ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl30g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
2dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
3dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
4dbj|AK101871.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 4e-10
5gb|AE015451.1| Pseudomonas putida KT2440 complete genome 56 1e-04
6dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 50 0.006
7emb|AJ303031.1|MMU303031 Mycosphaerella musicola microsatellite ... 48 0.024
8gb|J02527.1|DROGART Drosophila melanogaster Gart polypeptide gen... 48 0.024
9gb|AY190947.1| Drosophila pseudoobscura clone DPSF01_40_G23 (D14... 48 0.024
10emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 48 0.024
11gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 46 0.093
12gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 46 0.093
13gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 46 0.093
14gb|AY685231.1| Neurospora crassa F-box/WD-40 repeat-containing p... 46 0.093
15gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 46 0.093
16ref|XM_323892.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
17ref|XM_950887.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
18ref|XM_952082.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
19ref|XM_954064.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
20ref|XM_954186.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
21ref|XM_956291.1| Neurospora crassa OR74A hypothetical protein ( ... 46 0.093
22ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
23ref|XM_326790.1| Neurospora crassa OR74A hypothetical protein ( ... 46 0.093
24ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
25ref|XM_328190.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
26ref|XM_328894.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
27ref|XM_331604.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.093
28gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 46 0.093
29gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 46 0.093
30ref|XM_718288.1| Candida albicans SC5314 hypothetical protein (C... 46 0.093
31ref|XM_715743.1| Candida albicans SC5314 tRNA splicing ligase Tr... 46 0.093
32ref|XM_705331.1| Candida albicans SC5314 hypothetical protein (C... 46 0.093
33gb|AC132297.4| Mus musculus chromosome 7 clone RP24-330M18, comp... 46 0.093
34gb|AY341996.1| Drosophila miranda CG7255-like protein gene, part... 46 0.093
35ref|XM_755711.1| Ustilago maydis 521 hypothetical protein (UM046... 46 0.093
36ref|XM_883733.1| Candida albicans SC5314 hypothetical protein (C... 46 0.093
37gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.093
38ref|XM_716256.1| Candida albicans SC5314 tRNA splicing ligase Tr... 46 0.093
39gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete... 46 0.093
40gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 46 0.093
41gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic m... 46 0.093
42gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 46 0.093
43emb|CR555306.1| Azoarcus sp. EbN1 complete genome 46 0.093
44emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 46 0.093
45emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 46 0.093
46emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig... 46 0.093
47emb|BX294016.1|NCB9K17 Neurospora crassa DNA linkage group V BAC... 46 0.093
48emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete ... 46 0.093
49emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC... 46 0.093
50emb|AL451021.1|NC65E11 Neurospora crassa DNA linkage group V Cos... 46 0.093
51emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosm... 46 0.093
52emb|AL355926.1|NCB17C10 Neurospora crassa DNA linkage group II B... 46 0.093
53gb|AE012542.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.093
54gb|DQ378280.1| Drosophila virilis strain Tucson 15010-1001.10 fo... 46 0.093
55ref|NM_137678.2| Drosophila melanogaster Ipk1 CG30295-RA (Ipk1),... 46 0.093
56gb|AY061821.1| Drosophila melanogaster GH07317 full length cDNA 46 0.093
57gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57... 46 0.093
58gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.093
59gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 46 0.093
60dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.093
61gb|AC008289.5|AC008289 Drosophila melanogaster, chromosome 2R, r... 46 0.093
62gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, r... 46 0.093
63gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, r... 46 0.093
64gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, r... 46 0.093
65gb|AF348415.2| Zea mays cytosolic aldehyde dehydrogenase RF2D (r... 46 0.093
66gb|L13380.1|YSATRNALIG Candida albicans transfer RNA ligase gene... 46 0.093
67dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 46 0.093
68dbj|AK110643.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.093
69gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50... 46 0.093
70gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60... 46 0.093
71gb|AC004433.1|AC004433 Drosophila melanogaster, chromosome 2R, r... 46 0.093
72gb|AY633955.1| Drosophila cardini strain Basse Pointe y protein ... 46 0.093
73gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.093
74gb|AF042712.1|AF042712 Drosophila pseudoobscura even-skipped (ev... 46 0.093
75gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase ... 46 0.093
76gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (... 46 0.093
77gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferas... 46 0.093
78gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (c... 46 0.093
79gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransfera... 46 0.093
80gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransf... 46 0.093
81gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransfe... 46 0.093
82gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (... 46 0.093
83gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase... 46 0.093
84gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase ... 46 0.093
85gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (c... 46 0.093
86gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase ... 46 0.093
87gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase ... 46 0.093
88gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransfer... 46 0.093
89gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransf... 46 0.093
90gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransfe... 46 0.093
91gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransfe... 46 0.093
92gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 46 0.093
93gb|AC150275.2| Mus musculus BAC clone RP23-409M16 from 7, comple... 46 0.093
94dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, comp... 46 0.093
95gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipie... 46 0.093
96gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipie... 46 0.093
97gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipie... 46 0.093
98dbj|AB073680.1| Turbo marmoratus mRNA for nacrein, complete cds 46 0.093
99ref|XM_480314.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.37
100gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.37
101ref|XM_752979.1| Ustilago maydis 521 hypothetical protein (UM019... 44 0.37
102ref|XM_755102.1| Ustilago maydis 521 hypothetical protein (UM040... 44 0.37
103ref|XM_755134.1| Ustilago maydis 521 hypothetical protein (UM040... 44 0.37
104gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (... 44 0.37
105ref|XM_502461.1| Yarrowia lipolytica CLIB122, YALI0D05841g predi... 44 0.37
106gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 44 0.37
107gb|AC130797.5| Chlamydomonas reinhardtii clone cr-1j6b, complete... 44 0.37
108gb|AC009459.6| Drosophila melanogaster, chromosome 2R, region 57... 44 0.37
109dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
110dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
111dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
112dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
113gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.37
114gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.37
115dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
116dbj|AP004781.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
117dbj|AP003711.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
118dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
119gb|AF014927.1|AF014927 Chlamydomonas reinhardtii glutathione per... 44 0.37
120dbj|AK073403.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.37
121emb|AJ390493.1|CAL390493 Candida albicans partial ecm21 gene for... 44 0.37
122gb|AE003454.3| Drosophila melanogaster chromosome 2R, section 62... 44 0.37
123emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 44 0.37
124ref|NM_192679.1| Oryza sativa (japonica cultivar-group), predic... 42 1.5
125ref|XM_478182.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
126ref|XM_478172.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
127gb|AC112160.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
128ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.5
129gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence 42 1.5
130ref|XM_957135.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
131ref|XM_326244.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
132emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 42 1.5
133ref|XM_750841.1| Aspergillus fumigatus Af293 hypothetical protei... 42 1.5
134gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's ... 42 1.5
135emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... 42 1.5
136gb|AY957386.1| Paracoccus haeundaensis astaxanthin biosynthesis ... 42 1.5
137dbj|AB206672.1| Paracoccus sp. N81106 carotenoid biosynthesis ge... 42 1.5
138gb|DQ350712.1| Ajellomyces capsulatus nitrosative stress induced... 42 1.5
139dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
140dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
141dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
142gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, ... 42 1.5
143gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, r... 42 1.5
144dbj|D58420.2|ATUCRTWA Paracoccus sp. N81106 crtW, crtZ, crtY, cr... 42 1.5
145dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
146gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.5
147dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
148dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
149dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
150dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
151dbj|AK120689.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
152dbj|AK120157.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
153dbj|AK110890.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
154dbj|AK108737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
155emb|AJ330947.1|HSA330947 Homo sapiens genomic sequence surroundi... 42 1.5
156gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12... 42 1.5
157emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 42 1.5
158gb|AC147558.3| Mus musculus BAC clone RP23-470N2 from 8, complet... 42 1.5
159emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 42 1.5
160gb|AC152981.2| Mus musculus 10 BAC RP23-154M15 (Roswell Park Can... 42 1.5
161dbj|AB012145.1| Streptomyces lividans mRNA encoding metallothion... 42 1.5
162ref|XM_467014.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.8
163ref|XM_466682.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.8
164ref|XM_506864.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 5.8
165ref|NM_192727.1| Oryza sativa (japonica cultivar-group), predic... 40 5.8
166gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, co... 40 5.8
167gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl... 40 5.8
168ref|XM_365446.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.8
169ref|XM_362442.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 5.8
170gb|AE009066.1| Agrobacterium tumefaciens str. C58 circular chrom... 40 5.8
171gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 40 5.8
172ref|XM_883507.1| Leishmania major strain Friedlin hypothetical p... 40 5.8
173ref|XM_751684.1| Ustilago maydis 521 hypothetical protein (UM006... 40 5.8
174ref|XM_752624.1| Ustilago maydis 521 hypothetical protein (UM015... 40 5.8
175ref|XM_753523.1| Ustilago maydis 521 hypothetical protein (UM024... 40 5.8
176emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4,... 40 5.8
177ref|XM_385837.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 5.8
178ref|XM_381644.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 5.8
179emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete ch... 40 5.8
180gb|AY271618.1| Oryza sativa (indica cultivar-group) PDR-type ABC... 40 5.8
181gb|AC166543.2| Nectria haematococca clone JGIAYWI-5I13, complete... 40 5.8
182emb|Z30236.1|NPHALCYA N.pharaonis (SP1/28) gene for halocyanin 40 5.8
183emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.8
184emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II B... 40 5.8
185gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genom... 40 5.8
186emb|AL138972.1|DMBR25B3 Drosophila melanogaster BAC clone BACR25B3 40 5.8
187emb|AL035245.1|DMBH61I5 Drosophila melanogaster BAC clone BACH61I5 40 5.8
188gb|AC104054.6| Drosophila melanogaster X BAC RP98-21G11 (Roswell... 40 5.8
189gb|AC105055.2| Drosophila melanogaster X BAC RP98-5N9 (Roswell P... 40 5.8
190tpg|BK002977.1| TPA: TPA_inf: Drosophila melanogaster HDC17114 (... 40 5.8
191ref|NM_176746.1| Drosophila melanogaster forked CG5424-RC, trans... 40 5.8
192ref|NM_176745.1| Drosophila melanogaster forked CG5424-RD, trans... 40 5.8
193ref|NM_167563.2| Drosophila melanogaster forked CG5424-RA, trans... 40 5.8
194ref|NM_143605.2| Drosophila melanogaster CG11339-RA (CG11339), mRNA 40 5.8
195ref|NM_078660.2| Drosophila melanogaster forked CG5424-RB, trans... 40 5.8
196gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 40 5.8
197gb|AF472590.1| Sinorhizobium meliloti JJ1c10 hypothetical transm... 40 5.8
198gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F... 40 5.8
199gb|AY029175.1| Cavia porcellus F-box protein OCP1 (OCP1) mRNA, c... 40 5.8
200gb|AC008326.9| Drosophila melanogaster, chromosome 2L, region 27... 40 5.8
201gb|DQ355211.1| Phytophthora sojae cell 5A endo-1,4-betaglucanase... 40 5.8
202tpg|BK001017.1| TPA: TPA_exp: Oryza sativa (japonica cultivar-gr... 40 5.8
203gb|AC012096.8|AC012096 Drosophila melanogaster, chromosome X, re... 40 5.8
204gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 5.8
205gb|AC007977.12|AC007977 Drosophila melanogaster, chromosome 2L, ... 40 5.8
206gb|AC010995.11|AC010995 Drosophila melanogaster, chromosome X, r... 40 5.8
207gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, r... 40 5.8
208dbj|AP002844.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
209gb|AC137069.2| Genomic sequence for Oryza sativa, Nipponbare str... 40 5.8
210dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 5.8
211dbj|AP004818.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
212dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
213dbj|AP005291.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
214dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
215dbj|AK110597.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
216dbj|AK108390.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
217dbj|AK104319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
218dbj|AK060705.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
219gb|AY105287.1| Zea mays PCO135091 mRNA sequence 40 5.8
220gb|AE003615.3| Drosophila melanogaster chromosome 2L, section 24... 40 5.8
221gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 11... 40 5.8
222gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 ... 40 5.8
223gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 ... 40 5.8
224gb|AE003424.2| Drosophila melanogaster chromosome X, section 8 o... 40 5.8
225gb|AE003422.2| Drosophila melanogaster chromosome X, section 6 o... 40 5.8
226gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome 40 5.8
227emb|AJ535046.1|OSA535046 Oryza sativa (japonica cultivar-group) ... 40 5.8
228gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 40 5.8
229gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 5.8
230gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 40 5.8
231emb|X05177.1|DFUBX1 Drosophila funebris ubx (Ultrabithorax) gene... 40 5.8
232emb|X69871.1|DMFORKEDA D.melanogaster putative f gene 40 5.8
233dbj|D21203.2|DROFP Drosophila melanogaster forked mRNA for large... 40 5.8

