ATP
             synthase subunit g (ATP5L) pseudogene and two CpG islands,
             complete sequence
          Length = 164746

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 62640 ccccctgcccggccagccgccc 62619



to top

>emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on chromosome 9, complete
             sequence
          Length = 100719

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 83915 ccccctgcccggccagccgccc 83936



to top

>emb|Z75746.1|HSU221F2 Human DNA sequence from clone LL0XNC01-221F2 on chromosome X Contains
            the NXF3 gene for nuclear RNA export factor 3 and a novel
            pseudogene, complete sequence
          Length = 37764

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7769 ccccctgcccggccagccgccc 7790



to top

>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete
             sequence
          Length = 117939

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 66365 ccccctgcccggccagccgccc 66344



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 66037 ccccctgcccggccagccgccc 66016



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 65810 ccccctgcccggccagccgccc 65789



to top

>emb|Z84489.1|HS93N13 Human DNA sequence from clone RP1-93N13 on chromosome 6p21 Contains
            the HLA-DRB1*03011 and HLA-DQA1*05011 genes for major
            histocompatibility complex class II DR beta 1 and DQ
            alpha 1, a CpG island, ESTs, STSs and GSSs, complete
            sequence
          Length = 86896

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 4483 ccccctgcccggccagccgccc 4504



to top

>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete
            sequence
          Length = 86882

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 8989 ccccctgcccggccagccgccc 9010



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 8743 ccccctgcccggccagccgccc 8764



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 88   ctgcccggccagccgccctg 107
            ||||||||||||||||||||
Sbjct: 9297 ctgcccggccagccgccctg 9316



to top

>emb|AL732374.14| Human DNA sequence from clone RP13-444K19 on chromosome X Contains a
              mitochondrial ribosomal protein S18C (MRPS18C) pseudogene,
              the 3' end of the gene for a novel protein similar to PHD
              finger protein 2 PHF2 and a CpG island, complete sequence
          Length = 224187

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 152943 ccccctgcccggccagccgccc 152964



to top

>emb|BX004807.10| Human DNA sequence from clone RP11-565D17 on chromosome 1 Contains the
             5' end of the ITGB3BP gene for integrin beta 3 binding
             protein (beta3-endonexin), the 5' end of a novel gene
             (KIAA1799) and a CpG island, complete sequence
          Length = 78203

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 24764 ccccctgcccggccagccgccc 24785



to top

>emb|AL935026.4| Human DNA sequence from clone DAQB-109B10 on chromosome 6 Contains the
             HLA-DQA1 gene for the major histocompatibility complex,
             class II, DQ alpha 1 protein, the HLA-DQB1 gene for major
             histocompatibility complex, class II, DQ beta 1 protein
             and one CpG island, complete sequence
          Length = 39179

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 16500 ccccctgcccggccagccgccc 16479



to top

>emb|AL662924.24| Human DNA sequence from clone RP11-108J9 on chromosome 1 Contains the
             3' end of the CLIC4 gene for chloride intracellular
             channel 4 and three CpG islands, complete sequence
          Length = 82931

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 49941 ccccctgcccggccagccgccc 49920



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 49415 ccccctgcccggccagccgccc 49394



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 49366 ccccctgcccggccagccgccc 49345



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 16434 ccccctgcccggccagccgccc 16455



to top

>emb|AL662789.11| Human DNA sequence from clone XXbac-254F23 on chromosome 6 contains
            the 5' end of the HLA-DRB1 gene for major
            histocompatibility complex, class II, DR beta 1, the
            HLA-DQA1 gene for major histocompatibility complex, class
            II, DQ alpha 1, the HLA-DQB1 gene for major
            histocompatibility complex, class II, DQ beta 1, a
            cytochrome C oxidase polypeptide III pseudogene, a major
            histocompatibility complex, class II, beta polypeptide
            pseudogene and two CpG islands, complete sequence
          Length = 147557

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7795 ccccctgcccggccagccgccc 7774



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7342 ccccctgcccggccagccgccc 7321



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7063 ccccctgcccggccagccgccc 7042



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 6705 ccccctgcccggccagccgccc 6684



to top

>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the
             5' end of the gene for alpha-catenin-like protein
             (MGC26194) (VR22), a aldo-keto reductase family 1, member
             B10 (aldose reductase) (AKR1B10) pseudogene and a CpG
             island, complete sequence
          Length = 121210

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 61183 ccccctgcccggccagccgccc 61204



to top

>emb|AL672220.6| Human DNA sequence from clone RP11-17C2 on chromosome 1 Contains a CpG
             island, complete sequence
          Length = 104417

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 15528 ccccctgcccggccagccgccc 15507



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 15397 ctgcccggccagccgccctg 15378



to top

>emb|AL645939.6| Human DNA sequence from clone XXbac-170G13 on chromosome 6 contains two
             P5-1 pseudogenes, the HLA-F gene for major
             histocompatibility complex, class I, F, a ribosomal
             protein L23A (RPL23A) pseudogene, a MHC class 1
             polypeptide-related sequence B (MICB) pseudogene, a HCGIX
             pseudogene, a interferon-induced transmembrane protein 3
             (IFITM3) pseudogene, a HLA (MHC class 1) pseudogene, a
             putative novel MHC class 1 (HLA) protein, a 60S ribosomal
             protein L7A (RPL7A) pseudogene and five CpG islands,
             complete sequence
          Length = 123768

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 16233 ccccctgcccggccagccgccc 16254



to top

>emb|AL603890.14| Human DNA sequence from clone RP11-584P2 on chromosome 1 Contains the
             3' end of a novel gene  similar to preferentially
             expressed antigen in melanoma (PRAME), two novel proteins
             similar to preferentially expressed antigen in melanoma
             (PRAME), a novel gene and a CpG island, complete sequence
          Length = 88806

