ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl30c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.5
2ref|NM_027326.2| Mus musculus myeloid/lymphoid or mixed lineage-... 40 6.5
3ref|XM_572505.1| Cryptococcus neoformans var. neoformans JEC21 u... 40 6.5
4gb|AC130826.4| Mus musculus BAC clone RP23-400F13 from chromosom... 40 6.5
5gb|AC129315.3| Mus musculus BAC clone RP23-407E2 from chromosome... 40 6.5
6gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, comple... 40 6.5
7gb|AC141110.7| Medicago truncatula clone mth2-17i10, complete se... 40 6.5
8emb|AL590405.19| Human DNA sequence from clone RP11-124M24 on ch... 40 6.5
9emb|AL135911.16| Human DNA sequence from clone RP3-439I14 on chr... 40 6.5
10gb|BC021420.1| Mus musculus myeloid/lymphoid or mixed lineage-le... 40 6.5
11gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, co... 40 6.5
12gb|AF464167.1| Mus musculus protocadherin gamma gene, exon 3 and... 40 6.5
13dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 40 6.5
14dbj|AK136066.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 6.5
15gb|AC010198.8| Homo sapiens 12p11-37.2-54.4 BAC RP11-77I22 (Rosw... 40 6.5
16dbj|AK145442.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu... 40 6.5
17gb|AY283928.2| Bacteriophage KVP40, complete genome 40 6.5
18dbj|AK045331.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 40 6.5
19gb|AC018951.8|AC018951 Homo sapiens chromosome 11, clone RP11-30... 40 6.5
20gb|AF333960.1|AF333960 Mus musculus AF9 mRNA, partial cds 40 6.5
21gb|AC084866.5| Homo sapiens BAC clone RP11-6E9 from 4, complete ... 40 6.5
22gb|AC020969.2|AC020969 Mus musculus chromosome 18 clone RP23-19K... 40 6.5
23emb|AL806533.8| Mouse DNA sequence from clone RP23-468I23 on chr... 40 6.5

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 113    gaccaaggtggaaatgtaaatgaa 136
              |||||||||||||||| |||||||
Sbjct: 146870 gaccaaggtggaaatgaaaatgaa 146847



to top

>ref|NM_027326.2| Mus musculus myeloid/lymphoid or mixed lineage-leukemia translocation
            to 3 homolog (Drosophila) (Mllt3), transcript variant 1,
            mRNA
          Length = 3220

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  gtgagacttcagagaagaag 274
            ||||||||||||||||||||
Sbjct: 1179 gtgagacttcagagaagaag 1198



to top

>ref|XM_572505.1| Cryptococcus neoformans var. neoformans JEC21 ubiquitin-protein
            ligase (CNH03370) partial mRNA
          Length = 2810

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 113  gaccaaggtggaaatgtaaatgaa 136
            |||||||||||||||| |||||||
Sbjct: 1896 gaccaaggtggaaatgaaaatgaa 1919



to top

>gb|AC130826.4| Mus musculus BAC clone RP23-400F13 from chromosome 16, complete sequence
          Length = 186059

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     agagaagctggtttgacaaa 39
              ||||||||||||||||||||
Sbjct: 102774 agagaagctggtttgacaaa 102755



to top

>gb|AC129315.3| Mus musculus BAC clone RP23-407E2 from chromosome 18, complete sequence
          Length = 183462

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 362   aaggcttcaaatacctgtcc 381
             ||||||||||||||||||||
Sbjct: 39868 aaggcttcaaatacctgtcc 39849



to top

>gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, complete sequence
          Length = 211624

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 426    cacacatagatcagtgcctt 445
              ||||||||||||||||||||
Sbjct: 113909 cacacatagatcagtgcctt 113928



to top

>gb|AC141110.7| Medicago truncatula clone mth2-17i10, complete sequence
          Length = 113345

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 243   ttggttcatcacgtgagacttcag 266
             ||||||||||||| ||||||||||
Sbjct: 45152 ttggttcatcacgcgagacttcag 45175



to top

>emb|AL590405.19| Human DNA sequence from clone RP11-124M24 on chromosome 1 Contains part
             of a novel gene (KIAA1573), complete sequence
          Length = 133791

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   agaagggcaagttgctagtcaagt 293
             |||||||||||||||| |||||||
Sbjct: 50708 agaagggcaagttgcttgtcaagt 50731



to top

>emb|AL135911.16| Human DNA sequence from clone RP3-439I14 on chromosome 6q16.3-22.1
             Contains part of a novel gene, part of the gene for a
             novel protein similar to FLJ12457 (contains a 'Cold-shock'
             DNA-binding domain). Contains two CpG islands, complete
             sequence
          Length = 108907