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                             
Query: 113      cggcggcgatggaccaggtgcagcggaagagtagcctgaggtcgc 157
                ||||||||||||| ||||||| |||||||||||||||||||||||
Sbjct: 27136582 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 27136626



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 224      tcgacggcaacggcaacggc 243
                ||||||||||||||||||||
Sbjct: 25922650 tcgacggcaacggcaacggc 25922669



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 187      cccggcctcggcgagcggcg 206
                ||||||||||||||||||||
Sbjct: 24103365 cccggcctcggcgagcggcg 24103346



to top

>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1725_H08
          Length = 155431

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                          
Query: 113   cggcggcgatggaccaggtgcagcggaagagtagcctgaggtcgc 157
             ||||||||||||| ||||||| |||||||||||||||||||||||
Sbjct: 33031 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 33075



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1486_E07
          Length = 110494

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                           
Query: 113    cggcggcgatggaccaggtgcagcggaagagtagcctgaggtcgc 157
              ||||||||||||| ||||||| |||||||||||||||||||||||
Sbjct: 108231 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 108275



to top

>dbj|AK101871.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070F06, full
           insert sequence
          Length = 3349

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 113 cggcggcgatggaccaggtgcagcggaagagtagcctgaggtcgc 157
           ||||||||||||| ||||||| |||||||||||||||||||||||
Sbjct: 86  cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 130



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                               
Query: 218     tcaagatcgacggcaacggcaacggcaacggc 249
               |||||||| |||||||||||||||||||||||
Sbjct: 4907932 tcaagatcaacggcaacggcaacggcaacggc 4907901



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 218     tcaagatcgacggcaacggcaacggcaacggc 249
               |||||||| |||||||||||||||||||||||
Sbjct: 2530856 tcaagatcaacggcaacggcaacggcaacggc 2530887



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 4907917 acggcaacggcaacggcaacggc 4907895



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2530889 acggcaacggcaacggcaacggc 2530911



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2530883 acggcaacggcaacggcaacggc 2530905



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2530877 acggcaacggcaacggcaacggc 2530899



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2530871 acggcaacggcaacggcaacggc 2530893



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 2528903 acggcaacggcaacggcaacg 2528883



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 4907911 acggcaacggcaacggcaac 4907892



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 2530895 acggcaacggcaacggcaac 2530914



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 230     gcaacggcaacggcaacggc 249
               ||||||||||||||||||||
Sbjct: 2256098 gcaacggcaacggcaacggc 2256079



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                        
Query: 225     cgacggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||||
Sbjct: 7055284 cgacggcaacggcaacggcaacggc 7055260



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 733838 acggcaacggcaacggcaacggc 733860



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 733832 acggcaacggcaacggcaacggc 733854



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 733827 cggcaacggcaacggcaacggc 733848



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 228     cggcaacggcaacggcaacgg 248
               |||||||||||||||||||||
Sbjct: 8706410 cggcaacggcaacggcaacgg 8706430



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 228     cggcaacggcaacggcaacgg 248
               |||||||||||||||||||||
Sbjct: 8706248 cggcaacggcaacggcaacgg 8706268



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 5145273 acggcaacggcaacggcaacg 5145253



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 8706511 acggcaacggcaacggcaac 8706530



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 264     cgtccccggcgccgacgtcggcgg 287
               |||||||||| |||||||||||||
Sbjct: 7131244 cgtccccggctccgacgtcggcgg 7131221



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 232     aacggcaacggcaacggccc 251
               ||||||||||||||||||||
Sbjct: 3308956 aacggcaacggcaacggccc 3308975



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 733844 acggcaacggcaacggcaac 733863



to top

>emb|AJ303031.1|MMU303031 Mycosphaerella musicola microsatellite flanking region, clone
           MmSSR21
          Length = 638

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 227 acggcaacggcaacggcaacggcc 250
           ||||||||||||||||||||||||
Sbjct: 255 acggcaacggcaacggcaacggcc 278



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 249 acggcaacggcaacggcaacggc 271



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 243 acggcaacggcaacggcaacggc 265



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 228 cggcaacggcaacggcaacggc 249
           ||||||||||||||||||||||
Sbjct: 238 cggcaacggcaacggcaacggc 259



to top

>gb|J02527.1|DROGART Drosophila melanogaster Gart polypeptide gene, complete cds,
            alternatively spliced and pupal cuticle protein gene,
            complete cds
          Length = 9953

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 226  gacggcaacggcaacggcaacggc 249
            ||||||||||||||||||||||||
Sbjct: 2902 gacggcaacggcaacggcaacggc 2879



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 2895 acggcaacggcaacggcaac 2876



to top

>gb|AY190947.1| Drosophila pseudoobscura clone DPSF01_40_G23 (D1426) genomic sequence
          Length = 42336

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 225   cgacggcaacggcaacggcaacgg 248
             ||||||||||||||||||||||||
Sbjct: 33518 cgacggcaacggcaacggcaacgg 33541



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 226   gacggcaacggcaacggcaacggc 249
             |||||| |||||||||||||||||
Sbjct: 33513 gacggcgacggcaacggcaacggc 33536



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 227     acggcaacggcaacggcaacggcc 250
               ||||||||||||||||||||||||
Sbjct: 1919986 acggcaacggcaacggcaacggcc 1919963



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 1919991 cggcaacggcaacggcaacggc 1919970



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2801730 acggcaacggcaacggcaacggc 2801708



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2801724 acggcaacggcaacggcaacggc 2801702



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2801718 acggcaacggcaacggcaacggc 2801696



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2801712 acggcaacggcaacggcaacggc 2801690



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 2801734 ggcaacggcaacggcaacggc 2801714



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 10390 acggcaacggcaacggcaacggc 10368



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   acggcaacggcaacggcaacg 247
             |||||||||||||||||||||
Sbjct: 10384 acggcaacggcaacggcaacg 10364



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 522910 acggcaacggcaacggcaacggc 522932



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 522905 cggcaacggcaacggcaacggc 522926



to top

>gb|AY685231.1| Neurospora crassa F-box/WD-40 repeat-containing protein (fwd-1) mRNA,
            complete cds
          Length = 3033

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 2674 acggcaacggcaacggcaacggc 2696