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 32558 ccccctgcccggccagccgccc 32579



to top

>emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chromosome 1 Contains part
             of the CAMTA1 gene for calmodulin binding transcription
             activator 1, complete sequence
          Length = 107112

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 47413 ccccctgcccggccagccgccc 47392



to top

>emb|AL606491.19| Human DNA sequence from clone RP11-70P17 on chromosome 1 Contains the
             3' end of the gene for LDL receptor adaptor protein (ARH)
             and a novel gene, complete sequence
          Length = 49875

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42038 ccccctgcccggccagccgccc 42059



to top

>emb|AL606477.11| Human DNA sequence from clone RP11-190H11 on chromosome 1 Contains the
             5' end of the gene for HP1-BP74, the 3' end of the EIF4G3
             gene for  eukaryotic translation initiation factor 4
             gamma, 3 and three CpG islands, complete sequence
          Length = 139961

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 61232 ccccctgcccggccagccgccc 61253



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 60833 ccccctgcccggccagccgccc 60854



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 82    atccccctgcccggccagccgccc 105
             ||||| ||||||||||||||||||
Sbjct: 60957 atccctctgcccggccagccgccc 60980



to top

>emb|AL592046.7| Human DNA sequence from clone RP11-155O24 on chromosome X Contains part
             of the gene for upstream regulatory element binding
             protein 1 (UREB1) and a CpG island, complete sequence
          Length = 86196

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 43986 ccccctgcccggccagccgccc 44007



to top

>emb|AL590640.19| Human DNA sequence from clone RP11-40H20 on chromosome 1 Contains the
            5' end of the SLC9A1 gene for solute carrier family 9
            (sodium/hydrogen exchanger), isoform 1 (antiporter,
            Na+/H+, amiloride sensitive), a ribosomal protein L18a
            (RPL18A) pseudogene, a novel pseudogene (FLJ20420), a
            nucleophosmin (nucleolar phosphoprotein B23,
            numatrin)(NPM1) pseudogene, a mall nuclear
            ribonucleoprotein polypeptide E (SNRPE) pseudogene, a
            novel gene, the 5' end of a novel gene (KIAA1037) and a
            CpG island, complete sequence
          Length = 147052

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 9425 ccccctgcccggccagccgccc 9446



to top

>emb|AL591043.11| Human DNA sequence from clone RP11-357J22 on chromosome 1 Contains a
             proteolipid protein 2 (colonic epithelium-enriched) (PLP2)
             pseudogene, a mortality factor 4 (MORF4) pseudogene and a
             CPG island, complete sequence
          Length = 147109

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 93061 ccccctgcccggccagccgccc 93040



to top

>emb|AL589843.9| Human DNA sequence from clone RP11-535M15 on chromosome 9 Contains a
             novel gene, a makorin, ring finger protein, 2 (MKRN2)
             pseudogene, a novel gene (KIAA0972) and five CpG islands,
             complete sequence
          Length = 142527

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 47938 ccccctgcccggccagccgccc 47917



to top

>emb|AL512284.20| Human DNA sequence from clone RP11-248M22 on chromosome 10 Contains
             part of the gene for CamKI-like protein kinase (CKLiK)
             (LOC221042 LOC283070) and two CpG islands, complete
             sequence
          Length = 113920

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 72966 ccccctgcccggccagccgccc 72945



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 72567 ccccctgcccggccagccgccc 72546



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 82    atccccctgcccggccagccgccc 105
             ||||| ||||||||||||||||||
Sbjct: 72842 atccctctgcccggccagccgccc 72819



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 72743 ccccccgcccggccagccgccctg 72720



to top

>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains the
             3' end of a breast cancer antigen (NY-BR-1) pseudogene,
             the 3' end of a novel gene, a pseudogene similar to part
             of cubilin (intrinsic factor-cobalamin receptor, CUBN), a
             seven transmembrane helix receptor (FLJ31393) pseudogene,
             the OR13A1 gene for olfactory receptor family 13 subfamily
             A member 1 and two CpG islands, complete sequence
          Length = 168473

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 87151 ccccctgcccggccagccgccc 87172



to top

>emb|AL513044.13| Human DNA sequence from clone RP11-187D4 on chromosome 1 Contains a CpG
             island, complete sequence
          Length = 111901

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 86945 ccccctgcccggccagccgccc 86966



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 86818 ccccctgcccggccagccgccc 86839



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 86642 ccccctgcccggccagccgccc 86663



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 86367 ccccccgcccggccagccgccctg 86390



to top

>emb|AL513314.12| Human DNA sequence from clone RP11-358H9 on chromosome 1 Contains a
             novel gene, a capicua homolog (Drosophila) (CIC)
             pseudogene and a CpG island, complete sequence
          Length = 58205

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 48607 ccccctgcccggccagccgccc 48628



to top

>emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chromosome X Contains a
              heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3)
              pseudogene, a WW domain binding protein 11 (WBP11)
              pseudogene, a hexokinase 2 (HK2) pseudogene, a proteasome
              (prosome, macropain) subunit, alpha type, 1 (PSMA1)
              pseudogene, the 3' end of the gene for a novel WD repeat
              domain protein and three CpG islands, complete sequence
          Length = 223078

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 213920 ccccctgcccggccagccgccc 213941



to top

>emb|AL512449.6| Human DNA sequence from clone RP11-286E7 on chromosome 1 Contains part
             of the RPS6KC1 gene for ribosomal protein S6 kinase 52kDa
             polypeptide 1 and a CpG island, complete sequence
          Length = 176690

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 87741 ccccctgcccggccagccgccc 87720



