ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl29c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_507356.1| PREDICTED Oryza sativa (japonica cultivar-group... 307 2e-80
2ref|XM_476865.1| Oryza sativa (japonica cultivar-group), mRNA 307 2e-80
3ref|XM_507355.1| PREDICTED Oryza sativa (japonica cultivar-group... 307 2e-80
4ref|XM_507354.1| PREDICTED Oryza sativa (japonica cultivar-group... 307 2e-80
5ref|XM_506197.2| PREDICTED Oryza sativa (japonica cultivar-group... 307 2e-80
6dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 307 2e-80
7dbj|AP003800.3| Oryza sativa (japonica cultivar-group) genomic D... 307 2e-80
8dbj|AK104504.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
9dbj|AK104629.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
10dbj|AK104447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
11dbj|AK060963.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
12dbj|AK060711.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
13gb|BT016670.1| Zea mays clone Contig503 mRNA sequence 285 6e-74
14ref|NM_185075.1| Oryza sativa (japonica cultivar-group), mRNA 276 6e-71
15gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genom... 276 6e-71
16gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 276 6e-71
17gb|AC093713.6| Oryza sativa chromosome 3 BAC OSJNBa0094F01 genom... 276 6e-71
18dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 276 6e-71
19gb|BT016602.1| Zea mays clone Contig435 mRNA sequence 256 5e-65
20gb|AF134732.1|AF134732 Prunus armeniaca 60S ribosomal protein L1... 151 2e-33
21ref|XM_323058.1| Neurospora crassa OR74A hypothetical protein (N... 135 1e-28
22ref|XM_956011.1| Neurospora crassa OR74A hypothetical protein (N... 135 1e-28
23emb|BX071698.1|CNS09RHI Single read from an extremity of a full-... 129 8e-27
24emb|BX071539.1|CNS09RD3 Single read from an extremity of a full-... 129 8e-27
25emb|BX071106.1|CNS09R12 Single read from an extremity of a full-... 129 8e-27
26emb|BX071300.1|CNS09R6G Single read from an extremity of a full-... 129 8e-27
27emb|BX070109.1|CNS09Q9D Single read from an extremity of a full-... 129 8e-27
28emb|BX069884.1|CNS09Q34 Single read from an extremity of a full-... 129 8e-27
29emb|BX068549.1|CNS09P21 Single read from an extremity of a full-... 129 8e-27
30emb|BX068537.1|CNS09P1P Single read from an extremity of a full-... 129 8e-27
31emb|BX067761.1|CNS09OG5 Single read from an extremity of a full-... 129 8e-27
32emb|BX067621.1|CNS09OC9 Single read from an extremity of a full-... 129 8e-27
33emb|BX067602.1|CNS09OBQ Single read from an extremity of a full-... 129 8e-27
34emb|BX066250.1|CNS09NA6 Single read from an extremity of a full-... 129 8e-27
35emb|BX066050.1|CNS09N4M Single read from an extremity of a full-... 129 8e-27
36emb|BX065642.1|CNS09MTA Single read from an extremity of a full-... 129 8e-27
37emb|BX064972.1|CNS09MAO Single read from an extremity of a full-... 129 8e-27
38emb|BX064946.1|CNS09M9Y Single read from an extremity of a full-... 129 8e-27
39emb|BX064613.1|CNS09M0P Single read from an extremity of a full-... 129 8e-27
40emb|BX064230.1|CNS09LQ2 Single read from an extremity of a full-... 129 8e-27
41emb|BX064060.1|CNS09LLC Single read from an extremity of a full-... 129 8e-27
42emb|BX063285.1|CNS09KZT Single read from an extremity of a full-... 129 8e-27
43emb|BX063035.1|CNS09KSV Single read from an extremity of a full-... 129 8e-27
44emb|BX062606.1|CNS09KGY Single read from an extremity of a full-... 129 8e-27
45emb|BX062486.1|CNS09KDM Single read from an extremity of a full-... 129 8e-27
46emb|BX060737.1|CNS09J11 Single read from an extremity of a full-... 129 8e-27
47emb|BX060695.1|CNS09IZV Single read from an extremity of a full-... 129 8e-27
48emb|BX059648.1|CNS09I6S Single read from an extremity of a full-... 129 8e-27
49emb|BX059093.1|CNS09HRD Single read from an extremity of a full-... 129 8e-27
50emb|BX058908.1|CNS09HM8 Single read from an extremity of a full-... 129 8e-27
51emb|BX058752.1|CNS09HHW Single read from an extremity of a full-... 129 8e-27
52emb|BX058656.1|CNS09HF8 Single read from an extremity of a full-... 129 8e-27
53emb|BX058654.1|CNS09HF6 Single read from an extremity of a full-... 129 8e-27
54emb|BX057887.1|CNS09GTV Single read from an extremity of a full-... 129 8e-27
55emb|BX056228.1|CNS09FJS Single read from an extremity of a full-... 129 8e-27
56emb|BX055681.1|CNS09F4L Single read from an extremity of a full-... 129 8e-27
57emb|BX054853.1|CNS09EHL Single read from an extremity of a full-... 129 8e-27
58emb|BX054427.1|CNS09E5R Single read from an extremity of a full-... 129 8e-27
59emb|BX054030.1|CNS09DUQ Single read from an extremity of a full-... 129 8e-27
60emb|BX051715.1|CNS09C2F Single read from an extremity of a full-... 129 8e-27
61emb|BX051440.1|CNS09BUS Single read from an extremity of a full-... 129 8e-27
62emb|BX051418.1|CNS09BU6 Single read from an extremity of a full-... 129 8e-27