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1401572 acggcaacggcaacggcaacggc 1401550



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 227     acggcaacggcaacggcaacgg 248
               ||||||||||||||||||||||
Sbjct: 1401566 acggcaacggcaacggcaacgg 1401545



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 1401576 ggcaacggcaacggcaacggc 1401556



to top

>ref|XM_323892.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial
            mRNA
          Length = 3033

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 2674 acggcaacggcaacggcaacggc 2696



to top

>ref|XM_950887.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial
            mRNA
          Length = 3033

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 2674 acggcaacggcaacggcaacggc 2696



to top

>ref|XM_952082.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial
            mRNA
          Length = 1854

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1307 acggcaacggcaacggcaacggc 1329



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1301 acggcaacggcaacggcaacggc 1323



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1295 acggcaacggcaacggcaacggc 1317



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 227  acggcaacggcaacggcaacgg 248
            ||||||||||||||||||||||
Sbjct: 1313 acggcaacggcaacggcaacgg 1334



to top

>ref|XM_954064.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial
            mRNA
          Length = 1263

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 986  acggcaacggcaacggcaacggc 1008



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 982  ggcaacggcaacggcaacggc 1002



to top

>ref|XM_954186.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial
           mRNA
          Length = 1155

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 228 cggcaacggcaacggcaacggcc 250
           |||||||||||||||||||||||
Sbjct: 60  cggcaacggcaacggcaacggcc 82



to top

>ref|XM_956291.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related
           to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1)
           partial mRNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 176 acggcaacggcaacggcaacggc 198



to top

>ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial
            mRNA
          Length = 2178

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1871 acggcaacggcaacggcaacggc 1893



to top

>ref|XM_326790.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related
           to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1)
           partial mRNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 176 acggcaacggcaacggcaacggc 198



to top

>ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial
            mRNA
          Length = 2178

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1871 acggcaacggcaacggcaacggc 1893



to top

>ref|XM_328190.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial
            mRNA
          Length = 1854

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1307 acggcaacggcaacggcaacggc 1329



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1301 acggcaacggcaacggcaacggc 1323



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1295 acggcaacggcaacggcaacggc 1317



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 227  acggcaacggcaacggcaacgg 248
            ||||||||||||||||||||||
Sbjct: 1313 acggcaacggcaacggcaacgg 1334



to top

>ref|XM_328894.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial
           mRNA
          Length = 1155

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 228 cggcaacggcaacggcaacggcc 250
           |||||||||||||||||||||||
Sbjct: 60  cggcaacggcaacggcaacggcc 82



to top

>ref|XM_331604.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial
            mRNA
          Length = 1263

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 986  acggcaacggcaacggcaacggc 1008



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 982  ggcaacggcaacggcaacggc 1002



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2142537 acggcaacggcaacggcaacggc 2142559



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2142531 acggcaacggcaacggcaacggc 2142553



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2142525 acggcaacggcaacggcaacggc 2142547



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2137075 acggcaacggcaacggcaacggc 2137053



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 2137080 cggcaacggcaacggcaacggc 2137059



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 2142521 ggcaacggcaacggcaacggc 2142541



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 2137069 acggcaacggcaacggcaacg 2137049



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 2142543 acggcaacggcaacggcaac 2142562



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 228     cggcaacggcaacggcaacg 247
               ||||||||||||||||||||
Sbjct: 1416417 cggcaacggcaacggcaacg 1416436



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2981368 acggcaacggcaacggcaacggc 2981346



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2981362 acggcaacggcaacggcaacggc 2981340



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2981356 acggcaacggcaacggcaacggc 2981334



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 230     gcaacggcaacggcaacggccc 251
               ||||||||||||||||||||||
Sbjct: 2126459 gcaacggcaacggcaacggccc 2126438



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 2981372 ggcaacggcaacggcaacggc 2981352



to top

>ref|XM_718288.1| Candida albicans SC5314 hypothetical protein (CaO19_12351), mRNA
          Length = 1380

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 890 acggcaacggcaacggcaacggc 912



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 227 acggcaacggcaacggcaacgg 248
           ||||||||||||||||||||||
Sbjct: 896 acggcaacggcaacggcaacgg 917



to top

>ref|XM_715743.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (CaO19_13864),
           mRNA
          Length = 2499

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 436 acggcaacggcaacggcaacggc 458



to top

>ref|XM_705331.1| Candida albicans SC5314 hypothetical protein (CaO19.4553), mRNA
          Length = 2166

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1264 acggcaacggcaacggcaacggc 1286



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  acggcaacggcaacggcaacg 247
            |||||||||||||||||||||
Sbjct: 1270 acggcaacggcaacggcaacg 1290



to top

>gb|AC132297.4| Mus musculus chromosome 7 clone RP24-330M18, complete sequence
          Length = 152941

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 127064 acggcaacggcaacggcaacggc 127042



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 127067 gcaacggcaacggcaacggc 127048



to top

>gb|AY341996.1| Drosophila miranda CG7255-like protein gene, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 512 acggcaacggcaacggcaacggc 534



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 518 acggcaacggcaacggcaac 537



to top

>ref|XM_755711.1| Ustilago maydis 521 hypothetical protein (UM04657.1) partial mRNA
          Length = 5832

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 4835 acggcaacggcaacggcaacggc 4857



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 227  acggcaacggcaacggcaacgg 248
            ||||||||||||||||||||||
Sbjct: 4841 acggcaacggcaacggcaacgg 4862



to top

>ref|XM_883733.1| Candida albicans SC5314 hypothetical protein (CaJ7.0238) partial
           mRNA
          Length = 2499

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 436 acggcaacggcaacggcaacggc 458



to top

>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04,
              complete sequence
          Length = 164882

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 110669 acggcaacggcaacggcaacggc 110691



to top

>ref|XM_716256.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (TRL1) partial
           mRNA
          Length = 2499

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 436 acggcaacggcaacggcaacggc 458



to top

>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence
          Length = 227968

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 105732 acggcaacggcaacggcaacggc 105754



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 105729 gcaacggcaacggcaacggc 105748



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879557 acggcaacggcaacggcaacggc 1879535



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879551 acggcaacggcaacggcaacggc 1879529



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879545 acggcaacggcaacggcaacggc 1879523



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879539 acggcaacggcaacggcaacggc 1879517



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879533 acggcaacggcaacggcaacggc 1879511



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1879527 acggcaacggcaacggcaacggc 1879505



to top

>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis
             gene cluster, partial sequence
          Length = 103450

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 77511 acggcaacggcaacggcaacggc 77489



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 77505 acggcaacggcaacggcaacggc 77483



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 227   acggcaacggcaacggcaacgg 248
             ||||||||||||||||||||||
Sbjct: 77499 acggcaacggcaacggcaacgg 77478



to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709725 acggcaacggcaacggcaacggc 709747



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709719 acggcaacggcaacggcaacggc 709741



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709713 acggcaacggcaacggcaacggc 709735



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709707 acggcaacggcaacggcaacggc 709729



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709701 acggcaacggcaacggcaacggc 709723



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 709695 acggcaacggcaacggcaacggc 709717



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 709690 cggcaacggcaacggcaacggc 709711



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 3305689 acggcaacggcaacggcaacggc 3305711



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 3305683 acggcaacggcaacggcaacggc 3305705



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627482 acggcaacggcaacggcaacggc 1627504



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627476 acggcaacggcaacggcaacggc 1627498



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627470 acggcaacggcaacggcaacggc 1627492



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627464 acggcaacggcaacggcaacggc 1627486



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627458 acggcaacggcaacggcaacggc 1627480



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1627452 acggcaacggcaacggcaacggc 1627474



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 3305695 acggcaacggcaacggcaacg 3305715



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 1627488 acggcaacggcaacggcaacg 1627508



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2727407 acggcaacggcaacggcaacggc 2727429



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304198 acggcaacggcaacggcaacggc 304220



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304192 acggcaacggcaacggcaacggc 304214



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304186 acggcaacggcaacggcaacggc 304208



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304180 acggcaacggcaacggcaacggc 304202



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304174 acggcaacggcaacggcaacggc 304196



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304168 acggcaacggcaacggcaacggc 304190



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304162 acggcaacggcaacggcaacggc 304184



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304156 acggcaacggcaacggcaacggc 304178



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304150 acggcaacggcaacggcaacggc 304172



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304144 acggcaacggcaacggcaacggc 304166



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304138 acggcaacggcaacggcaacggc 304160



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304132 acggcaacggcaacggcaacggc 304154



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304126 acggcaacggcaacggcaacggc 304148



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304120 acggcaacggcaacggcaacggc 304142



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304114 acggcaacggcaacggcaacggc 304136



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304108 acggcaacggcaacggcaacggc 304130



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304102 acggcaacggcaacggcaacggc 304124



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304096 acggcaacggcaacggcaacggc 304118



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304090 acggcaacggcaacggcaacggc 304112



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304084 acggcaacggcaacggcaacggc 304106



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304078 acggcaacggcaacggcaacggc 304100



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304072 acggcaacggcaacggcaacggc 304094



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304066 acggcaacggcaacggcaacggc 304088



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304060 acggcaacggcaacggcaacggc 304082



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304054 acggcaacggcaacggcaacggc 304076



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304048 acggcaacggcaacggcaacggc 304070



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304042 acggcaacggcaacggcaacggc 304064



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304036 acggcaacggcaacggcaacggc 304058



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304030 acggcaacggcaacggcaacggc 304052



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304024 acggcaacggcaacggcaacggc 304046



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304018 acggcaacggcaacggcaacggc 304040