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 86406 ccccctgcccggccagccgccc 86385



to top

>emb|AL450309.14| Human DNA sequence from clone RP11-478H16 on chromosome 1 Contains the 5'
              end of the ERO1LB gene for ERO1-like beta (S. cerevisiae),
              an  FK506 binding protein 3, 25kDa (FKBP3) pseudogene, the
              5' UTR of a variant of the EDARADD gene for EDAR-associated
              death domain and three CpG islands, complete sequence
          Length = 166647

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 160915 ccccctgcccggccagccgccc 160936



to top

>emb|AL445205.14| Human DNA sequence from clone RP11-24J23 on chromosome 1 Contains a novel
              gene (FLJ38972), the 3' end of the ROR1 gene for receptor
              tyrosine kinase-like orphan receptor 1, the 5' end of gene
              MGC35130 and a CpG island, complete sequence
          Length = 115936

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 106030 ccccctgcccggccagccgccc 106051



to top

>emb|AL442646.14| Human DNA sequence from clone RP11-322A17 on chromosome X Contains a
            novel pseudogene and a lactate dehydrogenase B
            pseudogene, complete sequence
          Length = 155885

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7485 ccccctgcccggccagccgccc 7464



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7336 ccccctgcccggccagccgccc 7315



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 6980 ccccctgcccggccagccgccc 6959



to top

>emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chromosome 1 Contains
            part of the MACF1 gene for microtubule-actin crosslinking
            factor 1, a novel gene, a heat shock 10kDa protein 1
            (chaperonin 10) (HSPE1) pseudogene and a CpG island,
            complete sequence
          Length = 121295

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 8328 ccccctgcccggccagccgccc 8307



to top

>emb|AL445427.23| Human DNA sequence from clone RP5-1091A7 on chromosome 1p22.2-31.1
             Contains the 5' end of the COL24A1 gene for collagen type
             XXIV alpha 1 and two CpG islands, complete sequence
          Length = 111132

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 69247 ccccctgcccggccagccgccc 69268



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 69118 ccccctgcccggccagccgccc 69139



to top

>emb|AL391809.21| Human DNA sequence from clone RP11-47A4 on chromosome 1 Contains the 5'
             end of the RYR2 gene for ryanodine receptor 2 (cardiac)
             and three CpG islands, complete sequence
          Length = 167548

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 87360 ccccctgcccggccagccgccc 87339



to top

>emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chromosome 1 Contains the 3'
              end of a novel gene and a CpG island, complete sequence
          Length = 159117

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 155177 ccccctgcccggccagccgccc 155198



to top

>emb|AL450332.19| Human DNA sequence from clone RP11-138M12 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 174678

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 14038 ccccctgcccggccagccgccc 14017



to top

>emb|AL392104.19| Human DNA sequence from clone RP11-324E23 on chromosome 10 Contains the
              3' end of a novel gene (DKFZp761L0424) (KIAA1217), the 3'
              end of the gene for Rho-GTPase activating protein 10
              (ARHGAP10) and a CpG island, complete sequence
          Length = 166643

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 114374 ccccctgcccggccagccgccc 114395



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 114196 ccccctgcccggccagccgccc 114217



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 113770 ccccccgcccggccagccgccctg 113793



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 82     atccccctgcccggccagccgccc 105
              ||||||| ||||||||||||||||
Sbjct: 113464 atccccccgcccggccagccgccc 113487



to top

>emb|AL392107.17| Human DNA sequence from clone RP11-114F7 on chromosome 10 Contains the
             3' end of the ABCC2 gene for ATP-binding cassette
             sub-family C (CFTR/MRP) member 2, gene KIAA1010 and two
             CpG islands, complete sequence
          Length = 95018

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 83548 ccccctgcccggccagccgccc 83569



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 83294 ccccctgcccggccagccgccc 83315



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 30451 ccccctgcccggccagccgccc 30430



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 29694 ccccctgcccggccagccgccc 29673



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 29467 ccccctgcccggccagccgccc 29446



to top

>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part
             of the CDK5RAP2 gene for CDK5 regulatory subunit
             associated protein 2 (C48) and a CpG island, complete
             sequence
          Length = 46372

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42796 ccccctgcccggccagccgccc 42817



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42696 ccccctgcccggccagccgccc 42717



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 42164 ccccccgcccggccagccgccctg 42187



to top

>emb|AL442123.12| Human DNA sequence from clone RP11-175O19 on chromosome 10 Contains
            the 3' end of the MLR2 gene for a novel protein (likely
            ortholog of mouse transcription factor MLR2), the gene
            for a novel protein novel protein
            (DKFZP564P1916)(FLJ13022), the 3' end of the SLIT1 gene
            for slit homolog 1 (Drosophila) and a CpG island,
            complete sequence
          Length = 96660

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 5867 ccccctgcccggccagccgccc 5846



to top

>emb|AL392088.12| Human DNA sequence from clone RP5-964H19 on chromosome 1 Contains the
             3' end of the gene for a novel protein similar to FLJ32883
             containing DUF1220 domains, a suppression of
             tumorigenicity 13 (colon carcinoma) (Hsp70 interacting
             protein) (ST13) pseudogene, a novel pseudogene and two CpG
             islands, complete sequence
          Length = 74877

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 24427 ccccctgcccggccagccgccc 24406



to top

>emb|AL445587.10| Human DNA sequence from clone RP11-429D3 on chromosome 9 Contains part of
              a novel gene (LOC158135) and a CpG island, complete
              sequence
          Length = 173062

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 121743 ccccctgcccggccagccgccc 121764



to top

>emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on chromosome 10 Contains
             part of the gene for VPS10 domain receptor protein SORCS 3
             (SORCS3), complete sequence
          Length = 149248