63emb|BX050326.1|CNS09AZU Single read from an extremity of a full-... 129 8e-27
64emb|BX031031.1|CNS08W3V Single read from an extremity of a full-... 129 8e-27
65emb|BX030880.1|CNS08VZO Single read from an extremity of a full-... 129 8e-27
66emb|BX048824.1|CNS099U4 Single read from an extremity of a full-... 129 8e-27
67emb|BX048817.1|CNS099TX Single read from an extremity of a full-... 129 8e-27
68emb|BX048453.1|CNS099JT Single read from an extremity of a full-... 129 8e-27
69emb|BX047452.1|CNS098S0 Single read from an extremity of a full-... 129 8e-27
70emb|BX046088.1|CNS097Q4 Single read from an extremity of a full-... 129 8e-27
71emb|BX046005.1|CNS097NT Single read from an extremity of a full-... 129 8e-27
72emb|BX045175.1|CNS0970R Single read from an extremity of a full-... 129 8e-27
73emb|BX045169.1|CNS0970L Single read from an extremity of a full-... 129 8e-27
74emb|BX044809.1|CNS096QL Single read from an extremity of a full-... 129 8e-27
75emb|BX044681.1|CNS096N1 Single read from an extremity of a full-... 129 8e-27
76emb|BX043379.1|CNS095MV Single read from an extremity of a full-... 129 8e-27
77emb|BX042571.1|CNS0950F Single read from an extremity of a full-... 129 8e-27
78emb|BX041947.1|CNS094J3 Single read from an extremity of a full-... 129 8e-27
79emb|BX041632.1|CNS094AC Single read from an extremity of a full-... 129 8e-27
80emb|BX041411.1|CNS09447 Single read from an extremity of a full-... 129 8e-27
81emb|BX040059.1|CNS0932N Single read from an extremity of a full-... 129 8e-27
82emb|BX039722.1|CNS092TA Single read from an extremity of a full-... 129 8e-27
83emb|BX039619.1|CNS092QF Single read from an extremity of a full-... 129 8e-27
84emb|BX039363.1|CNS092JB Single read from an extremity of a full-... 129 8e-27
85emb|BX037413.1|CNS09115 Single read from an extremity of a full-... 129 8e-27
86emb|BX037122.1|CNS090T2 Single read from an extremity of a full-... 129 8e-27
87emb|BX036904.1|CNS090N0 Single read from an extremity of a full-... 129 8e-27
88emb|BX036825.1|CNS090KT Single read from an extremity of a full-... 129 8e-27
89emb|BX035067.1|CNS08Z7Z Single read from an extremity of a full-... 129 8e-27
90emb|BX034799.1|CNS08Z0J Single read from an extremity of a full-... 129 8e-27
91emb|BX034660.1|CNS08YWO Single read from an extremity of a full-... 129 8e-27
92emb|BX033560.1|CNS08Y24 Single read from an extremity of a full-... 129 8e-27
93emb|BX032994.1|CNS08XME Single read from an extremity of a full-... 129 8e-27
94emb|BX032856.1|CNS08XIK Single read from an extremity of a full-... 129 8e-27
95emb|BX032542.1|CNS08X9U Single read from an extremity of a full-... 129 8e-27
96emb|BX032047.1|CNS08WW3 Single read from an extremity of a full-... 129 8e-27
97emb|BX031890.1|CNS08WRQ Single read from an extremity of a full-... 129 8e-27
98emb|BX031850.1|CNS08WQM Single read from an extremity of a full-... 129 8e-27
99emb|BX031568.1|CNS08WIS Single read from an extremity of a full-... 129 8e-27
100emb|BX031343.1|CNS08WCJ Single read from an extremity of a full-... 129 8e-27
101emb|BX030784.1|CNS08VX0 Single read from an extremity of a full-... 129 8e-27
102emb|BX030270.1|CNS08VIQ Single read from an extremity of a full-... 129 8e-27
103emb|BX029941.1|CNS08V9L Single read from an extremity of a full-... 129 8e-27
104emb|BX029405.1|CNS08UUP Single read from an extremity of a full-... 129 8e-27
105emb|BX029718.1|CNS08V3E Single read from an extremity of a full-... 129 8e-27
106emb|BX029654.1|CNS08V1M Single read from an extremity of a full-... 129 8e-27
107emb|BX029582.1|CNS08UZM Single read from an extremity of a full-... 129 8e-27
108emb|BX028809.1|CNS08UE5 Single read from an extremity of a full-... 129 8e-27
109emb|BX022385.1|CNS08PFP Single read from an extremity of a full-... 129 8e-27
110emb|BX027803.1|CNS08TM7 Single read from an extremity of a full-... 129 8e-27
111emb|BX027324.1|CNS08T8W Single read from an extremity of a full-... 129 8e-27
112emb|BX027271.1|CNS08T7F Single read from an extremity of a full-... 129 8e-27
113emb|BX027230.1|CNS08T6A Single read from an extremity of a full-... 129 8e-27
114emb|BX027166.1|CNS08T4I Single read from an extremity of a full-... 129 8e-27
115emb|BX026891.1|CNS08SWV Single read from an extremity of a full-... 129 8e-27
116emb|BX026633.1|CNS08SPP Single read from an extremity of a full-... 129 8e-27
117emb|BX026544.1|CNS08SN8 Single read from an extremity of a full-... 129 8e-27
118emb|BX025273.1|CNS08RNX Single read from an extremity of a full-... 129 8e-27
119emb|BX025114.1|CNS08RJI Single read from an extremity of a full-... 129 8e-27
120emb|BX024925.1|CNS08RE9 Single read from an extremity of a full-... 129 8e-27
121emb|BX024604.1|CNS08R5C Single read from an extremity of a full-... 129 8e-27
122emb|BX024150.1|CNS08QSQ Single read from an extremity of a full-... 129 8e-27
123emb|BX022076.1|CNS08P74 Single read from an extremity of a full-... 129 8e-27
124emb|BX019595.1|CNS08NA7 Single read from an extremity of a full-... 129 8e-27