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304012 acggcaacggcaacggcaacggc 304034



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304006 acggcaacggcaacggcaacggc 304028



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 304000 acggcaacggcaacggcaacggc 304022



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 303994 acggcaacggcaacggcaacggc 304016



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 303988 acggcaacggcaacggcaacggc 304010



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 303982 acggcaacggcaacggcaacggc 304004



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 303976 acggcaacggcaacggcaacggc 303998



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 303970 acggcaacggcaacggcaacggc 303992



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 2727402 cggcaacggcaacggcaacggc 2727423



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 427424 cggcaacggcaacggcaacggc 427403



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 2727413 acggcaacggcaacggcaacg 2727433



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 303966 ggcaacggcaacggcaacggc 303986



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 304204 acggcaacggcaacggcaac 304223



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    cggcaacggcaacggcaacg 247
              ||||||||||||||||||||
Sbjct: 298828 cggcaacggcaacggcaacg 298809



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2978237 acggcaacggcaacggcaacggc 2978215



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2978231 acggcaacggcaacggcaacggc 2978209



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2978225 acggcaacggcaacggcaacggc 2978203



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2978219 acggcaacggcaacggcaacggc 2978197



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2978213 acggcaacggcaacggcaacggc 2978191



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1716213 acggcaacggcaacggcaacggc 1716191



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1716207 acggcaacggcaacggcaacggc 1716185



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 2978242 cggcaacggcaacggcaacggc 2978221



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 230     gcaacggcaacggcaacggccc 251
               ||||||||||||||||||||||
Sbjct: 2246763 gcaacggcaacggcaacggccc 2246784



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 225     cgacggcaacggcaacggcaacggc 249
               |||| ||||||||||||||||||||
Sbjct: 1716221 cgacagcaacggcaacggcaacggc 1716197



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 1716201 acggcaacggcaacggcaac 1716182



to top

>emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig B1D14
          Length = 138898

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 107426 acggcaacggcaacggcaacggc 107448



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 107422 ggcaacggcaacggcaacggc 107442



to top

>emb|BX294016.1|NCB9K17 Neurospora crassa DNA linkage group V BAC clone B9K17
          Length = 71774

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 59400 acggcaacggcaacggcaacggc 59422



to top

>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29
          Length = 311000

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 205483 acggcaacggcaacggcaacggc 205505



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 205477 acggcaacggcaacggcaacggc 205499



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 205472 cggcaacggcaacggcaacggc 205493



to top

>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5
          Length = 72305

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 56679 acggcaacggcaacggcaacggc 56701



to top

>emb|AL451021.1|NC65E11 Neurospora crassa DNA linkage group V Cosmid contig 65E11
          Length = 64884

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 2946 acggcaacggcaacggcaacggc 2968



to top

>emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosmid contig 15E6
          Length = 61843

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 56975 acggcaacggcaacggcaacggc 56953



to top

>emb|AL355926.1|NCB17C10 Neurospora crassa DNA linkage group II BAC clone B17C10
          Length = 68484

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 59648 acggcaacggcaacggcaacggc 59670



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 59642 acggcaacggcaacggcaacggc 59664



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 59636 acggcaacggcaacggcaacggc 59658



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 227   acggcaacggcaacggcaacgg 248
             ||||||||||||||||||||||
Sbjct: 59654 acggcaacggcaacggcaacgg 59675



to top

>gb|AE012542.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 450
            of 460 of the complete genome
          Length = 11491

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 8001 acggcaacggcaacggcaacggc 7979



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 7995 acggcaacggcaacggcaacggc 7973



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 230  gcaacggcaacggcaacggc 249
            ||||||||||||||||||||
Sbjct: 8004 gcaacggcaacggcaacggc 7985



to top

>gb|DQ378280.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 43O10, complete
             sequence
          Length = 40809

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 14055 acggcaacggcaacggcaacggc 14077



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   gcaacggcaacggcaacggc 249
             ||||||||||||||||||||
Sbjct: 14052 gcaacggcaacggcaacggc 14071



to top

>ref|NM_137678.2| Drosophila melanogaster Ipk1 CG30295-RA (Ipk1), mRNA
          Length = 2463

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1968 acggcaacggcaacggcaacggc 1990



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 1964 ggcaacggcaacggcaacggc 1984



to top

>gb|AY061821.1| Drosophila melanogaster GH07317 full length cDNA
          Length = 2476

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 1968 acggcaacggcaacggcaacggc 1990



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 1964 ggcaacggcaacggcaacggc 1984



to top

>gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone
             BACR10P16, complete sequence
          Length = 171972

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 92940 acggcaacggcaacggcaacggc 92962



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 92936 ggcaacggcaacggcaacggc 92956



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 5043695 acggcaacggcaacggcaacggc 5043673



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 5043689 acggcaacggcaacggcaacggc 5043667



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 230     gcaacggcaacggcaacggc 249
               ||||||||||||||||||||
Sbjct: 5043698 gcaacggcaacggcaacggc 5043679



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 2220751 acggcaacggcaacggcaacggc 2220773



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 1561001 ggcaacggcaacggcaacggc 1561021



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 230     gcaacggcaacggcaacggc 249
               ||||||||||||||||||||
Sbjct: 2220748 gcaacggcaacggcaacggc 2220767



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 5900785 acggcaacggcaacggcaacggc 5900807



to top

>gb|AC008289.5|AC008289 Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone
             BACR04E05, complete sequence
          Length = 163012

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 85387 acggcaacggcaacggcaacggc 85365



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 85391 ggcaacggcaacggcaacggc 85371



to top

>gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, region 89B-89B, BAC clone
              BACR37I18, complete sequence
          Length = 195037

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 105813 acggcaacggcaacggcaacggc 105835



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 105809 ggcaacggcaacggcaacggc 105829



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 105819 acggcaacggcaacggcaac 105838



to top

>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone
              BACR10P11, complete sequence
          Length = 164035

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 158168 acggcaacggcaacggcaacggc 158146



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 158172 ggcaacggcaacggcaacggc 158152



to top

>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone
             BACR05P04, complete sequence
          Length = 194335

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 15776 acggcaacggcaacggcaacggc 15798



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 15772 ggcaacggcaacggcaacggc 15792



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 15782 acggcaacggcaacggcaac 15801



to top

>gb|AF348415.2| Zea mays cytosolic aldehyde dehydrogenase RF2D (rf2d) mRNA,
           complete cds
          Length = 1901

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 136 acggcaacggcaacggcaacggc 158



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 130 acggcaacggcaacggcaacggc 152



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 230 gcaacggcaacggcaacggc 249
           ||||||||||||||||||||
Sbjct: 127 gcaacggcaacggcaacggc 146



to top

>gb|L13380.1|YSATRNALIG Candida albicans transfer RNA ligase gene, complete cds
          Length = 2763

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 556 acggcaacggcaacggcaacggc 578



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 1502002 acggcaacggcaacggcaacggc 1501980



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 1502007 cggcaacggcaacggcaacggc 1501986



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 5889526 ggcaacggcaacggcaacggc 5889546



to top

>dbj|AK110643.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-D02, full
           insert sequence
          Length = 1044

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 271 acggcaacggcaacggcaacggc 293



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 228 cggcaacggcaacggcaacggc 249
           ||||||||||||||||||||||
Sbjct: 656 cggcaacggcaacggcaacggc 677



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 661 acggcaacggcaacggcaac 680



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 277 acggcaacggcaacggcaac 296



to top

>gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50 of 118 of the complete
              sequence
          Length = 226200

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 105225 acggcaacggcaacggcaacggc 105247



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 105221 ggcaacggcaacggcaacggc 105241



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 105231 acggcaacggcaacggcaac 105250



to top

>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete
             sequence
          Length = 303438

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 93100 acggcaacggcaacggcaacggc 93122



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 93096 ggcaacggcaacggcaacggc 93116



to top

>gb|AC004433.1|AC004433 Drosophila melanogaster, chromosome 2R, region 57B1-57B6, P1 clone
             DS03659, complete sequence
          Length = 85862

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 28558 acggcaacggcaacggcaacggc 28536



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 28562 ggcaacggcaacggcaacggc 28542



to top

>gb|AY633955.1| Drosophila cardini strain Basse Pointe y protein (y) gene, partial
           cds
          Length = 663

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 156 acggcaacggcaacggcaacggc 178



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 227     acggcaacggcaacggcaacggc 249
               |||||||||||||||||||||||
Sbjct: 5967262 acggcaacggcaacggcaacggc 5967284



to top

>gb|AF042712.1|AF042712 Drosophila pseudoobscura even-skipped (eve) gene, stripe 2 enhancer
           region
          Length = 1027

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 347 acggcaacggcaacggcaacggc 325



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 228 cggcaacggcaacggcaacggc 249
           ||||||||||||||||||||||
Sbjct: 352 cggcaacggcaacggcaacggc 331



to top

>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1152

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1145

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 137 acggcaacggcaacggcaacggc 159



to top

>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1222

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1209

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1152

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1463

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 132 acggcaacggcaacggcaacggc 154



to top

>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1464

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 132 acggcaacggcaacggcaacggc 154



to top

>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1434

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
           complete cds
          Length = 1150

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1153

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 140 acggcaacggcaacggcaacggc 162



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 134 acggcaacggcaacggcaacggc 156



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 128 acggcaacggcaacggcaacggc 150



to top

>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1206

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 142 acggcaacggcaacggcaacggc 164



to top

>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
           gene, complete cds
          Length = 1451

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 140 acggcaacggcaacggcaacggc 162



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 134 acggcaacggcaacggcaacggc 156