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 58874 ccccctgcccggccagccgccc 58853



to top

>emb|AL445465.10| Human DNA sequence from clone RP11-415D17 on chromosome 6 Contains two
             novel genes, part of a novel gene, a ubiquitin-conjugating
             enzyme E2 family pseudogene and a CpG island, complete
             sequence
          Length = 126388

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 89997 ccccctgcccggccagccgccc 89976



to top

>emb|AL392103.6| Human DNA sequence from clone RP11-477L16 on chromosome 10 Contains a
              pseudogene similar to part of nuclease sensitive element
              binding protein 1 (NSEP1, part of the gene for SEC15 (S.
              cerevisiae)-like (SEC15L), and one CpG island, complete
              sequence
          Length = 125087

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 123059 ccccctgcccggccagccgccc 123080



to top

>emb|AL365179.30| Human DNA sequence from clone RP13-34C21 on chromosome Xq24-25 Contains
             a chromobox homolog 1 (HP1 beta homolog Drosophila) (CBX1)
             pseudogene and a CpG island, complete sequence
          Length = 180851

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 44376 ccccctgcccggccagccgccc 44397



to top

>emb|AL365182.27| Human DNA sequence from clone RP11-560O15 on chromosome 1 Contains a
             protein phosphatase 1, regulatory (inhibitor) subunit 11
             (PPP1R11) pseudogene and a CpG island, complete sequence
          Length = 56883

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34779 ccccctgcccggccagccgccc 34800



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34557 ccccctgcccggccagccgccc 34578



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34430 ccccctgcccggccagccgccc 34451



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34209 ccccctgcccggccagccgccc 34230



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34082 ccccctgcccggccagccgccc 34103



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 33906 ccccccgcccggccagccgccctg 33929



to top

>emb|AL390729.23| Human DNA sequence from clone RP3-522D1 on chromosome 1 Contains the 5'
             end of a novel gene, a novel gene, a ribosomal protein L39
             (RPL39) pseudogene and a CpG island, complete sequence
          Length = 69656

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 58487 ccccctgcccggccagccgccc 58466



to top

>emb|AL390715.23| Human DNA sequence from clone RP11-167O6 on chromosome 10 Contains the
              ARHGAP12 gene for Rho GTPase activating protein 12 and two
              CpG islands, complete sequence
          Length = 189161

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 182747 ccccctgcccggccagccgccc 182768



to top

>emb|AL390879.20| Human DNA sequence from clone RP11-308D16 on chromosome Xq25-27.1
             Contains the 3' end of a novel gene, a serine/arginine
             repetitive matrix 1 (SRRM1) pseudogene (LOC347480), the
             GPR101 gene for G protein-coupled receptor 101 and four
             CpG islands, complete sequence
          Length = 172280

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 80451 ccccctgcccggccagccgccc 80430



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 80175 ccccctgcccggccagccgccc 80154



to top

>emb|AL360169.17| Human DNA sequence from clone RP11-732M18 on chromosome 6 Contains the 5'
              end of the gene for tubby super-family protein (TUSP,
              KIAA1397), a novel gene, part of a novel gene and two CpG
              islands, complete sequence
          Length = 180635

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 168062 ccccctgcccggccagccgccc 168083



to top

>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six
              novel genes similar to preferentially expressed antigen in
              melanoma (PRAME), two novel genes, two preferentially
              expressed antigen in melanoma (PRAME) pseudogenes and a CpG
              island, complete sequence
          Length = 184591

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 122564 ccccctgcccggccagccgccc 122543



to top

>emb|AL365190.16| Human DNA sequence from clone RP11-512H14 on chromosome 9 Contains the
             5' end of the TLE1 gene for transducin-like enhancer of
             split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1), the 5'
             end of a novel gene and two CpG isalnds, complete sequence
          Length = 89468

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 84865 ccccctgcccggccagccgccc 84886



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 84765 ccccccgcccggccagccgccctg 84788



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 84539 ccccccgcccggccagccgccctg 84562



to top

>emb|AL391379.12| Human DNA sequence from clone RP13-171J5 on chromosome X Contains a CpG
             island, complete sequence
          Length = 116800

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 34391 ccccctgcccggccagccgccc 34370



to top

>emb|AL356968.41| Human DNA sequence from clone RP11-329A14 on chromosome 1 Contains the
             5' end of the SPATA6 gene for spermatogenesis associated
             6, an amyotrophic lateral sclerosis 2 (juvenile)
             chromosome region, candidate 2 (ALS2CR2) pseudogene, a
             ribosomal protein L21 (RPL21) pseudogene and a CpG island,
             complete sequence
          Length = 173373

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 56548 ccccctgcccggccagccgccc 56527



to top

>emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on chromosome 10 Contains the
             5' end of the MMS19L gene for MMS19-like (MET18 homolog,
             S. cerevisiae), the gene for a novel protein (FLJ11807),
             the 5' end of the ANKRD2 gene for ankyrin repeat domain 2
             (stretch responsive muscle) and two CpG islands, complete
             sequence
          Length = 86299

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 41599 ccccctgcccggccagccgccc 41578



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 41375 ccccctgcccggccagccgccc 41354



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 41472 ccccccgcccggccagccgccctg 41449



to top

>emb|AL359385.28| Human DNA sequence from clone RP11-375N9 on chromosome 10 Contains the
             gene for a novel protein (MGC14258), a CD164 antigen,
             sialomucin (CD164) pseudogene and two CpG islands,
             complete sequence
          Length = 99408

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 76127 ccccctgcccggccagccgccc 76148



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 75848 ccccccgcccggccagccgccctg 75871