125emb|BX021406.1|CNS08OOI Single read from an extremity of a full-... 129 8e-27
126emb|BX020675.1|CNS08O47 Single read from an extremity of a full-... 129 8e-27
127emb|BX020239.1|CNS08NS3 Single read from an extremity of a full-... 129 8e-27
128emb|BX019840.1|CNS08NH0 Single read from an extremity of a full-... 129 8e-27
129emb|BX019458.1|CNS08N6E Single read from an extremity of a full-... 129 8e-27
130emb|BX018909.1|CNS08MR5 Single read from an extremity of a full-... 129 8e-27
131emb|BX017960.1|CNS08M0S Single read from an extremity of a full-... 129 8e-27
132emb|BX016402.1|CNS08KTI Single read from an extremity of a full-... 129 8e-27
133emb|BX015414.1|CNS08K22 Single read from an extremity of a full-... 129 8e-27
134emb|BX015216.1|CNS08JWK Single read from an extremity of a full-... 129 8e-27
135emb|BX015196.1|CNS08JW0 Single read from an extremity of a full-... 129 8e-27
136emb|BX014706.1|CNS08JIE Single read from an extremity of a full-... 129 8e-27
137emb|BX014916.1|CNS08JO8 Single read from an extremity of a full-... 129 8e-27
138emb|BX014856.1|CNS08JMK Single read from an extremity of a full-... 129 8e-27
139emb|BX013748.1|CNS08IRS Single read from an extremity of a full-... 129 8e-27
140emb|BX013627.1|CNS08IOF Single read from an extremity of a full-... 129 8e-27
141emb|BX013270.1|CNS08IEI Single read from an extremity of a full-... 129 8e-27
142emb|BX012265.1|CNS08HML Single read from an extremity of a full-... 129 8e-27
143emb|BX011982.1|CNS08HEQ Single read from an extremity of a full-... 129 8e-27
144emb|BX011974.1|CNS08HEI Single read from an extremity of a full-... 129 8e-27
145emb|BX010132.1|CNS08FZC Single read from an extremity of a full-... 129 8e-27
146emb|BX010011.1|CNS08FVZ Single read from an extremity of a full-... 129 8e-27
147emb|BX009959.1|CNS08FUJ Single read from an extremity of a full-... 129 8e-27
148emb|BX009257.1|CNS08FB1 Single read from an extremity of a full-... 129 8e-27
149emb|BX008853.1|CNS08EZT Single read from an extremity of a full-... 129 8e-27
150emb|BX008455.1|CNS08EOR Single read from an extremity of a full-... 129 8e-27
151emb|BX007776.1|CNS08E5W Single read from an extremity of a full-... 129 8e-27
152emb|BX005962.1|CNS08CRI Single read from an extremity of a full-... 129 8e-27
153emb|BX005882.1|CNS08CPA Single read from an extremity of a full-... 129 8e-27
154emb|BX005776.1|CNS08CMC Single read from an extremity of a full-... 129 8e-27
155emb|BX005555.1|CNS08CG7 Single read from an extremity of a full-... 129 8e-27
156ref|XM_312665.2| Anopheles gambiae str. PEST ENSANGP00000020662 ... 129 8e-27
157emb|BX016572.1|CNS08KY8 Single read from an extremity of a full-... 125 1e-25
158emb|BX053942.1|CNS09DSA Single read from an extremity of a full-... 123 5e-25
159emb|BX036130.1|CNS0901I Single read from an extremity of a full-... 123 5e-25
160emb|BX071015.1|CNS09QYJ Single read from an extremity of a full-... 121 2e-24
161emb|BX070157.1|CNS09QAP Single read from an extremity of a full-... 121 2e-24
162emb|BX068805.1|CNS09P95 Single read from an extremity of a full-... 121 2e-24
163emb|BX060249.1|CNS09INH Single read from an extremity of a full-... 121 2e-24
164emb|BX057837.1|CNS09GSH Single read from an extremity of a full-... 121 2e-24
165emb|BX049803.1|CNS09ALB Single read from an extremity of a full-... 121 2e-24
166emb|BX046083.1|CNS097PZ Single read from an extremity of a full-... 121 2e-24
167emb|BX044586.1|CNS096KE Single read from an extremity of a full-... 121 2e-24
168emb|BX043521.1|CNS095QT Single read from an extremity of a full-... 121 2e-24
169emb|BX033912.1|CNS08YBW Single read from an extremity of a full-... 121 2e-24
170emb|BX033780.1|CNS08Y88 Single read from an extremity of a full-... 121 2e-24
171emb|BX032883.1|CNS08XJB Single read from an extremity of a full-... 121 2e-24
172emb|BX029876.1|CNS08V7S Single read from an extremity of a full-... 121 2e-24
173emb|BX029038.1|CNS08UKI Single read from an extremity of a full-... 121 2e-24
174emb|BX028617.1|CNS08U8T Single read from an extremity of a full-... 121 2e-24
175emb|BX028094.1|CNS08TUA Single read from an extremity of a full-... 121 2e-24
176emb|BX025515.1|CNS08RUN Single read from an extremity of a full-... 121 2e-24
177emb|BX022958.1|CNS08PVM Single read from an extremity of a full-... 121 2e-24
178emb|BX022235.1|CNS08PBJ Single read from an extremity of a full-... 121 2e-24
179emb|BX021578.1|CNS08OTA Single read from an extremity of a full-... 121 2e-24
180emb|BX016278.1|CNS08KQ2 Single read from an extremity of a full-... 121 2e-24
181emb|BX011461.1|CNS08H09 Single read from an extremity of a full-... 121 2e-24
182emb|BX009034.1|CNS08F4U Single read from an extremity of a full-... 121 2e-24
183emb|BX007697.1|CNS08E3P Single read from an extremity of a full-... 121 2e-24
184emb|BX007185.1|CNS08DPH Single read from an extremity of a full-... 121 2e-24
185emb|BX006719.1|CNS08DCJ Single read from an extremity of a full-... 121 2e-24