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 128 acggcaacggcaacggcaacggc 150



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19624 acggcaacggcaacggcaacggc 19646



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19618 acggcaacggcaacggcaacggc 19640



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19612 acggcaacggcaacggcaacggc 19634



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19606 acggcaacggcaacggcaacggc 19628



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19600 acggcaacggcaacggcaacggc 19622



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19594 acggcaacggcaacggcaacggc 19616



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19588 acggcaacggcaacggcaacggc 19610



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19582 acggcaacggcaacggcaacggc 19604



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19576 acggcaacggcaacggcaacggc 19598



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19570 acggcaacggcaacggcaacggc 19592



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19564 acggcaacggcaacggcaacggc 19586



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19558 acggcaacggcaacggcaacggc 19580



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19552 acggcaacggcaacggcaacggc 19574



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19546 acggcaacggcaacggcaacggc 19568



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19540 acggcaacggcaacggcaacggc 19562



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19534 acggcaacggcaacggcaacggc 19556



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19528 acggcaacggcaacggcaacggc 19550



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19522 acggcaacggcaacggcaacggc 19544



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19516 acggcaacggcaacggcaacggc 19538



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   acggcaacggcaacggcaacggc 249
             |||||||||||||||||||||||
Sbjct: 19510 acggcaacggcaacggcaacggc 19532



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   acggcaacggcaacggcaacg 247
             |||||||||||||||||||||
Sbjct: 19630 acggcaacggcaacggcaacg 19650



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   ggcaacggcaacggcaacggc 249
             |||||||||||||||||||||
Sbjct: 19506 ggcaacggcaacggcaacggc 19526



to top

>gb|AC150275.2| Mus musculus BAC clone RP23-409M16 from 7, complete sequence
          Length = 224935

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 223642 acggcaacggcaacggcaacggc 223620



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 223645 gcaacggcaacggcaacggc 223626



to top

>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence
          Length = 949626

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 458662 acggcaacggcaacggcaacggc 458684



to top

>gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipiens
            quinquefasciatus-3940143D9, complete sequence
          Length = 118759

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 6050 acggcaacggcaacggcaacggc 6072



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 6046 ggcaacggcaacggcaacggc 6066



to top

>gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipiens
            quinquefasciatus-3940139D9, complete sequence
          Length = 118752

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 227  acggcaacggcaacggcaacggc 249
            |||||||||||||||||||||||
Sbjct: 6049 acggcaacggcaacggcaacggc 6071



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 6045 ggcaacggcaacggcaacggc 6065



to top

>gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipiens
              quinquefasciatus-3940124D9, complete sequence
          Length = 118889

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    acggcaacggcaacggcaacggc 249
              |||||||||||||||||||||||
Sbjct: 112710 acggcaacggcaacggcaacggc 112688



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 112714 ggcaacggcaacggcaacggc 112694



to top

>dbj|AB073680.1| Turbo marmoratus mRNA for nacrein, complete cds
          Length = 1710

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 934 acggcaacggcaacggcaacggc 956



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 227 acggcaacggcaacggcaacggc 249
           |||||||||||||||||||||||
Sbjct: 928 acggcaacggcaacggcaacggc 950



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 229 ggcaacggcaacggcaacggc 249
           |||||||||||||||||||||
Sbjct: 924 ggcaacggcaacggcaacggc 944



to top

>ref|XM_480314.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 303

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 228 cggcaacggcaacggcaacggc 249
           ||||||||||||||||||||||
Sbjct: 24  cggcaacggcaacggcaacggc 3



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 731616 cggcaacggcaacggcaacggc 731595



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 189      cggcctcggcgagcggcggg 208
                ||||||||||||||||||||
Sbjct: 17146395 cggcctcggcgagcggcggg 17146376



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 229     ggcaacggcaacggcaacgg 248
               ||||||||||||||||||||
Sbjct: 9571970 ggcaacggcaacggcaacgg 9571989



to top

>ref|XM_752979.1| Ustilago maydis 521 hypothetical protein (UM01925.1) partial mRNA
          Length = 3153

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 228  cggcaacggcaacggcaacggc 249
            ||||||||||||||||||||||
Sbjct: 1410 cggcaacggcaacggcaacggc 1431



to top

>ref|XM_755102.1| Ustilago maydis 521 hypothetical protein (UM04048.1) partial mRNA
          Length = 1890

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 228  cggcaacggcaacggcaacggc 249
            ||||||||||||||||||||||
Sbjct: 1837 cggcaacggcaacggcaacggc 1858



to top

>ref|XM_755134.1| Ustilago maydis 521 hypothetical protein (UM04080.1) partial mRNA
          Length = 2019

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 230 gcaacggcaacggcaacggccc 251
           ||||||||||||||||||||||
Sbjct: 224 gcaacggcaacggcaacggccc 245



to top

>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217
              (CG31217), and ultrabithorax (Ubx) genes, complete cds
          Length = 308092

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 227    acggcaacggcaacggcaacggcccc 252
              |||||||||||||||||||| |||||
Sbjct: 224034 acggcaacggcaacggcaacagcccc 224009



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 235918 gcaacggcaacggcaacggc 235899



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 235915 acggcaacggcaacggcaac 235896



to top

>ref|XM_502461.1| Yarrowia lipolytica CLIB122, YALI0D05841g predicted mRNA
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 228  cggcaacggcaacggcaacggc 249
            ||||||||||||||||||||||
Sbjct: 1557 cggcaacggcaacggcaacggc 1578



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  acggcaacggcaacggcaacg 247
            |||||||||||||||||||||
Sbjct: 1562 acggcaacggcaacggcaacg 1582



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 4874141 cggcaacggcaacggcaacggc 4874120



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     acggcaacggcaacggcaacg 247
               |||||||||||||||||||||
Sbjct: 4874136 acggcaacggcaacggcaacg 4874116



to top

>gb|AC130797.5| Chlamydomonas reinhardtii clone cr-1j6b, complete sequence
          Length = 80650

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 227   acggcaacggcaacggcaacgg 248
             ||||||||||||||||||||||
Sbjct: 58507 acggcaacggcaacggcaacgg 58486



to top

>gb|AC009459.6| Drosophila melanogaster, chromosome 2R, region 57E-57F, BAC clone
             BACR34C17, complete sequence
          Length = 167447

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   cggcaacggcaacggcaacggc 249
             ||||||||||||||||||||||
Sbjct: 28462 cggcaacggcaacggcaacggc 28483



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 228     cggcaacggcaacggcaacggc 249
               ||||||||||||||||||||||
Sbjct: 4282924 cggcaacggcaacggcaacggc 4282903



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 228      cggcaacggcaacggcaacggc 249
                ||||||||||||||||||||||
Sbjct: 22761895 cggcaacggcaacggcaacggc 22761874



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 227      acggcaacggcaacggcaacg 247
                |||||||||||||||||||||
Sbjct: 22761890 acggcaacggcaacggcaacg 22761870



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 230      gcaacggcaacggcaacggcc 250
                |||||||||||||||||||||
Sbjct: 18197372 gcaacggcaacggcaacggcc 18197352



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 228      cggcaacggcaacggcaacggc 249
                ||||||||||||||||||||||
Sbjct: 24172891 cggcaacggcaacggcaacggc 24172870



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 227      acggcaacggcaacggcaac 246
                ||||||||||||||||||||
Sbjct: 24172886 acggcaacggcaacggcaac 24172867



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 267      ccccggcgccgacgtcggcg 286
                ||||||||||||||||||||
Sbjct: 19830922 ccccggcgccgacgtcggcg 19830903



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 228     cggcaacggcaacggcaacg 247
               ||||||||||||||||||||
Sbjct: 8203415 cggcaacggcaacggcaacg 8203396



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 731614 cggcaacggcaacggcaacggc 731593



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 189      cggcctcggcgagcggcggg 208
                ||||||||||||||||||||
Sbjct: 17139964 cggcctcggcgagcggcggg 17139945



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 229     ggcaacggcaacggcaacgg 248
               ||||||||||||||||||||
Sbjct: 9570091 ggcaacggcaacggcaacgg 9570110



to top

>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0090O10, complete sequence
          Length = 162132

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   cggcaacggcaacggcaacggc 249
             ||||||||||||||||||||||
Sbjct: 27161 cggcaacggcaacggcaacggc 27140



to top

>gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0005F16,
              complete sequence
          Length = 160053

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 117497 cggcaacggcaacggcaacggc 117476



to top

>dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0054L03
          Length = 183623

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   cggcaacggcaacggcaacggc 249
             ||||||||||||||||||||||
Sbjct: 45718 cggcaacggcaacggcaacggc 45697



to top

>dbj|AP004781.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0691E09
          Length = 149859

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 228  cggcaacggcaacggcaacggc 249
            ||||||||||||||||||||||
Sbjct: 2980 cggcaacggcaacggcaacggc 2959



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 2975 acggcaacggcaacggcaac 2956



to top

>dbj|AP003711.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417G12
          Length = 163568

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 106349 cggcaacggcaacggcaacggc 106328



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 106344 acggcaacggcaacggcaac 106325



to top

>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1092_A07
          Length = 137081

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   cggcaacggcaacggcaacggc 249
             ||||||||||||||||||||||
Sbjct: 81237 cggcaacggcaacggcaacggc 81216



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   acggcaacggcaacggcaacg 247
             |||||||||||||||||||||
Sbjct: 81232 acggcaacggcaacggcaacg 81212



to top

>gb|AF014927.1|AF014927 Chlamydomonas reinhardtii glutathione peroxidase homolog (gpxh) gene,
            complete cds
          Length = 4947