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 75627 ccccccgcccggccagccgccctg 75650



to top

>emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chromosome 6 Contains the
              CDYL gene for a Y chromosome-like chromodomain protein, a
              ribosomal protein S18 (RPS18) pseudogene, the gene for
              ribonuclease P 40kD subunit (RPP40) and CpG islands,
              complete sequence
          Length = 166863

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 143806 ccccctgcccggccagccgccc 143785



to top

>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the
             5' end of the MAPKAP1 gene for mitogen-activated protein
             kinase associated protein 1, a novel gene, the 5' end of
             the PBX3 gene for pre-B-cell leukemia transcription factor
             3 and three CpG islands, complete sequence
          Length = 109081

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 98477 ccccctgcccggccagccgccc 98456



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 99187 ccccccgcccggccagccgccctg 99164



to top

>emb|AL357125.22| Human DNA sequence from clone RP11-293D12 on chromosome 10 Contains
             part of the EGR2 gene for early growth response 2 (Krox-20
             homolog, Drosophila), complete sequence
          Length = 116948

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 84050 ccccctgcccggccagccgccc 84071



to top

>emb|AL358072.21| Human DNA sequence from clone RP11-188D8 on chromosome 1 Contains the
             5' end of the MAN1A2 gene for mannosidase alpha class 1A
             member 2 and two CpG islands, complete sequence
          Length = 129725

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 70698 ccccctgcccggccagccgccc 70677



to top

>emb|AL356970.21| Human DNA sequence from clone RP11-465E14 on chromosome 6, complete
             sequence
          Length = 53086

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 19347 ccccctgcccggccagccgccc 19326



to top

>emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chromosome 6 Contains a
             novel gene and a CpG island, complete sequence
          Length = 140630

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 33666 ccccctgcccggccagccgccc 33645



to top

>emb|AL357055.18| Human DNA sequence from clone RP11-389O22 on chromosome 1 Contains the
             3' end of a novel gene, the 5' end of a novel gene, the
             LRIG2 gene for leucine-rich repeats and
             immunoglobulin-like domains 2, a ring finger protein 12
             (RNF12) pseudogene, a ribosomal protein S19 (RPS19)
             pseudogene, a ribosomal protein S15 (RPS15) pseudogene and
             a CpG island, complete sequence
          Length = 188812

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42914 ccccctgcccggccagccgccc 42935



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 42724 ccccctgcccggccagccgccc 42745



to top

>gb|AC021028.12| Homo sapiens chromosome 10 clone RP11-137H2, complete sequence
          Length = 161803

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 127962 ccccctgcccggccagccgccc 127983



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 127238 ccccccgcccggccagccgccctg 127261



to top

>gb|AC116533.11| Homo sapiens chromosome 11, clone RP11-466H18, complete sequence
          Length = 189143

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 105590 ccccctgcccggccagccgccc 105611



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 105461 ccccctgcccggccagccgccc 105482



to top

>emb|AL355855.23| Human DNA sequence from clone RP11-302L10 on chromosome 6 Contains the
             5' end of the NUDT3 gene for nudix (nucleoside diphosphate
             linked moiety X)-type motif 3 and CpG islands, complete
             sequence
          Length = 29442

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12964 ccccctgcccggccagccgccc 12985



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12913 ccccctgcccggccagccgccc 12934



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 12737 ccccccgcccggccagccgccctg 12760



to top

>emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on chromosome 1 Contains the 5'
              end of the gene for GPP34-related protein (GPP34R), the
              gene for a novel protein (DKFZp434A1315), the CTSS gene for
              cathepsin S, a pseudogene similar to part of short
              coiled-coil protein (SCOC) and the 3' end of the CTSK gene
              for cathepsin K (pycnodysostosis), complete sequence
          Length = 154068

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 134576 ccccctgcccggccagccgccc 134597



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 81742 ccccccgcccggccagccgccctg 81719



to top

>emb|AL356652.19| Human DNA sequence from clone RP11-42O4 on chromosome 20 Contains part
             of the gene for a novel glycosyl hydrolase family 47
             protein and the PROCR gene for endothelial protein C
             receptor (EPCR), complete sequence
          Length = 50217

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 14272 ccccctgcccggccagccgccc 14293



to top

>emb|AL355861.19| Human DNA sequence from clone RP11-567J24 on chromosome 10 Contains the
              5' end of a novel gene, the PRDX3 gene for peroxiredoxin 3
              (AOP1, MER5, AOP-1, SP-22), the 5' end of the GPRK5 gene
              for G protein-coupled receptor kinase 5 (GRK5), a novel
              gene and four CpG islands, complete sequence
          Length = 168528

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 101963 ccccctgcccggccagccgccc 101942



to top

>emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chromosome 13 Contains the
             KATNAL1 gene for katanin p60 subunit A-like 1, a
             peroxiredoxin 2 (PRDX2) pseudogene, two novel genes and
             two CpG islands, complete sequence
          Length = 182303

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 71430 ccccctgcccggccagccgccc 71451



to top

>emb|AL355535.14| Human DNA sequence from clone RP11-494N1 on chromosome 9 Contains the 5'
              end of the GNA14 gene for guanine nucleotide binding
              protein (G protein) alpha 14, the 3' end of the GNAQ gene
              for guanine nucleotide binding protein (G protein) q
              polypeptide and two CpG islands, complete sequence
          Length = 186658

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 176476 ccccctgcccggccagccgccc 176497



to top

>emb|AL355802.13| Human DNA sequence from clone RP3-337H4 on chromosome 6 Contains the 3'
             part of a novel gene, three novel genes, the gene for RNA
             polymerase I 40 kDa subunit (RPA40) (RPA39), the gene for
             exportin 5 (KIAA1291) (XPO5), a 40S ribosomal protein S2
             (RPS2) pseudogene, the 5' part of the POLH gene for DNA
             directed polymerase eta and four CpG islands, complete
             sequence
          Length = 105935