186emb|BX006260.1|CNS08CZS Single read from an extremity of a full-... 121 2e-24
187ref|XM_753952.1| Ustilago maydis 521 hypothetical protein (UM028... 119 8e-24
188gb|DQ440454.1| Aedes aegypti clone AET-617a ribosomal protein L4... 115 1e-22
189emb|BX071467.1|CNS09RB3 Single read from an extremity of a full-... 115 1e-22
190emb|BX065961.1|CNS09N25 Single read from an extremity of a full-... 115 1e-22
191emb|BX064526.1|CNS09LYA Single read from an extremity of a full-... 115 1e-22
192emb|BX054632.1|CNS09EBG Single read from an extremity of a full-... 115 1e-22
193emb|BX048459.1|CNS099JZ Single read from an extremity of a full-... 115 1e-22
194emb|BX035657.1|CNS08ZOD Single read from an extremity of a full-... 115 1e-22
195emb|BX034646.1|CNS08YWA Single read from an extremity of a full-... 115 1e-22
196emb|BX032528.1|CNS08X9G Single read from an extremity of a full-... 115 1e-22
197emb|BX031361.1|CNS08WD1 Single read from an extremity of a full-... 115 1e-22
198emb|BX021630.1|CNS08OUQ Single read from an extremity of a full-... 115 1e-22
199emb|CR938469.1| Single read from an extremity of a full-length c... 115 1e-22
200emb|CR938086.1| Single read from an extremity of a full-length c... 115 1e-22
201emb|CR938041.1| Single read from an extremity of a full-length c... 115 1e-22
202gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete... 113 5e-22
203emb|BX060779.1|CNS09J27 Single read from an extremity of a full-... 113 5e-22
204emb|BX058138.1|CNS09H0U Single read from an extremity of a full-... 113 5e-22
205emb|BX054627.1|CNS09EBB Single read from an extremity of a full-... 113 5e-22
206emb|BX052380.1|CNS09CKW Single read from an extremity of a full-... 113 5e-22
207emb|BX052359.1|CNS09CKB Single read from an extremity of a full-... 113 5e-22
208emb|BX051843.1|CNS09C5Z Single read from an extremity of a full-... 113 5e-22
209emb|BX048690.1|CNS099QE Single read from an extremity of a full-... 113 5e-22
210emb|BX047476.1|CNS098SO Single read from an extremity of a full-... 113 5e-22
211emb|BX043964.1|CNS09634 Single read from an extremity of a full-... 113 5e-22
212emb|BX043794.1|CNS095YE Single read from an extremity of a full-... 113 5e-22
213emb|BX039890.1|CNS092XY Single read from an extremity of a full-... 113 5e-22
214emb|BX036997.1|CNS090PL Single read from an extremity of a full-... 113 5e-22
215emb|BX030333.1|CNS08VKH Single read from an extremity of a full-... 113 5e-22
216emb|BX024520.1|CNS08R30 Single read from an extremity of a full-... 113 5e-22
217emb|BX023770.1|CNS08QI6 Single read from an extremity of a full-... 113 5e-22
218emb|BX011625.1|CNS08H4T Single read from an extremity of a full-... 113 5e-22
219emb|BX009620.1|CNS08FL4 Single read from an extremity of a full-... 113 5e-22
220emb|BX006833.1|CNS08DFP Single read from an extremity of a full-... 113 5e-22
221emb|BX005633.1|CNS08CID Single read from an extremity of a full-... 113 5e-22
222emb|X13382.1|DMRPL1R Drosophila melanogaster mRNA for put. ribos... 113 5e-22
223ref|NM_079814.2| Drosophila melanogaster Ribosomal protein L4 CG... 113 5e-22
224gb|AY069485.1| Drosophila melanogaster LD21756 full length cDNA 113 5e-22
225gb|AE003763.3| Drosophila melanogaster chromosome 3R, section 10... 113 5e-22
226emb|BX040293.1|CNS09395 Single read from an extremity of a full-... 109 8e-21
227emb|BX059255.1|CNS09HVV Single read from an extremity of a full-... 107 3e-20
228emb|BX049372.1|CNS09A9C Single read from an extremity of a full-... 107 3e-20
229emb|BX034795.1|CNS08Z0F Single read from an extremity of a full-... 107 3e-20
230emb|BX027534.1|CNS08TEQ Single read from an extremity of a full-... 107 3e-20
231ref|XM_778380.1| PREDICTED: Strongylocentrotus purpuratus simila... 107 3e-20
232emb|X06881.1|DMRPL1 Drosophila gene for ribosomal protein L1 fra... 107 3e-20
233emb|CR938640.1| Single read from an extremity of a full-length c... 107 3e-20
234gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chr... 105 1e-19
235ref|XM_567364.1| Cryptococcus neoformans var. neoformans JEC21 R... 105 1e-19
236emb|BX059712.1|CNS09I8K Single read from an extremity of a full-... 105 1e-19
237emb|BX058351.1|CNS09H6R Single read from an extremity of a full-... 105 1e-19
238emb|BX057329.1|CNS09GED Single read from an extremity of a full-... 105 1e-19
239emb|BX044408.1|CNS096FG Single read from an extremity of a full-... 105 1e-19
240emb|BX026422.1|CNS08SJU Single read from an extremity of a full-... 105 1e-19
241emb|BX013720.1|CNS08IR0 Single read from an extremity of a full-... 105 1e-19
242emb|BX006709.1|CNS08DC9 Single read from an extremity of a full-... 105 1e-19
243emb|BX012712.1|CNS08HZ0 Single read from an extremity of a full-... 103 5e-19
244emb|BX044279.1|CNS096BV Single read from an extremity of a full-... 101 2e-18
245emb|BX020278.1|CNS08NT6 Single read from an extremity of a full-... 101 2e-18
246emb|BX025743.1|CNS08S0Z Single read from an extremity of a full-... 100 8e-18