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 227  acggcaacggcaacggcaacgg 248
            ||||||||||||||||||||||
Sbjct: 1450 acggcaacggcaacggcaacgg 1471



to top

>dbj|AK073403.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042F02, full
           insert sequence
          Length = 2138

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 228 cggcaacggcaacggcaacggc 249
           ||||||||||||||||||||||
Sbjct: 912 cggcaacggcaacggcaacggc 933



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 917 acggcaacggcaacggcaac 936



to top

>emb|AJ390493.1|CAL390493 Candida albicans partial ecm21 gene for ECM21 protein
          Length = 515

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 227 acggcaacggcaacggcaacgg 248
           ||||||||||||||||||||||
Sbjct: 77  acggcaacggcaacggcaacgg 98



to top

>gb|AE003454.3| Drosophila melanogaster chromosome 2R, section 62 of 73 of the complete
              sequence
          Length = 313634

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 178998 cggcaacggcaacggcaacggc 179019



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    cggcaacggcaacggcaacggc 249
              ||||||||||||||||||||||
Sbjct: 750765 cggcaacggcaacggcaacggc 750744



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    acggcaacggcaacggcaacg 247
              |||||||||||||||||||||
Sbjct: 750760 acggcaacggcaacggcaacg 750740



to top

>ref|NM_192679.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1461

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 230 gcaacggcaacggcaacggcc 250
           |||||||||||||||||||||
Sbjct: 407 gcaacggcaacggcaacggcc 427



to top

>ref|XM_478182.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 456

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 273 cgccgacgtcggcggggcggc 293
           |||||||||||||||||||||
Sbjct: 231 cgccgacgtcggcggggcggc 251



to top

>ref|XM_478172.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 230 gcaacggcaacggcaacggcc 250
           |||||||||||||||||||||
Sbjct: 175 gcaacggcaacggcaacggcc 155



to top

>gb|AC112160.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1579_G03,
             complete sequence
          Length = 121466

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 226   gacggcaacggcaacggcaac 246
             |||||||||||||||||||||
Sbjct: 35631 gacggcaacggcaacggcaac 35611



to top

>ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (MG05326.4) partial
           mRNA
          Length = 1512

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 acggcaacggcaacggcaacg 247
           |||||||||||||||||||||
Sbjct: 179 acggcaacggcaacggcaacg 199



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 229 ggcaacggcaacggcaacggc 249
           |||||||||||||||||||||
Sbjct: 175 ggcaacggcaacggcaacggc 195



to top

>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence
          Length = 125927

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   acggcaacggcaacggcaacg 247
             |||||||||||||||||||||
Sbjct: 94927 acggcaacggcaacggcaacg 94947



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   gcaacggcaacggcaacggc 249
             ||||||||||||||||||||
Sbjct: 94924 gcaacggcaacggcaacggc 94943



to top

>ref|XM_957135.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial
            mRNA
          Length = 1977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 230  gcaacggcaacggcaacggcc 250
            |||||||||||||||||||||
Sbjct: 1888 gcaacggcaacggcaacggcc 1908



to top

>ref|XM_326244.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial
            mRNA
          Length = 1977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 230  gcaacggcaacggcaacggcc 250
            |||||||||||||||||||||
Sbjct: 1888 gcaacggcaacggcaacggcc 1908



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   cggcaacggcaacggcaacgg 248
             |||||||||||||||||||||
Sbjct: 44074 cggcaacggcaacggcaacgg 44054



to top

>ref|XM_750841.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g15990)
           partial mRNA
          Length = 456

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 acggcaacggcaacggcaacg 247
           |||||||||||||||||||||
Sbjct: 224 acggcaacggcaacggcaacg 244



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 229 ggcaacggcaacggcaacggc 249
           |||||||||||||||||||||
Sbjct: 220 ggcaacggcaacggcaacggc 240



to top

>gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 221805

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 8188 ggcaacggcaacggcaacggc 8168



to top

>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
          Length = 283100

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   cgcccggcctcggcgagcggc 205
             |||||||||||||||||||||
Sbjct: 49426 cgcccggcctcggcgagcggc 49446



to top

>gb|AY957386.1| Paracoccus haeundaensis astaxanthin biosynthesis gene cluster,
            complete sequence
          Length = 6227

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 113  cggcggcgatggaccaggtgcagcg 137
            |||||||||||||||||| ||||||
Sbjct: 4979 cggcggcgatggaccaggcgcagcg 4955



to top

>dbj|AB206672.1| Paracoccus sp. N81106 carotenoid biosynthesis gene cluster (idi,
            crtW, crtZ, crtY, crtI, crtB, crtE, crtX), complete cds
          Length = 10074

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 113  cggcggcgatggaccaggtgcagcg 137
            |||||||||||||||||| ||||||
Sbjct: 6333 cggcggcgatggaccaggcgcagcg 6309



to top

>gb|DQ350712.1| Ajellomyces capsulatus nitrosative stress induced transcription 6
            (NIT6) gene, partial sequence
          Length = 2995

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 2974 ggcaacggcaacggcaacggc 2994



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 228      cggcaacggcaacggcaacgg 248
                |||||||||||||||||||||
Sbjct: 11756939 cggcaacggcaacggcaacgg 11756959



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 226      gacggcaacggcaacggcaac 246
                |||||||||||||||||||||
Sbjct: 24149393 gacggcaacggcaacggcaac 24149373



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 228      cggcaacggcaacggcaacgg 248
                |||||||||||||||||||||
Sbjct: 40276076 cggcaacggcaacggcaacgg 40276056



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 230      gcaacggcaacggcaacggcc 250
                |||||||||||||||||||||
Sbjct: 23835526 gcaacggcaacggcaacggcc 23835546



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 256      cccttctccgtccccggcgccgacgtcg 283
                |||| ||||||||||||||||| |||||
Sbjct: 24077861 ccctcctccgtccccggcgccgtcgtcg 24077888



to top

>gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
            BACR02B19, complete sequence
          Length = 171286

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  ggcaacggcaacggcaacggc 249
            |||||||||||||||||||||
Sbjct: 9258 ggcaacggcaacggcaacggc 9278



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 9262 acggcaacggcaacggcaac 9281



to top

>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
              BACR01C11, complete sequence
          Length = 176991

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 155629 ggcaacggcaacggcaacggc 155649



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 155633 acggcaacggcaacggcaac 155652



to top

>dbj|D58420.2|ATUCRTWA Paracoccus sp. N81106 crtW, crtZ, crtY, crtI, crtB genes, complete
            cds
          Length = 5382

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 113  cggcggcgatggaccaggtgcagcg 137
            |||||||||||||||||| ||||||
Sbjct: 4728 cggcggcgatggaccaggcgcagcg 4704



to top

>dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1793G04
          Length = 156714

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 228    cggcaacggcaacggcaacgg 248
              |||||||||||||||||||||
Sbjct: 141854 cggcaacggcaacggcaacgg 141834



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 252    cgcgcccttctccgtccccgg 272
              |||||||||||||||||||||
Sbjct: 646016 cgcgcccttctccgtccccgg 646036



to top

>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0711F01
          Length = 193091

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 228    cggcaacggcaacggcaacgg 248
              |||||||||||||||||||||
Sbjct: 191573 cggcaacggcaacggcaacgg 191593



to top

>dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0477A12
          Length = 138141

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 230    gcaacggcaacggcaacggcc 250
              |||||||||||||||||||||
Sbjct: 132678 gcaacggcaacggcaacggcc 132658



to top

>dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0681B11
          Length = 144091

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 230    gcaacggcaacggcaacggcc 250
              |||||||||||||||||||||
Sbjct: 116111 gcaacggcaacggcaacggcc 116131



to top

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           BAC clone:OJ1218_C12
          Length = 105861

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 230 gcaacggcaacggcaacggcc 250
           |||||||||||||||||||||
Sbjct: 615 gcaacggcaacggcaacggcc 595



to top

>dbj|AK120689.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169E21, full
           insert sequence
          Length = 2172

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 cggcaacggcaacggcaacgg 248
           |||||||||||||||||||||
Sbjct: 526 cggcaacggcaacggcaacgg 546



to top

>dbj|AK120157.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030D19, full
           insert sequence
          Length = 1665

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 230 gcaacggcaacggcaacggcc 250
           |||||||||||||||||||||
Sbjct: 449 gcaacggcaacggcaacggcc 469



to top

>dbj|AK110890.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-H07, full
            insert sequence
          Length = 1680

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 230  gcaacggcaacggcaacggcc 250
            |||||||||||||||||||||
Sbjct: 1172 gcaacggcaacggcaacggcc 1152



to top

>dbj|AK108737.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D10, full
           insert sequence
          Length = 817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 230 gcaacggcaacggcaacggcc 250
           |||||||||||||||||||||
Sbjct: 175 gcaacggcaacggcaacggcc 155



to top

>emb|AJ330947.1|HSA330947 Homo sapiens genomic sequence surrounding NotI site, clone
           NL6-BF11RS
          Length = 763

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 174 gcaggccatggcgcccggcct 194
           |||||||||||||||||||||
Sbjct: 212 gcaggccatggcgcccggcct 232



to top

>gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12 of 118 of the complete
              sequence
          Length = 301379

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 207038 ggcaacggcaacggcaacggc 207058



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 207042 acggcaacggcaacggcaac 207061



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 225    cgacggcaacggcaacggcaacggc 249
              |||||||||||||||||| ||||||
Sbjct: 382526 cgacggcaacggcaacggaaacggc 382550