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 93421 ccccctgcccggccagccgccc 93400



to top

>emb|AL354989.13| Human DNA sequence from clone RP11-537H15 on chromosome 9 Contains the 5'
              end of a novel gene (KIAA1491, FLJ22435 FLJ21704,
              FLJ22148), two novel genes (including DKFZP434O125
              (KIAA1892, FLJ20347)), a tubulin beta pseudogene, an IMP
              (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene
              and four CpG islands, complete sequence
          Length = 151990

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 150023 ccccctgcccggccagccgccc 150044



to top

>emb|AL355305.9| Human DNA sequence from clone RP11-487F23 on chromosome 6 Contains the
             5' end of the gene for p53 regulated PA26 nuclear protein
             (PA26-T1), a novel gene and part of a novel gene, complete
             sequence
          Length = 185257

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 11307 ccccctgcccggccagccgccc 11328



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 11180 ccccctgcccggccagccgccc 11201



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 10829 ccccctgcccggccagccgccc 10850



to top

>emb|AL354808.24| Human DNA sequence from clone RP11-523H24 on chromosome 13 Contains the
              3' end of a novel gene, the gene for paraspeckle protein 1
              (PSP1) (FLJ10955), two novel genes, a  sialyltransferase 7D
              (SIAT7D) pseudogene, the 3' end of a variant of the ZNF237
              gene for zinc finger protein 237 and two CpG islands,
              complete sequence
          Length = 169303

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 114924 ccccctgcccggccagccgccc 114945



to top

>emb|AL354707.17| Human DNA sequence from clone RP11-390F4 on chromosome 9 Contains the 5'
              end of a ring finger protein 2 (RNF2) pseudogene, the 3'
              end of a novel gene, a 60S ribosomal protein L35a (RPL35A)
              pseudogene, three novel genes, a gene similar to small
              nuclear ribonucleoprotein polypeptide E (SNRPE), the 5' end
              of the JMJD2C gene for jumonji domain containing 2C, a
              chromosome 20 open reading frame 45 (C20orf45) pseudogene
              and six CpG islands, complete sequence
          Length = 170970

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 140313 ccccctgcccggccagccgccc 140334



to top

>emb|AL353700.14| Human DNA sequence from clone RP3-350J21 on chromosome 6 Contains part
             of the DNAH8 gene for dynein axonemal heavy polypeptide 8
             and the 5' part of a novel gene, complete sequence
          Length = 56509

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 17900 ccccctgcccggccagccgccc 17879



to top

>emb|AL162498.12| Human DNA sequence from clone RP11-315A9 on chromosome 13 Contains a
            CpG island, complete sequence
          Length = 24565

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 1811 ccccctgcccggccagccgccc 1790



to top

>emb|AL354798.13| Human DNA sequence from clone RP11-756A22 on chromosome 13 Contains the
              3' end of a novel gene, the CENJP gene for centromere
              protein J (LAP, CPAP, LIP1, BM032), 2 novel genes, a
              pseudogene similar to part of solute carrier family 25
              (mitochondrial carrier; ornithine transporter) member 15
              (SLC25A15), a TPTE and PTEN homologous inositol lipid
              phosphatase (TPIP) pseudogene, a 60S ribisomal protein L34
              (RPL34) pseudogene and 2 CpG islands, complete sequence
          Length = 167319

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 132062 ccccctgcccggccagccgccc 132041



to top

>emb|AL162584.9| Human DNA sequence from clone RP11-12A16 on chromosome 9 Contains part of
              the MAPKAP1 gene for mitogen-activated protein kinase
              associated protein 1, a novel gene, a heterogeneous nuclear
              ribonucleoprotein A1 (HNRP1) pseudogene and two CpG
              islands, complete sequence
          Length = 160178

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 101220 ccccctgcccggccagccgccc 101241



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 100763 ccccccgcccggccagccgccctg 100786



to top

>emb|AL161652.25| Human DNA sequence from clone RP11-543N17 on chromosome 10 Contains the
             3' end of a novel gene (FLJ20445) and a MAP/microtubule
             affinity-regulating kinase 2 (MARK2) pseudogene, complete
             sequence
          Length = 156949

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 82254 ccccctgcccggccagccgccc 82275



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 81639 ccccctgcccggccagccgccc 81660



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 81279 ccccctgcccggccagccgccc 81300



 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    cccctgcccggccagccgccc 105
             |||||||||||||||||||||
Sbjct: 82044 cccctgcccggccagccgccc 82064



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 80953 ccccccgcccggccagccgccctg 80976



to top

>emb|AL158209.23| Human DNA sequence from clone RP11-275N1 on chromosome 10 Contains a
             novel gene and a pseudogene similar to part of FLJ10581,
             complete sequence
          Length = 132327

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 92312 ccccctgcccggccagccgccc 92333



to top

>emb|AL160260.22| Human DNA sequence from clone RP11-519H8 on chromosome 6 Contains a CpG
             island, complete sequence
          Length = 75778

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12814 ccccctgcccggccagccgccc 12793



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 12493 ccccctgcccggccagccgccc 12472



to top

>emb|AL162389.21| Human DNA sequence from clone RP11-380I20 on chromosome 9 Contains a
             small EDRK-rich factor 2 (SERF2) pseudogene, a ribosomal
             protein L36a pseudogene 6 (RPL36AP6) and two CpG islands,
             complete sequence
          Length = 157017

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 64288 ccccctgcccggccagccgccc 64309



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 64110 ccccctgcccggccagccgccc 64131



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 63932 ccccctgcccggccagccgccc 63953