247ref|XM_966541.1| PREDICTED: Tribolium castaneum similar to CG550... 98 3e-17
248emb|BX024418.1|CNS08R06 Single read from an extremity of a full-... 98 3e-17
249emb|AJ312335.1|OMY312335 Oncorhynchus mykiss partial mRNA for pu... 98 3e-17
250emb|AJ315139.1|OMY315139 Oncorhynchus mykiss partial mRNA for pu... 98 3e-17
251ref|XM_362607.1| Magnaporthe grisea 70-15 hypothetical protein (... 96 1e-16
252ref|NM_111797.2| Arabidopsis thaliana structural constituent of ... 94 5e-16
253ref|NM_001035586.1| Arabidopsis thaliana structural constituent ... 94 5e-16
254emb|BX013408.1|CNS08IIC Single read from an extremity of a full-... 94 5e-16
255gb|BT008495.1| Arabidopsis thaliana At3g09630 gene, complete cds 94 5e-16
256gb|AY056781.1| Arabidopsis thaliana AT3g09630/F11F8_22 mRNA, com... 94 5e-16
257gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11... 94 5e-16
258gb|BT002438.1| Arabidopsis thaliana putative 60S ribosomal prote... 94 5e-16
259dbj|AU066549.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal pr... 94 5e-16
260gb|DQ211981.1| Toxoplasma gondii 60S ribosomal subunit protein L... 92 2e-15
261emb|BX057879.1|CNS09GTN Single read from an extremity of a full-... 92 2e-15
262emb|BX041513.1|CNS09471 Single read from an extremity of a full-... 92 2e-15
263emb|BX024780.1|CNS08RA8 Single read from an extremity of a full-... 92 2e-15
264emb|AL513443.1|NC93G11 Neurospora crassa DNA linkage group V Cos... 92 2e-15
265emb|CR938470.1| Single read from an extremity of a full-length c... 92 2e-15
266ref|NM_120365.2| Arabidopsis thaliana structural constituent of ... 88 3e-14
267emb|AL162973.1|ATF9G14 Arabidopsis thaliana DNA chromosome 5, BA... 88 3e-14
268gb|AY136320.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
269gb|AY114639.1| Arabidopsis thaliana 60S ribosomal protein-like p... 88 3e-14
270gb|AY093384.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
271gb|AY062452.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
272gb|AY059886.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
273gb|AY054479.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
274dbj|AK117624.1| Arabidopsis thaliana At5g02870 mRNA for putative... 88 3e-14
275gb|BT002088.1| Arabidopsis thaliana 60S ribosomal protein-like (... 88 3e-14
276gb|AY087963.1| Arabidopsis thaliana clone 39947 mRNA, complete s... 86 1e-13
277dbj|AK108635.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
278emb|BX019852.1|CNS08NHC Single read from an extremity of a full-... 82 2e-12
279emb|BX012970.1|CNS08I66 Single read from an extremity of a full-... 82 2e-12
280emb|BX072152.1|CNS09RU4 Single read from an extremity of a full-... 78 3e-11
281emb|CT033082.1| Platynereis dumerilii EST IB0AAA27AD03EM1 78 3e-11
282emb|CT032463.1| Platynereis dumerilii EST IB0AAA37DH08EM1 78 3e-11
283gb|AF367314.1| Arabidopsis thaliana AT5g02870/F9G14_180 mRNA, co... 72 2e-09
284emb|BX041921.1|CNS094ID Single read from an extremity of a full-... 70 7e-09
285emb|CT033545.1| Platynereis dumerilii EST IB0AAA18CB04EM1 70 7e-09
286emb|CT033468.1| Platynereis dumerilii EST IB0AAA19DA06EM1 70 7e-09
287emb|CT033344.1| Platynereis dumerilii EST IB0AAA22BC05EM1 70 7e-09
288emb|CT033150.1| Platynereis dumerilii EST IB0AAA25DF12EM1 70 7e-09
289emb|CT033035.1| Platynereis dumerilii EST IB0AAA27CF07EM1 70 7e-09
290emb|CT033024.1| Platynereis dumerilii EST IB0AAA27DB08EM1 70 7e-09
291emb|CT032877.1| Platynereis dumerilii EST IB0AAA30AF03EM1 70 7e-09
292emb|CT032532.1| Platynereis dumerilii EST IB0AAA36DC10EM1 70 7e-09
293emb|BX053806.1|CNS09DOI Single read from an extremity of a full-... 68 3e-08
294emb|BX015866.1|CNS08KEM Single read from an extremity of a full-... 68 3e-08
295gb|DQ228320.1| Solanum tuberosum clone 131F11 unknown mRNA 66 1e-07
296gb|AY023157.1| Oryza sativa microsatellite MRG5482 containing (G... 66 1e-07
297gb|U30495.1|UCU30495 Urechis caupo ribosomal protein mRNA, compl... 66 1e-07
298emb|BX047622.1|CNS098WQ Single read from an extremity of a full-... 64 4e-07
299emb|BX022498.1|CNS08PIU Single read from an extremity of a full-... 64 4e-07
300gb|AF526248.1| Chlamys farreri clone iolscfcl213ct227cn242 ribos... 62 2e-06
301gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 62 2e-06
302gb|AF401555.1| Ictalurus punctatus ribosomal protein L4 mRNA, co... 62 2e-06
303ref|NM_208087.1| Eremothecium gossypii AAR191Cp (AAR191C), mRNA 62 2e-06
304gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 60 7e-06
305ref|XM_842678.1| Leishmania major strain Friedlin hypothetical p... 60 7e-06
306ref|XM_842679.1| Leishmania major strain Friedlin ribosomal prot... 60 7e-06
307ref|XM_842680.1| Leishmania major strain Friedlin ribosomal prot... 60 7e-06
308emb|BX020037.1|CNS08NMH Single read from an extremity of a full-... 60 7e-06
309emb|BX021389.1|CNS08OO1 Single read from an extremity of a full-... 56 1e-04
310gb|AC148756.2| Medicago truncatula clone mth2-22d18, complete se... 56 1e-04
