ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl30g10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_592352.2| PREDICTED: Bos taurus hypothetical LOC514490 (L... 46 0.078
2gb|AC163614.4| Mus musculus BAC clone RP23-102K8 from chromosome... 42 1.2
3gb|AC161420.6| Mus musculus BAC clone RP24-358O9 from chromosome... 42 1.2
4gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 4.8
5gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete g... 40 4.8
6ref|XM_361577.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 4.8
7ref|XM_369638.1| Magnaporthe grisea 70-15 chromosome III hypothe... 40 4.8
8ref|XM_500054.1| Yarrowia lipolytica CLIB122, YALI0A14322g predi... 40 4.8
9ref|XM_505509.1| Yarrowia lipolytica CLIB122, YALI0F16819g predi... 40 4.8
10emb|AL109615.42|HS1120P11 Human DNA sequence from clone RP5-1120... 40 4.8
11emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete ... 40 4.8
12gb|AF326398.1|AF326398 Pseudomonas sp. ADP Mn(II)-oxidation-asso... 40 4.8
13emb|CR391398.1| Gallus gallus finished cDNA, clone ChEST652p12 40 4.8
14dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 4.8
15gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 4.8
16emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 4.8
17emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 40 4.8

>ref|XM_592352.2| PREDICTED: Bos taurus hypothetical LOC514490 (LOC514490), mRNA
          Length = 3224

 Score = 46.1 bits (23), Expect = 0.078
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 171 gcagccccacggccggcggcagc 193
           |||||||||||||||||||||||
Sbjct: 444 gcagccccacggccggcggcagc 422



to top

>gb|AC163614.4| Mus musculus BAC clone RP23-102K8 from chromosome 1, complete sequence
          Length = 201646

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 62    ggtttggggttccgatctggt 82
             |||||||||||||||||||||
Sbjct: 58039 ggtttggggttccgatctggt 58019



to top

>gb|AC161420.6| Mus musculus BAC clone RP24-358O9 from chromosome 1, complete sequence
          Length = 200763

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 62     ggtttggggttccgatctggt 82
              |||||||||||||||||||||
Sbjct: 170152 ggtttggggttccgatctggt 170132



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 275    gacgaggaggccgttcaggggctc 298
              ||||| ||||||||||||||||||
Sbjct: 303637 gacgatgaggccgttcaggggctc 303614



to top

>gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete genome
          Length = 2314078

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    ggcgcgttcctgcccttcgc 225
              ||||||||||||||||||||
Sbjct: 693397 ggcgcgttcctgcccttcgc 693416



to top

>ref|XM_361577.1| Magnaporthe grisea 70-15 hypothetical protein (MG04051.4) partial
           mRNA
          Length = 1245

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 168 gcggcagccccacggccggcggcagcag 195
           |||||||| |||||| ||||||||||||
Sbjct: 35  gcggcagcaccacgggcggcggcagcag 62



to top

>ref|XM_369638.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG05826.4) partial mRNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 169 cggcagccccacggccggcg 188
           ||||||||||||||||||||
Sbjct: 645 cggcagccccacggccggcg 664



to top

>ref|XM_500054.1| Yarrowia lipolytica CLIB122, YALI0A14322g predicted mRNA
          Length = 1053

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 188 ggcagcagggacgagcgggg 207
           ||||||||||||||||||||
Sbjct: 972 ggcagcagggacgagcgggg 991



to top

>ref|XM_505509.1| Yarrowia lipolytica CLIB122, YALI0F16819g predicted mRNA
          Length = 1317

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 69   ggttccgatctggttgacct 88
            ||||||||||||||||||||
Sbjct: 1059 ggttccgatctggttgacct 1040



to top

>emb|AL109615.42|HS1120P11 Human DNA sequence from clone RP5-1120P11 on chromosome 6p12.3-21.2,
             complete sequence
          Length = 146655

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   cggccggcggcagcagggac 199
             ||||||||||||||||||||
Sbjct: 27346 cggccggcggcagcagggac 27327



to top

>emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete genome; segment 5/29
          Length = 339650

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    cacggccggcggcagcaggg 197
              ||||||||||||||||||||
Sbjct: 168294 cacggccggcggcagcaggg 168275



to top

>gb|AF326398.1|AF326398 Pseudomonas sp. ADP Mn(II)-oxidation-associated multicopper oxidase
           (cumA) gene, partial cds
          Length = 1062

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 196 ggacgagcggggcgcgttcctgcccttc 223
           |||||||| |||||| ||||||||||||
Sbjct: 252 ggacgagcagggcgccttcctgcccttc 279



to top

>emb|CR391398.1| Gallus gallus finished cDNA, clone ChEST652p12
          Length = 914

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 182 gccggcggcagcagggacgagcgg 205
           ||||||||||||||||| ||||||
Sbjct: 16  gccggcggcagcagggaagagcgg 39



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 244     gaggaaggccaccccgccca 263
               ||||||||||||||||||||
Sbjct: 1028123 gaggaaggccaccccgccca 1028104



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 244    gaggaaggccaccccgccca 263
              ||||||||||||||||||||
Sbjct: 701098 gaggaaggccaccccgccca 701079



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 69      ggttccgatctggttgacct 88
               ||||||||||||||||||||
Sbjct: 2248068 ggttccgatctggttgacct 2248087



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 188     ggcagcagggacgagcgggg 207
               ||||||||||||||||||||
Sbjct: 1451265 ggcagcagggacgagcgggg 1451246


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,728,906
Number of Sequences: 3902068
Number of extensions: 1728906
Number of successful extensions: 32716
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32534
Number of HSP's gapped (non-prelim): 182
length of query: 364
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 342
effective length of database: 17,147,199,772
effective search space: 5864342322024
effective search space used: 5864342322024
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top