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 63881 ccccctgcccggccagccgccc 63902



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 63703 ccccctgcccggccagccgccc 63724



to top

>emb|AL161656.20| Human DNA sequence from clone RP11-12M19 on chromosome 20 Contains
            the C20orf81 gene, the VSP16 gene for vacuolar protein
            sorting 16 (yeast), the 5' end of the PTPRA gene for
            protein tyrosine phosphatase receptor type A and four CpG
            islands, complete sequence
          Length = 103370

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 5165 ccccctgcccggccagccgccc 5186



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 88   ctgcccggccagccgccctg 107
            ||||||||||||||||||||
Sbjct: 5648 ctgcccggccagccgccctg 5667



to top

>emb|AL161941.18| Human DNA sequence from clone RP11-494B22 on chromosome 20 Contains the
             PPIP11 gene for peptidylprolyl isomerase (cyclophilin)
             pseudogene 11 and a CpG island, complete sequence
          Length = 81304

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 66757 ccccctgcccggccagccgccc 66736



to top

>emb|AL160157.17| Human DNA sequence from clone RP11-547C18 on chromosome 13 Contains the
             5' end of the GUCY1B2 gene for guanylate cyclase 1 soluble
             beta 2 and part of a novel gene, complete sequence
          Length = 127227

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 78470 ccccctgcccggccagccgccc 78491



to top

>emb|AL161802.15| Human DNA sequence from clone RP11-96L6 on chromosome 20 Contains the
             5' part of the KIAA0980 gene ESTs, STSs, GSSs and two CpG
             islands, complete sequence
          Length = 57115

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 25609 ccccctgcccggccagccgccc 25630



to top

>emb|AL160032.14| Human DNA sequence from clone RP11-474L7 on chromosome 13 Contains the
             3' end of the KLF12 gene for Kruppel-like factor 12, a
             novel gene and the 5' end of a novel gene and a CpG
             island, complete sequence
          Length = 181324

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 48111 ccccctgcccggccagccgccc 48132



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 48011 ccccctgcccggccagccgccc 48032



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 48060 ccccccgcccggccagccgccctg 48083



to top

>emb|AL161716.14| Human DNA sequence from clone RP11-266E6 on chromosome 13 Contains the
             3' end of a novel gene, a guanidinoacetate
             N-methyltransferase (GAMT) pseudogene and a CpG island,
             complete sequence
          Length = 164345

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 18481 ccccctgcccggccagccgccc 18502



to top

>emb|AL162416.13| Human DNA sequence from clone RP11-296H15 on chromosome 9 Contains the
             3' end of the TMC1 gene for transmembrane
             cochlear-expressed 1 and three CpG islands, complete
             sequence
          Length = 75609

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 45181 ccccctgcccggccagccgccc 45160



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 10926 ccccctgcccggccagccgccc 10905



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 55756 ccccccgcccggccagccgccctg 55733



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 45537 ccccccgcccggccagccgccctg 45514



to top

>emb|AL158014.20| Human DNA sequence from clone RP11-88I10 on chromosome 10q25.2-26.2
             Contains the 5' end of a novel gene, the 5' end of the
             SAC2 gene for Sac domain-containing inositol phosphatase 2
             and three CpG islands, complete sequence
          Length = 114244

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 38491 ccccctgcccggccagccgccc 38512



 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    cccctgcccggccagccgccc 105
             |||||||||||||||||||||
Sbjct: 38443 cccctgcccggccagccgccc 38463



to top

>emb|AL158206.8| Human DNA sequence from clone RP11-363E7 on chromosome 9 Contains
           the 3' end of a novel gene, possible ortholog of mouse
           cancer related gene-liver 1 (CRG-L1), a
           tmicortubule-associated protein pseudogene, the 3' end
           of the SLC24A2 gene for solute carrier family 24
           (sodium/potassium/calcium exchanger) member 2 (NCKX2)
           and 2 CpG islands, complete sequence
          Length = 163542

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 84  ccccctgcccggccagccgccc 105
           ||||||||||||||||||||||
Sbjct: 830 ccccctgcccggccagccgccc 809



to top

>emb|AL139811.30| Human DNA sequence from clone RP11-75A9 on chromosome Xp11.23-11.4
             Contains a catenin, beta like 1 (NAP, P14L, C20orf33,
             FLJ21108, NYD-SP19) (CTNNBL1) pseudogene, a
             glyceraldehyde-3-phosphate dehydrogenase (G3PD, GAPDH)
             (GAPD) pseudogene, a transmembrane protein vezatin
             pseudogene, a novel gene (FLJ20344) and two CpG islands,
             complete sequence
          Length = 141469

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 57033 ccccctgcccggccagccgccc 57012



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 56632 ccccctgcccggccagccgccc 56611



to top

>gb|AC104010.21| Homo sapiens chromosome 11, clone RP11-244C20, complete sequence
          Length = 63480

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 28678 ccccctgcccggccagccgccc 28657



to top

>gb|AC099558.2| Homo sapiens chromosome 3 clone RP11-680P23, complete sequence
          Length = 180049

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 107142 ccccctgcccggccagccgccc 107163



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 106913 ccccccgcccggccagccgccctg 106936



to top

>emb|AL139326.15| Human DNA sequence from clone RP11-351K3 on chromosome 13 Contains the
             3' end of the COG3 gene for component of oligomeric golgi
             complex 3, a novel gene (FLJ32682),a translocase of inner
             mitochondrial membrane 9 homolog (yeast) (TIMM9)
             pseudogene and a CpG island, complete sequence
          Length = 175588