311ref|NM_059015.2| Caenorhabditis elegans Ribosomal Protein, Large... 56 1e-04
312gb|AF000196.1| Caenorhabditis elegans cosmid B0041, complete seq... 56 1e-04
313gb|AY389936.1| Protopterus dolloi ribosomal protein L4-like mRNA... 54 4e-04
314gb|AY313844.1| Taenopygia guttata steroidogenic enzyme cytochrom... 54 4e-04
315emb|AM048989.1| Eucinetus sp. APV-2005 mRNA for ribosomal protei... 54 4e-04
316ref|XM_501532.1| Yarrowia lipolytica CLIB122, YALI0C06820g predi... 54 4e-04
317emb|BX011009.1|CNS08GNP Single read from an extremity of a full-... 54 4e-04
318emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 54 4e-04
319ref|XM_676353.1| Aspergillus nidulans FGSC A4 hypothetical prote... 50 0.006
320ref|XM_799423.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.006
321ref|XM_799424.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.006
322ref|XM_801917.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 50 0.006
323emb|BX032884.1|CNS08XJC Single read from an extremity of a full-... 50 0.006
324emb|BX012339.1|CNS08HON Single read from an extremity of a full-... 50 0.006
325ref|NM_213107.1| Danio rerio ribosomal protein L4 (rpl4), mRNA 48 0.025
326gb|BC067580.1| Danio rerio ribosomal protein L4, mRNA (cDNA clon... 48 0.025
327gb|BC049520.1| Danio rerio ribosomal protein L4, mRNA (cDNA clon... 48 0.025
328emb|BX031404.1|CNS08WE8 Single read from an extremity of a full-... 48 0.025
329emb|BX015510.1|CNS08K4Q Single read from an extremity of a full-... 48 0.025
330gb|AC135499.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.098
331dbj|AB236838.1| Trifolium pratense RNA for putative 60S ribosoma... 46 0.098
332dbj|AB236796.1| Trifolium pratense RNA for putative 60S ribosoma... 46 0.098
333dbj|AB236763.1| Trifolium pratense RNA for putative 60S ribosoma... 46 0.098
334dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.098
335gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.098
336emb|BX034120.1|CNS08YHO Single read from an extremity of a full-... 44 0.39
337emb|BX017787.1|CNS08LVZ Single read from an extremity of a full-... 44 0.39
338gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 1.5
339ref|XM_742948.1| Aspergillus fumigatus Af293 60s ribosomal prote... 42 1.5
340emb|BX057619.1|CNS09GMF Single read from an extremity of a full-... 42 1.5
341emb|BX049843.1|CNS09AMF Single read from an extremity of a full-... 42 1.5
342emb|BX042682.1|CNS0953I Single read from an extremity of a full-... 42 1.5
343emb|BX036444.1|CNS090A8 Single read from an extremity of a full-... 42 1.5
344emb|BX640438.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.5
345gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 42 1.5
346dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
347dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
348dbj|AP004357.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
349dbj|AP004641.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
350dbj|AK120084.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
351dbj|AK106345.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
352dbj|AK066214.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
353gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
354emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa... 42 1.5
355gb|AC152105.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A3, compl... 40 6.1
356ref|XM_477396.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.1
357gb|AY540995.1| Achromobacter xylosoxidans subsp. denitrificans s... 40 6.1
358ref|XM_427647.1| PREDICTED: Gallus gallus similar to Xbr-1b (LOC... 40 6.1
359gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom... 40 6.1
360ref|XM_390955.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 6.1
361ref|XM_387362.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 6.1
362gb|AY459352.1| Thermus aquaticus 4-alpha-glucanotransferase gene... 40 6.1
363gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome 40 6.1
364gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.1
365gb|AC158786.8| Mus musculus chromosome 5, clone RP23-228M24, com... 40 6.1
366dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
367dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
368dbj|AP006175.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
369dbj|AP005172.4| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
370dbj|AP005612.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
371dbj|AP004890.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
372dbj|AK109462.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.1
373emb|AL512355.6|CNS07EF4 Human chromosome 14 DNA sequence BAC R-1... 40 6.1
374dbj|AK059774.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.1
375emb|AL954156.3|CNS08CCU Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.1
376dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 6.1
377gb|DQ065837.1| Burkholderia cepacia strain 2a plasmid pIJB1, com... 40 6.1

