Clone Name | bastl31b08 |
---|---|
Clone Library Name | barley_pub |
>gb|AC125517.4| Mus musculus BAC clone RP24-261P6 from chromosome 3, complete sequence Length = 193517 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 atactgagccagtgagctcca 41 ||||||||||||||||||||| Sbjct: 141447 atactgagccagtgagctcca 141427
>gb|AC117200.3| Mus musculus BAC clone RP23-164N7 from 3, complete sequence Length = 220758 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 197 gtgcctgatgaggtagttgggggcagcca 225 |||||||||||||| ||| |||||||||| Sbjct: 126096 gtgcctgatgaggtggttaggggcagcca 126068
>emb|AL590011.5| Human DNA sequence from clone RP11-88K15 on chromosome 6 Contains part of the RAB3IP2 gene for RAB3 interacting protein 2 and one CpG island, complete sequence Length = 154979 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 154 atttgctagcctgttcttgagattt 178 ||||||||||||||| ||||||||| Sbjct: 39296 atttgctagcctgtttttgagattt 39320
>emb|AL645630.9| Mouse DNA sequence from clone RP23-8C1 on chromosome 11, complete sequence Length = 167898 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 197 gtgcctgatgaggtagttgggggcagcca 225 |||||||||||||| ||| |||||||||| Sbjct: 118118 gtgcctgatgaggtggttaggggcagcca 118090
>gb|AC095996.9| Rattus norvegicus 18 BAC CH230-13K4 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 54068 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 ttgggggcagccaaggaagc 232 |||||||||||||||||||| Sbjct: 4582 ttgggggcagccaaggaagc 4601
>gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's Hospital Oakland Research Institute) complete sequence Length = 204000 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 cccctcgtgctcctcccagtctgt 338 |||||||| ||||||||||||||| Sbjct: 194966 cccctcgttctcctcccagtctgt 194943
>emb|AL590666.8| Human DNA sequence from clone RP11-66D17 on chromosome 1 Contains the 3' end of the SH2D2A gene for SH2 domain protein 2A, the PRCC gene for papillary renal cell carcinoma (translocation-associated), the HDGF gene for hepatoma-derived growth factor (high-mobility group protein 1-like), the MRPL24 gene for mitochondrial ribosomal protein L24, the gene for CGI-41 protein (CGI-41), a novel gene (FLJ12671), a novel gene, the CRABP2 gene for cellular retinoic acid binding protein 2, a novel gene, the gene for NES nestin, the 5' end of a novel gene, the 3' end of the BCAN gene for brevican and 5 CpG islands, complete sequence Length = 160597 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 ctcctcccagtctgtggtcc 343 |||||||||||||||||||| Sbjct: 58439 ctcctcccagtctgtggtcc 58420
>emb|AL358092.26| Human DNA sequence from clone RP11-336A2 on chromosome 10, complete sequence Length = 103816 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 306 tccttcaggcccctcgtgctcctc 329 ||||||||||||||| |||||||| Sbjct: 10710 tccttcaggcccctcctgctcctc 10687
>gb|AC022706.7| Homo sapiens chromosome , clone RP11-47L3, complete sequence Length = 162474 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 ctcctccccagctcgccccg 63 |||||||||||||||||||| Sbjct: 71011 ctcctccccagctcgccccg 70992
>gb|AC027004.15| Homo sapiens chromosome 15, clone RP11-143C19, complete sequence Length = 181804 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 gcctgttcttgagatttctc 181 |||||||||||||||||||| Sbjct: 27769 gcctgttcttgagatttctc 27750
>gb|AC022916.11| Homo sapiens chromosome 17, clone RP11-799D4, complete sequence Length = 215786 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 ctcctccccagctcgccccg 63 |||||||||||||||||||| Sbjct: 210380 ctcctccccagctcgccccg 210361
>emb|AL049874.3|CNS0000Q Human chromosome 14 DNA sequence BAC R-1042B17 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 193047 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 tgagccagtgagctccacac 44 |||||||||||||||||||| Sbjct: 7496 tgagccagtgagctccacac 7515
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 cgcgggcgcgcgtgcgcggc 113 |||||||||||||||||||| Sbjct: 1952829 cgcgggcgcgcgtgcgcggc 1952848
>gb|AF007568.1|AF007568 Erwinia stewartii plasmid pSW1200 replication initiator protein (repA) gene, complete cds Length = 3687 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 gttcttgagatttctccgct 185 |||||||||||||||||||| Sbjct: 1079 gttcttgagatttctccgct 1098 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,967,442 Number of Sequences: 3902068 Number of extensions: 2967442 Number of successful extensions: 62721 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62607 Number of HSP's gapped (non-prelim): 114 length of query: 431 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 409 effective length of database: 17,147,199,772 effective search space: 7013204706748 effective search space used: 7013204706748 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)