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 17986 ccccctgcccggccagccgccc 17965



to top

>emb|AL138921.14| Human DNA sequence from clone RP11-316M21 on chromosome 10 Contains
            the 3' end of gene FLJ30135, the CHUK gene for conserved
            helix-loop ubiquitous kinase, a novel gene (FLJ32012), a
            novel gene containing FLJ10998, FLJ40576, FLJ3922,
            FLJ30751, a prohibitin (PHB) pseudogene, a tropomyosin
            (TPM4) pseudogene and three CpG islands, complete
            sequence
          Length = 194916

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7859 ccccctgcccggccagccgccc 7880



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7680 ccccctgcccggccagccgccc 7701



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 7655 ccccctgcccggccagccgccc 7676



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 192077 ctgcccggccagccgccctg 192096



to top

>emb|AL157777.5| Human DNA sequence from clone RP11-76H14 on chromosome 6 Contains the
              HTR1E gene for 5-hydroxytryptamine (serotonin) receptor, a
              pseudogene similar to the  5' end of ST13 (suppression of
              tumorigenicity 13, a Hsp70-interacting protein), a
              pseudogene similar to the 5' end of a Tec protein-tyrosine
              kinase, a pseudogene similar to 60S ribosomal protein L7,a
              pseudogene similar to the bifunctional
              methylenetetrahydrofolate dehydrogenase/cyclohydrolase
              mitochondria and two CpG islands, complete sequence
          Length = 169669

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 140335 ccccctgcccggccagccgccc 140314



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ctgcccggccagccgccctg 107
              ||||||||||||||||||||
Sbjct: 140290 ctgcccggccagccgccctg 140271



to top

>emb|AL138744.41| Human DNA sequence from clone RP13-257M1 on chromosome Xp11.23-11.4
             Contains part of the UTX gene for ubiquitously transcribed
             tetratricopeptide repeat gene X chromosome and a CpG
             island, complete sequence
          Length = 143968

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 98809 ccccctgcccggccagccgccc 98788



to top

>emb|AL135907.21| Human DNA sequence from clone RP1-257C19 on chromosome 6 Contains the
             3' end of the gene for hypothetical protein FLJ14917
             (contains FLJ13594), complete sequence
          Length = 45627

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 27727 ccccctgcccggccagccgccc 27748



to top

>emb|AL137852.15| Human DNA sequence from clone RP11-131A5 on chromosome 9q32-34.11
             Contains the RAD23B gene for RA23B homolog B (S.
             cerevisiae) and three CpG islands, complete sequence
          Length = 162509

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 18091 ccccctgcccggccagccgccc 18070



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    ctgcccggccagccgccctg 107
             ||||||||||||||||||||
Sbjct: 33215 ctgcccggccagccgccctg 33234



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 18369 ccccccgcccggccagccgccctg 18346



to top

>gb|AC087442.13| Homo sapiens chromosome 11, clone RP11-495O11, complete sequence
          Length = 200269

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 163318 ccccctgcccggccagccgccc 163297



to top

>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the
             3' end of the TACC2 gene for transforming, acidic
             coiled-coil containing protein 2 (AZU-1), the gene for a
             novel protein (FLJ25359) and two CpG islands, complete
             sequence
          Length = 213861

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 45411 ccccctgcccggccagccgccc 45390



to top

>emb|AL135787.13| Human DNA sequence from clone RP11-16L21 on chromosome 9 Contains the
             3' end of a variant of the gene for  KIAA1962 protein
             similar to zinc finger protein HIT-10, the LTB4DH gene for
             leukotriene B4 12-hydroxydehydrogenase (MGC34943), the
             gene for KIAA0563-related gene (LOC286331), the GNG10 gene
             for guanine nucleotide binding protein (G protein), gamma
             10, a novel gene, the 3' end of a novel gene and six CpG
             islands, complete sequence
          Length = 161448

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 84861 ccccctgcccggccagccgccc 84882



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    ccccctgcccggccagccgccctg 107
             ||||| ||||||||||||||||||
Sbjct: 84228 ccccccgcccggccagccgccctg 84251



to top

>emb|AL138728.12| Human DNA sequence from clone RP1-153N22 on chromosome 6q21-22.1
            Contains a CpG island, complete sequence
          Length = 26999

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 84   ccccctgcccggccagccgccc 105
            ||||||||||||||||||||||
Sbjct: 9772 ccccctgcccggccagccgccc 9751



to top

>gb|AC011401.9| Homo sapiens chromosome 5 clone CTB-35K5, complete sequence
          Length = 199275

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 84     ccccctgcccggccagccgccc 105
              ||||||||||||||||||||||
Sbjct: 135630 ccccctgcccggccagccgccc 135651



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ccccctgcccggccagccgccctg 107
              ||||| ||||||||||||||||||
Sbjct: 135405 ccccccgcccggccagccgccctg 135428



to top

>gb|AC048348.25| Homo sapiens 3 BAC RP11-457E6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 100869

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 51535 ccccctgcccggccagccgccc 51514



to top

>emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chromosome 1q25.1-31.1
             Contains the 3' end of the RGSL1 gene for regulator of
             G-protein signalling like 1, the RNASEL gene for
             ribonuclease L (2',5'-oligoisoadenylate
             synthetase-dependent) and a CpG island, complete sequence
          Length = 100549

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 84    ccccctgcccggccagccgccc 105
             ||||||||||||||||||||||
Sbjct: 15900 ccccctgcccggccagccgccc 15879


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,357,941
Number of Sequences: 3902068
Number of extensions: 2357941
Number of successful extensions: 59913
Number of sequences better than 10.0: 897
Number of HSP's better than 10.0 without gapping: 897
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50207
Number of HSP's gapped (non-prelim): 9706
length of query: 271
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 249
effective length of database: 17,147,199,772
effective search space: 4269652743228
effective search space used: 4269652743228
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top