>ref|XM_507356.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1014_E09.28
           mRNA
          Length = 1487

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 157 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 216

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 217 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 276

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 277 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 336

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 337 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 396

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 397 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 450



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 80  tcgtctccgtcaaggccctggagggcgacatggccac 116



to top

>ref|XM_476865.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1395

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 161 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 220

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 221 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 280

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 281 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 340

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 341 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 400

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 401 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 454



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 84  tcgtctccgtcaaggccctggagggcgacatggccac 120



to top

>ref|XM_507355.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1014_E09.28
           mRNA
          Length = 1641

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 161 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 220

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 221 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 280

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 281 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 340

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 341 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 400

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 401 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 454



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 84  tcgtctccgtcaaggccctggagggcgacatggccac 120



to top

>ref|XM_507354.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1014_E09.28
           mRNA
          Length = 1480

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 162 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 221

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 222 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 281

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 282 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 341

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 342 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 401

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 402 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 455



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 85  tcgtctccgtcaaggccctggagggcgacatggccac 121



to top

>ref|XM_506197.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1014_E09.28
           mRNA
          Length = 1486

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 162 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 221

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 222 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 281

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 282 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 341

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 342 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 401

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 402 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 455



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 85  tcgtctccgtcaaggccctggagggcgacatggccac 121



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                           
Query: 157     gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
               |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 4295485 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 4295544

                                                                           
Query: 217     cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
               |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 4295545 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 4295604

                                                                           
Query: 277     ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
               || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 4295605 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 4295664

                                                                           
Query: 337     ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
               ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 4295665 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 4295724

                                                                     
Query: 397     aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
               ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 4295725 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 4295778



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                    
Query: 83      tcgtctccgtcaaggccctggagggggacatggccac 119
               ||||||||||||||||||||||||| |||||||||||
Sbjct: 4295408 tcgtctccgtcaaggccctggagggcgacatggccac 4295444



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 420      ccgcctccgtcgcgtcgccg 439
                ||||||||||||||||||||
Sbjct: 10078256 ccgcctccgtcgcgtcgccg 10078237



to top

>dbj|AP003800.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1014_E09
          Length = 184624

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                          
Query: 157    gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
              |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 116539 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 116598

                                                                          
Query: 217    cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
              |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 116599 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 116658

                                                                          
Query: 277    ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
              || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 116659 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 116718

                                                                          
Query: 337    ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
              ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 116719 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 116778

                                                                    
Query: 397    aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
              ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 116779 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 116832



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                   
Query: 83     tcgtctccgtcaaggccctggagggggacatggccac 119
              ||||||||||||||||||||||||| |||||||||||
Sbjct: 116462 tcgtctccgtcaaggccctggagggcgacatggccac 116498



to top

>dbj|AK104504.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F06, full
           insert sequence
          Length = 1486

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 162 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 221

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 222 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 281

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 282 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 341

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 342 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 401

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 402 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 455



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 85  tcgtctccgtcaaggccctggagggcgacatggccac 121



to top

>dbj|AK104629.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-C02, full
           insert sequence
          Length = 1487

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 157 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 216

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 217 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 276

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 277 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 336

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 337 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 396

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 397 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 450



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 80  tcgtctccgtcaaggccctggagggcgacatggccac 116



to top

>dbj|AK104447.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-B12, full
           insert sequence
          Length = 1480

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 162 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 221

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 222 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 281

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 282 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 341

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 342 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 401

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 402 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 455



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 85  tcgtctccgtcaaggccctggagggcgacatggccac 121



to top

>dbj|AK060963.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-A09, full
           insert sequence
          Length = 1395

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 161 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 220

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 221 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 280

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 281 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 340

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 341 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 400

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 401 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 454



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 84  tcgtctccgtcaaggccctggagggcgacatggccac 120



to top

>dbj|AK060711.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-B02, full
           insert sequence
          Length = 1641

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 gcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgcaacagccgc 216
           |||||| |||||||||||||  ||  |||||||||||||||  ||||||||||||  |||
Sbjct: 161 gcgccgctccgccccgacgtggtccgcttcgtccacaggctgctctcctgcaacaagcgc 220

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||||||||| ||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 221 cagccctacgccgtgtcccgccgcgccggccaccagacctcggcggagtcgtggggcacg 280

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           || |||||||||||||||||||| || |||  |||||| || || |||||||||||||||
Sbjct: 281 gggcgcgccgtgtcgcgtatcccccgcgtccccggcggcgggacgcaccgcgccgggcag 340

                                                                       
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctggcgc 396
           ||||||||||||||||||||||| ||||| |||||||||||||| |||  ||  ||||||
Sbjct: 341 ggagccttcggcaacatgtgccgcggcgggcgcatgttcgcgccgaccaagacatggcgc 400

                                                                 
Query: 397 aagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctccgcc 450
           ||||||||||| ||||||||| ||| |||||| |||||||||||||||||||||
Sbjct: 401 aagtggcaccgccgcgtcaacgtccacctccgccgcgtcgccgtcgcctccgcc 454