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 226     gacggcaacggcaacggcaacggc 249
               ||||||||||||| ||||||||||
Sbjct: 2426719 gacggcaacggcaccggcaacggc 2426742



to top

>gb|AC147558.3| Mus musculus BAC clone RP23-470N2 from 8, complete sequence
          Length = 212626

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    ggcaacggcaacggcaacggc 249
              |||||||||||||||||||||
Sbjct: 137895 ggcaacggcaacggcaacggc 137875



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 229     ggcaacggcaacggcaacggc 249
               |||||||||||||||||||||
Sbjct: 4032494 ggcaacggcaacggcaacggc 4032514



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 227     acggcaacggcaacggcaac 246
               ||||||||||||||||||||
Sbjct: 4032498 acggcaacggcaacggcaac 4032517



to top

>gb|AC152981.2| Mus musculus 10 BAC RP23-154M15 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 200104

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 225   cgacggcaacggcaacggcaacggc 249
             ||||||||||||||||||| |||||
Sbjct: 84230 cgacggcaacggcaacggcgacggc 84254



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 225   cgacggcaacggcaacggcaacggc 249
             ||||||| |||||||||||||||||
Sbjct: 84224 cgacggcgacggcaacggcaacggc 84248



to top

>dbj|AB012145.1| Streptomyces lividans mRNA encoding metallothionein-like domain,
           complete cds
          Length = 1109

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 185 cgcccggcctcggcgagcggc 205
           |||||||||||||||||||||
Sbjct: 431 cgcccggcctcggcgagcggc 411



to top

>ref|XM_467014.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 324

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 tcgacggcaacggcaacggc 243
           ||||||||||||||||||||
Sbjct: 221 tcgacggcaacggcaacggc 240



to top

>ref|XM_466682.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1671

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  cccggcctcggcgagcggcg 206
            ||||||||||||||||||||
Sbjct: 1073 cccggcctcggcgagcggcg 1054



to top

>ref|XM_506864.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1004_A05.15 mRNA
          Length = 1716

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  cccggcctcggcgagcggcg 206
            ||||||||||||||||||||
Sbjct: 1073 cccggcctcggcgagcggcg 1054



to top

>ref|NM_192727.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 4299

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 256 cccttctccgtccccggcgccgacgtcg 283
           |||| ||||||||||||||||| |||||
Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210



to top

>gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, complete sequence
          Length = 268984

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 188    ccggcctcggcgagcggcgg 207
              ||||||||||||||||||||
Sbjct: 160132 ccggcctcggcgagcggcgg 160151



to top

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 169   gacgagcaggccatggcgcccggc 192
             |||| |||||||||||||||||||
Sbjct: 15363 gacgggcaggccatggcgcccggc 15386



to top

>ref|XM_365446.1| Magnaporthe grisea 70-15 hypothetical protein (MG02148.4) partial
            mRNA
          Length = 2160

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 1622 acggcaacggcaacggcaac 1641



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 230  gcaacggcaacggcaacggc 249
            ||||||||||||||||||||
Sbjct: 1619 gcaacggcaacggcaacggc 1638



to top

>ref|XM_362442.1| Magnaporthe grisea 70-15 hypothetical protein (MG08025.4) partial
            mRNA
          Length = 4995

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 229  ggcaacggcaacggcaacgg 248
            ||||||||||||||||||||
Sbjct: 2347 ggcaacggcaacggcaacgg 2366



to top

>gb|AE009066.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 92 of
            256 of the complete sequence
          Length = 10606

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 174  gcaggccatggcgcccggcc 193
            ||||||||||||||||||||
Sbjct: 7514 gcaggccatggcgcccggcc 7533



to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 893839 gcaacggcaacggcaacggc 893820



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 893836 acggcaacggcaacggcaac 893817



to top

>ref|XM_883507.1| Leishmania major strain Friedlin hypothetical protein (L7610.03)
            partial mRNA
          Length = 3840

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 226  gacggcaacggcaacggcaacggc 249
            |||||||| |||||||||||||||
Sbjct: 3589 gacggcaatggcaacggcaacggc 3612



to top

>ref|XM_751684.1| Ustilago maydis 521 hypothetical protein (UM00630.1) partial mRNA
          Length = 2568

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 230  gcaacggcaacggcaacggc 249
            ||||||||||||||||||||
Sbjct: 2156 gcaacggcaacggcaacggc 2175



to top

>ref|XM_752624.1| Ustilago maydis 521 hypothetical protein (UM01570.1) partial mRNA
          Length = 6954

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 1916 acggcaacggcaacggcaac 1935



to top

>ref|XM_753523.1| Ustilago maydis 521 hypothetical protein (UM02469.1) partial mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 227 acggcaacggcaacggcaacggcc 250
           ||||||||||||||||| ||||||
Sbjct: 701 acggcaacggcaacggccacggcc 724



to top

>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 226    gacggcaacggcaacggcaacggc 249
              |||||||| |||||||||||||||
Sbjct: 121611 gacggcaatggcaacggcaacggc 121588



to top

>ref|XM_385837.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05661.1)
           partial mRNA
          Length = 2184

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 35  acggcaacggcaacggcaac 54



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 230 gcaacggcaacggcaacggc 249
           ||||||||||||||||||||
Sbjct: 32  gcaacggcaacggcaacggc 51



to top

>ref|XM_381644.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01468.1)
           partial mRNA
          Length = 1380

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 953 acggcaacggcaacggcaac 972



to top

>emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete chromosome; segment 9/12
          Length = 323450

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    gccatggcgcccggcctcgg 197
              ||||||||||||||||||||
Sbjct: 135288 gccatggcgcccggcctcgg 135269



to top

>gb|AY271618.1| Oryza sativa (indica cultivar-group) PDR-type ABC transporter 9
           mRNA, complete cds
          Length = 4700

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 256 cccttctccgtccccggcgccgacgtcg 283
           |||| ||||||||||||||||| |||||
Sbjct: 256 ccctcctccgtccccggcgccgtcgtcg 229



to top

>gb|AC166543.2| Nectria haematococca clone JGIAYWI-5I13, complete sequence
          Length = 40607

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   gcaacggcaacggcaacggc 249
             ||||||||||||||||||||
Sbjct: 19892 gcaacggcaacggcaacggc 19911



to top

>emb|Z30236.1|NPHALCYA N.pharaonis (SP1/28) gene for halocyanin
          Length = 620

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 ggcaacggcaacggcaacgg 248
           ||||||||||||||||||||
Sbjct: 141 ggcaacggcaacggcaacgg 160



to top

>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 231   caacggcaacggcaacggcc 250
             ||||||||||||||||||||
Sbjct: 86979 caacggcaacggcaacggcc 86998



to top

>emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II BAC contig B24N11
          Length = 129306

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   gcaacggcaacggcaacggc 249
             ||||||||||||||||||||
Sbjct: 40487 gcaacggcaacggcaacggc 40506



to top

>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete
             sequence
          Length = 153247

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   cggcctcggcgagcggcggg 208
             ||||||||||||||||||||
Sbjct: 37788 cggcctcggcgagcggcggg 37769



to top

>emb|AL138972.1|DMBR25B3 Drosophila melanogaster BAC clone BACR25B3
          Length = 154329

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 2579 acggcaacggcaacggcaac 2560



to top

>emb|AL035245.1|DMBH61I5 Drosophila melanogaster BAC clone BACH61I5
          Length = 29358

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 14578 acggcaacggcaacggcaac 14559



to top

>gb|AC104054.6| Drosophila melanogaster X BAC RP98-21G11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170347

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 58917 acggcaacggcaacggcaac 58898



to top

>gb|AC105055.2| Drosophila melanogaster X BAC RP98-5N9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 169618

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 98610 acggcaacggcaacggcaac 98591



to top

>tpg|BK002977.1| TPA: TPA_inf: Drosophila melanogaster HDC17114 (HDC17114) gene,
           complete cds
          Length = 924

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 833 acggcaacggcaacggcaac 814



to top

>ref|NM_176746.1| Drosophila melanogaster forked CG5424-RC, transcript variant C (f),
            mRNA
          Length = 5587

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 229  ggcaacggcaacggcaacgg 248
            ||||||||||||||||||||
Sbjct: 3464 ggcaacggcaacggcaacgg 3483



to top

>ref|NM_176745.1| Drosophila melanogaster forked CG5424-RD, transcript variant D (f),
            mRNA
          Length = 4968

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 229  ggcaacggcaacggcaacgg 248
            ||||||||||||||||||||
Sbjct: 2845 ggcaacggcaacggcaacgg 2864



to top

>ref|NM_167563.2| Drosophila melanogaster forked CG5424-RA, transcript variant A (f),
           mRNA
          Length = 2540

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 ggcaacggcaacggcaacgg 248
           ||||||||||||||||||||
Sbjct: 417 ggcaacggcaacggcaacgg 436



to top

>ref|NM_143605.2| Drosophila melanogaster CG11339-RA (CG11339), mRNA
          Length = 3855

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 230  gcaacggcaacggcaacggc 249
            ||||||||||||||||||||
Sbjct: 1013 gcaacggcaacggcaacggc 1032



to top

>ref|NM_078660.2| Drosophila melanogaster forked CG5424-RB, transcript variant B (f),
            mRNA
          Length = 5476

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 229  ggcaacggcaacggcaacgg 248
            ||||||||||||||||||||
Sbjct: 3353 ggcaacggcaacggcaacgg 3372



