ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl30e06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete ... 44 0.39
2gb|AE004849.1| Pseudomonas aeruginosa PAO1, section 410 of 529 o... 44 0.39
3gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 1.6
4gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 6.1
5ref|XM_743108.1| Aspergillus fumigatus Af293 hypothetical protei... 40 6.1
6emb|AJ632203.2| Streptomyces antibioticus oviedomycin biosynthet... 40 6.1
7emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 m... 40 6.1
8emb|AJ621740.1| Gallus gallus GMCSF gene for granulocyte-macroph... 40 6.1
9gb|AC152174.15| Gasterosteus aculeatus clone ch213-202d23, compl... 40 6.1
10gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.1
11gb|AF151965.1|AF151965 Pseudomonas putida strain KT2440 proline ... 40 6.1
12gb|AF153207.1|AF153207 Pseudomonas putida proline dehydrogenase ... 40 6.1
13gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 6.1

>emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete genome; segment 16/29
          Length = 299050

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 382   ggtgaccgggacgccgcggacggcgc 407
             ||||| ||||||||||||||||||||
Sbjct: 13487 ggtgagcgggacgccgcggacggcgc 13512



to top

>gb|AE004849.1| Pseudomonas aeruginosa PAO1, section 410 of 529 of the complete
            genome
          Length = 10113

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 295  ggcgtggggcagcagcaggacg 316
            ||||||||||||||||||||||
Sbjct: 5963 ggcgtggggcagcagcaggacg 5984



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 387     ccgggacgccgcggacggcgc 407
               |||||||||||||||||||||
Sbjct: 2322538 ccgggacgccgcggacggcgc 2322558



to top

>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     gccggtgacagcgcccgccg 56
              ||||||||||||||||||||
Sbjct: 953935 gccggtgacagcgcccgccg 953916



to top

>ref|XM_743108.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g01410)
           partial mRNA
          Length = 1704

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 75  ctttttataccaccatccat 94
           ||||||||||||||||||||
Sbjct: 471 ctttttataccaccatccat 452



to top

>emb|AJ632203.2| Streptomyces antibioticus oviedomycin biosynthetic gene cluster, strain
             ATCC 11891
          Length = 24720

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   cggtgaccgggacgccgcgg 400
             ||||||||||||||||||||
Sbjct: 11990 cggtgaccgggacgccgcgg 11971



to top

>emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 map 22q22.3, complete
              sequence
          Length = 185080

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 295    ggcgtggggcagcagcaggacggc 318
              ||||||||| ||||||||||||||
Sbjct: 153362 ggcgtgggggagcagcaggacggc 153385



to top

>emb|AJ621740.1| Gallus gallus GMCSF gene for granulocyte-macrophage colony-stimulating
             factor and IL3 gene for interleukin-3, BAC bCHORI92M14
             clone, contig 1
          Length = 54760

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    ccgtccgtccgtccactcca 73
             ||||||||||||||||||||
Sbjct: 16844 ccgtccgtccgtccactcca 16863



to top

>gb|AC152174.15| Gasterosteus aculeatus clone ch213-202d23, complete sequence
          Length = 174464

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    cgccgtccgtccgtccactc 71
             ||||||||||||||||||||
Sbjct: 66426 cgccgtccgtccgtccactc 66445



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 363    gacgtggacggctcgccccggtgaccgggacg 394
              |||| |||||||||||| ||||||||| ||||
Sbjct: 392992 gacggggacggctcgccacggtgaccgcgacg 393023



to top

>gb|AF151965.1|AF151965 Pseudomonas putida strain KT2440 proline dehydrogenase (putA) gene,
            complete cds
          Length = 5162

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 304  cagcagcaggacggcgaagg 323
            ||||||||||||||||||||
Sbjct: 3704 cagcagcaggacggcgaagg 3723



to top

>gb|AF153207.1|AF153207 Pseudomonas putida proline dehydrogenase (putA) and proline permease
            (putP) genes, complete cds
          Length = 8660

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 304  cagcagcaggacggcgaagg 323
            ||||||||||||||||||||
Sbjct: 1459 cagcagcaggacggcgaagg 1440



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 304     cagcagcaggacggcgaagg 323
               ||||||||||||||||||||
Sbjct: 5633817 cagcagcaggacggcgaagg 5633836


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,340,989
Number of Sequences: 3902068
Number of extensions: 2340989
Number of successful extensions: 66857
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66635
Number of HSP's gapped (non-prelim): 222
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top