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 411   ataccactttgaatgcacacatag 434
             ||||||||||||| ||||||||||
Sbjct: 11735 ataccactttgaaggcacacatag 11758



to top

>gb|BC021420.1| Mus musculus myeloid/lymphoid or mixed lineage-leukemia translocation
            to 3 homolog (Drosophila), transcript variant 1, mRNA
            (cDNA clone MGC:29198 IMAGE:5012671), complete cds
          Length = 3220

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  gtgagacttcagagaagaag 274
            ||||||||||||||||||||
Sbjct: 1179 gtgagacttcagagaagaag 1198



to top

>gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, complete sequence
          Length = 191630

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    caggaagataatatttgcag 189
              ||||||||||||||||||||
Sbjct: 107764 caggaagataatatttgcag 107783



to top

>gb|AF464167.1| Mus musculus protocadherin gamma gene, exon 3 and partial cds
          Length = 6440

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 362  aaggcttcaaatacctgtcc 381
            ||||||||||||||||||||
Sbjct: 6029 aaggcttcaaatacctgtcc 6010



to top

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 14      aaagctagagaagctggttt 33
               ||||||||||||||||||||
Sbjct: 1216305 aaagctagagaagctggttt 1216324



to top

>dbj|AK136066.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420452G02
           product:myeloid/lymphoid or mixed lineage-leukemia
           translocation to 3 homolog (Drosophila), full insert
           sequence
          Length = 2717

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 gtgagacttcagagaagaag 274
           ||||||||||||||||||||
Sbjct: 573 gtgagacttcagagaagaag 592



to top

>gb|AC010198.8| Homo sapiens 12p11-37.2-54.4 BAC RP11-77I22 (Roswell Park Cancer
              Institute Human BAC Library) complete sequence
          Length = 199070

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    aagaagggcaagttgctagt 288
              ||||||||||||||||||||
Sbjct: 142901 aagaagggcaagttgctagt 142920



to top

>dbj|AK145442.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN full-length enriched
           library, clone:I0C0045K23 product:myeloid/lymphoid or
           mixed lineage-leukemia translocation to 3 homolog
           (Drosophila), full insert sequence
          Length = 3166

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 255 gtgagacttcagagaagaag 274
           ||||||||||||||||||||
Sbjct: 853 gtgagacttcagagaagaag 872



to top

>gb|AY283928.2| Bacteriophage KVP40, complete genome
          Length = 244834

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 462    ccgagccagtcgtagagacg 481
              ||||||||||||||||||||
Sbjct: 229311 ccgagccagtcgtagagacg 229330



to top

>dbj|AK045331.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
            enriched library, clone:B130065N20 product:SIMILAR TO
            MYELOID/LYMPHOID OR MIXED-LINEAGE LEUKEMIA (TRITHORAX
            HOMOLOG, DROSOPHILA), TRANSLOCATED TO, 3 homolog [Mus
            musculus], full insert sequence
          Length = 4538

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  gtgagacttcagagaagaag 274
            ||||||||||||||||||||
Sbjct: 1175 gtgagacttcagagaagaag 1194



to top

>gb|AC018951.8|AC018951 Homo sapiens chromosome 11, clone RP11-307P14, complete sequence
          Length = 194547

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 31    tttgacaaatgtgaatacaactgg 54
             |||||||||||| |||||||||||
Sbjct: 95789 tttgacaaatgtaaatacaactgg 95812



to top

>gb|AF333960.1|AF333960 Mus musculus AF9 mRNA, partial cds
          Length = 1699

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  gtgagacttcagagaagaag 274
            ||||||||||||||||||||
Sbjct: 1001 gtgagacttcagagaagaag 1020



to top

>gb|AC084866.5| Homo sapiens BAC clone RP11-6E9 from 4, complete sequence
          Length = 196852

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   cttcagagaagaagggcaag 280
             ||||||||||||||||||||
Sbjct: 19378 cttcagagaagaagggcaag 19359



to top

>gb|AC020969.2|AC020969 Mus musculus chromosome 18 clone RP23-19K11, complete sequence
          Length = 179771

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 362    aaggcttcaaatacctgtcc 381
              ||||||||||||||||||||
Sbjct: 109920 aaggcttcaaatacctgtcc 109939



to top

>emb|AL806533.8| Mouse DNA sequence from clone RP23-468I23 on chromosome 4, complete
             sequence
          Length = 201226

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 255   gtgagacttcagagaagaag 274
             ||||||||||||||||||||
Sbjct: 52155 gtgagacttcagagaagaag 52136


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,516,425
Number of Sequences: 3902068
Number of extensions: 4516425
Number of successful extensions: 181941
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 181857
Number of HSP's gapped (non-prelim): 84
length of query: 484
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 462
effective length of database: 17,147,199,772
effective search space: 7922006294664
effective search space used: 7922006294664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top