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 174     gcaggccatggcgcccggcc 193
               ||||||||||||||||||||
Sbjct: 1015329 gcaggccatggcgcccggcc 1015348



to top

>gb|AF472590.1| Sinorhizobium meliloti JJ1c10 hypothetical transmembrane protein,
            hypothetical protein, hypothetical transmembrane protein,
            hypothetical protein, aspartate aminotransferase A
            (aatA), hypothetical protein, putative oxidoreductase
            protein, and putative oxidoreductase protein genes,
            complete cds; and putative transcription regulator
            protein gene, partial cds
          Length = 7402

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 178  gccatggcgcccggcctcgg 197
            ||||||||||||||||||||
Sbjct: 2996 gccatggcgcccggcctcgg 3015



to top

>gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F-15F, BAC clone
              BACR01K05, complete sequence
          Length = 162761

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 229    ggcaacggcaacggcaacgg 248
              ||||||||||||||||||||
Sbjct: 125094 ggcaacggcaacggcaacgg 125075



to top

>gb|AY029175.1| Cavia porcellus F-box protein OCP1 (OCP1) mRNA, complete cds
          Length = 1180

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 acggcgggcaggacgctgtc 335
           ||||||||||||||||||||
Sbjct: 891 acggcgggcaggacgctgtc 910



to top

>gb|AC008326.9| Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone
             BACR39J17, complete sequence
          Length = 148780

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 71735 acggcaacggcaacggcaac 71754



to top

>gb|DQ355211.1| Phytophthora sojae cell 5A endo-1,4-betaglucanase (EGL-V.8) mRNA,
           complete cds
          Length = 1845

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 146 acggcaacggcaacggcaac 165



to top

>tpg|BK001017.1| TPA: TPA_exp: Oryza sativa (japonica cultivar-group) isolate
           P0410E03.7 PDR3 ABC transporter (pdr3) gene, complete
           cds
          Length = 6575

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 256 cccttctccgtccccggcgccgacgtcg 283
           |||| ||||||||||||||||| |||||
Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210



to top

>gb|AC012096.8|AC012096 Drosophila melanogaster, chromosome X, region 15E-15F, BAC clone
              BACR18O02, complete sequence
          Length = 177793

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 229    ggcaacggcaacggcaacgg 248
              ||||||||||||||||||||
Sbjct: 126120 ggcaacggcaacggcaacgg 126139



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 787953 acggcaacggcaacggcaac 787972



to top

>gb|AC007977.12|AC007977 Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone
              BACR13J07, complete sequence
          Length = 174287

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 128437 acggcaacggcaacggcaac 128456



to top

>gb|AC010995.11|AC010995 Drosophila melanogaster, chromosome X, region 12A-12A, BAC clone
             BACR30C16, complete sequence
          Length = 185810

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 228   cggcaacggcaacggcaacggccc 251
             ||||| ||||||||||||||||||
Sbjct: 78702 cggcagcggcaacggcaacggccc 78679



to top

>gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, region 100C-100C, BAC clone
             BACR02G16, complete sequence
          Length = 177480

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   gcaacggcaacggcaacggc 249
             ||||||||||||||||||||
Sbjct: 10519 gcaacggcaacggcaacggc 10538



to top

>dbj|AP002844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0410E03
          Length = 164839

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 256   cccttctccgtccccggcgccgacgtcg 283
             |||| ||||||||||||||||| |||||
Sbjct: 53683 ccctcctccgtccccggcgccgtcgtcg 53710



to top

>gb|AC137069.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0009C19, from chromosome 3, complete sequence
          Length = 131709

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 229   ggcaacggcaacggcaacgg 248
             ||||||||||||||||||||
Sbjct: 40716 ggcaacggcaacggcaacgg 40697



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 184     gcgcccggcctcggcgagcg 203
               ||||||||||||||||||||
Sbjct: 3790165 gcgcccggcctcggcgagcg 3790184



to top

>dbj|AP004818.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0551A03
          Length = 173027

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   ccccggcgccgacgtcggcg 286
             ||||||||||||||||||||
Sbjct: 97967 ccccggcgccgacgtcggcg 97948



to top

>dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0624H09
          Length = 158719

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   cggcaacggcaacggcaacg 247
             ||||||||||||||||||||
Sbjct: 95778 cggcaacggcaacggcaacg 95759



to top

>dbj|AP005291.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1282_H11
          Length = 143314

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 224   tcgacggcaacggcaacggc 243
             ||||||||||||||||||||
Sbjct: 73991 tcgacggcaacggcaacggc 74010



to top

>dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1004_A05
          Length = 174290

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   cccggcctcggcgagcggcg 206
             ||||||||||||||||||||
Sbjct: 62106 cccggcctcggcgagcggcg 62087



to top

>dbj|AK110597.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-G01, full
           insert sequence
          Length = 1311

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 229 ggcaacggcaacggcaacgg 248
           ||||||||||||||||||||
Sbjct: 621 ggcaacggcaacggcaacgg 640



to top

>dbj|AK108390.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-F04, full
           insert sequence
          Length = 920

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 ccccggcgccgacgtcggcg 286
           ||||||||||||||||||||
Sbjct: 302 ccccggcgccgacgtcggcg 321



to top

>dbj|AK104319.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-E04, full
            insert sequence
          Length = 1671

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  cccggcctcggcgagcggcg 206
            ||||||||||||||||||||
Sbjct: 1073 cccggcctcggcgagcggcg 1054



to top

>dbj|AK060705.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-G09, full
            insert sequence
          Length = 1714

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  cccggcctcggcgagcggcg 206
            ||||||||||||||||||||
Sbjct: 1071 cccggcctcggcgagcggcg 1052



to top

>gb|AY105287.1| Zea mays PCO135091 mRNA sequence
          Length = 825

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 acggcaacggcaacggcaac 246
           ||||||||||||||||||||
Sbjct: 766 acggcaacggcaacggcaac 785



to top

>gb|AE003615.3| Drosophila melanogaster chromosome 2L, section 24 of 83 of the complete
              sequence
          Length = 270751

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 264931 acggcaacggcaacggcaac 264950



to top

>gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 115 of 118 of the complete
              sequence
          Length = 232290

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    gcaacggcaacggcaacggc 249
              ||||||||||||||||||||
Sbjct: 225016 gcaacggcaacggcaacggc 225035



to top

>gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 of 74 of the complete
             sequence
          Length = 314205

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   ggcaacggcaacggcaacgg 248
             ||||||||||||||||||||
Sbjct: 41305 ggcaacggcaacggcaacgg 41324



to top

>gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 of 74 of the complete
             sequence
          Length = 307761

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 228   cggcaacggcaacggcaacggccc 251
             ||||| ||||||||||||||||||
Sbjct: 31409 cggcagcggcaacggcaacggccc 31386



to top

>gb|AE003424.2| Drosophila melanogaster chromosome X, section 8 of 74 of the complete
             sequence
          Length = 274777

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   acggcaacggcaacggcaac 246
             ||||||||||||||||||||
Sbjct: 94247 acggcaacggcaacggcaac 94228



to top

>gb|AE003422.2| Drosophila melanogaster chromosome X, section 6 of 74 of the complete
              sequence
          Length = 300933

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    acggcaacggcaacggcaac 246
              ||||||||||||||||||||
Sbjct: 225587 acggcaacggcaacggcaac 225568



to top

>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome
          Length = 2153922

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 225     cgacggcaacggcaacggcaacgg 248
               ||||||| ||||||||||||||||
Sbjct: 1073572 cgacggcgacggcaacggcaacgg 1073595



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 225    cgacggcaacggcaacggcaacgg 248
              ||||||| ||||||||||||||||
Sbjct: 461515 cgacggcgacggcaacggcaacgg 461492



to top

>emb|AJ535046.1|OSA535046 Oryza sativa (japonica cultivar-group) pdr9 gene for PDR-like ABC
           transporter, exons 1-21
          Length = 6575

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 256 cccttctccgtccccggcgccgacgtcg 283
           |||| ||||||||||||||||| |||||
Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 335     cgaccgccgccagctcgccgacca 358
               |||||||||||||| |||||||||
Sbjct: 2845756 cgaccgccgccagcccgccgacca 2845779



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 312     gccgacggcgggcaggacgctgtcgacc 339
               |||||||||||||| ||||||| |||||
Sbjct: 4473767 gccgacggcgggcaagacgctgccgacc 4473740



to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    cggcaacggcaacggcaacg 247
              ||||||||||||||||||||
Sbjct: 871513 cggcaacggcaacggcaacg 871532



to top

>emb|X05177.1|DFUBX1 Drosophila funebris ubx (Ultrabithorax) gene 5' region
          Length = 3002

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 227  acggcaacggcaacggcaac 246
            ||||||||||||||||||||
Sbjct: 1109 acggcaacggcaacggcaac 1090



to top

>emb|X69871.1|DMFORKEDA D.melanogaster putative f gene
          Length = 19408

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   ggcaacggcaacggcaacgg 248
             ||||||||||||||||||||
Sbjct: 15260 ggcaacggcaacggcaacgg 15279



to top

>dbj|D21203.2|DROFP Drosophila melanogaster forked mRNA for large Forked protein,
            complete cds
          Length = 5472

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 229  ggcaacggcaacggcaacgg 248
            ||||||||||||||||||||
Sbjct: 3353 ggcaacggcaacggcaacgg 3372


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,377,259
Number of Sequences: 3902068
Number of extensions: 2377259
Number of successful extensions: 62874
Number of sequences better than 10.0: 233
Number of HSP's better than 10.0 without gapping: 244
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57102
Number of HSP's gapped (non-prelim): 5534
length of query: 429
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 407
effective length of database: 17,147,199,772
effective search space: 6978910307204
effective search space used: 6978910307204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top