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 83  tcgtctccgtcaaggccctggagggggacatggccac 119
           ||||||||||||||||||||||||| |||||||||||
Sbjct: 84  tcgtctccgtcaaggccctggagggcgacatggccac 120



to top

>gb|BT016670.1| Zea mays clone Contig503 mRNA sequence
          Length = 1384

 Score =  285 bits (144), Expect = 6e-74
 Identities = 311/367 (84%)
 Strand = Plus / Plus

                                                                       
Query: 83  tcgtctccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgc 142
           |||||||||| |||||||| ||||| |||||||  || |||||  ||||| || |  | |
Sbjct: 57  tcgtctccgtgaaggccctagagggagacatggtaaccgacgcccccggcatcgccttac 116

                                                                       
Query: 143 cgcacgtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtct 202
           ||| |||| |   |||||||||||||||||||||  |||  |||  ||||| |||  | |
Sbjct: 117 cgcccgtcttcggggcgccgatccgccccgacgtggtcaggttcacccacaagctgctgt 176

                                                                       
Query: 203 cctgcaacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccg 262
           |||||||||  |||||||||||||| |||||||||   ||||| |||||||| |||||||
Sbjct: 177 cctgcaacaagcgccagccctacgcagtctcccgccgcgccggccaccagacgtcggccg 236

                                                                       
Query: 263 agtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaaccc 322
           |||||||||| || || ||||||||||| |||||||| || |||  |||||| || ||||
Sbjct: 237 agtcctggggtaccggccgcgccgtgtctcgtatcccccgcgtccccggcggcggcaccc 296

                                                                       
Query: 323 accgcgccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgccca 382
           |||||||||| |||||||| ||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 297 accgcgccggccagggagcgttcggcaacatgtgccgcggcgggcgcatgttcgcgccca 356

                                                                       
Query: 383 cccggatctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcg 442
           ||  ||||||||||||||||||||| ||||||||||||  |||||| |||||||||||||
Sbjct: 357 ccaagatctggcgcaagtggcaccgccgcgtcaacatcaacctccgccgcgtcgccgtcg 416

                  
Query: 443 cctccgc 449
           |||||||
Sbjct: 417 cctccgc 423



to top

>ref|NM_185075.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1464

 Score =  276 bits (139), Expect = 6e-71
 Identities = 306/362 (84%)
 Strand = Plus / Plus

                                                                       
Query: 88  tccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgccgcac 147
           ||||| |||||||||||||| |||||||| |||||| |||||||| ||| ||||||||| 
Sbjct: 80  tccgtgaaggccctggagggcgacatggcgacggactcggccggcatccagatgccgcag 139

                                                                       
Query: 148 gtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgc 207
           ||  |    ||||||||||||||||||||  ||||||||  ||||| |||  ||||||||
Sbjct: 140 gtgctccgcgcgccgatccgccccgacgtggtcaccttcacccacaagctcctctcctgc 199

                                                                       
Query: 208 aacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcc 267
           ||| |||||||||| |||||||| || |||   || || ||||||||||| || ||||| 
Sbjct: 200 aaccgccgccagccgtacgccgtgtcgcgccgcgcggggcaccagacctccgcggagtcg 259

                                                                       
Query: 268 tggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgc 327
           ||||||||||| ||||||||||| || |||||||| |||  |||||| || || ||||||
Sbjct: 260 tggggcacgggccgcgccgtgtcccgcatcccgcgcgtccccggcggcggcacgcaccgc 319

                                                                       
Query: 328 gccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccgg 387
           || |||||||| || ||||||||||||||||| ||||| ||||||||||||||||||  |
Sbjct: 320 gcggggcagggcgcgttcggcaacatgtgccgcggcgggcgcatgttcgcgcccaccaag 379

                                                                       
Query: 388 atctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctcc 447
           |||||||||   |||||||| |||||||||||||||||||| ||| | |||||||| |||
Sbjct: 380 atctggcgccgctggcaccgccgcgtcaacatccgcctccgccgcatagccgtcgcgtcc 439

             
Query: 448 gc 449
           ||
Sbjct: 440 gc 441



to top

>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete
             sequence
          Length = 141582

 Score =  276 bits (139), Expect = 6e-71
 Identities = 306/362 (84%)
 Strand = Plus / Plus

                                                                         
Query: 88    tccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgccgcac 147
             ||||| |||||||||||||| |||||||| |||||| |||||||| ||| ||||||||| 
Sbjct: 37504 tccgtgaaggccctggagggcgacatggcgacggactcggccggcatccagatgccgcag 37563

                                                                         
Query: 148   gtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgc 207
             ||  |    ||||||||||||||||||||  ||||||||  ||||| |||  ||||||||
Sbjct: 37564 gtgctccgcgcgccgatccgccccgacgtggtcaccttcacccacaagctcctctcctgc 37623

                                                                         
Query: 208   aacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcc 267
             ||| |||||||||| |||||||| || |||   || || ||||||||||| || ||||| 
Sbjct: 37624 aaccgccgccagccgtacgccgtgtcgcgccgcgcggggcaccagacctccgcggagtcg 37683

                                                                         
Query: 268   tggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgc 327
             ||||||||||| ||||||||||| || |||||||| |||  |||||| || || ||||||
Sbjct: 37684 tggggcacgggccgcgccgtgtcccgcatcccgcgcgtccccggcggcggcacgcaccgc 37743

                                                                         
Query: 328   gccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccgg 387
             || |||||||| || ||||||||||||||||| ||||| ||||||||||||||||||  |
Sbjct: 37744 gcggggcagggcgcgttcggcaacatgtgccgcggcgggcgcatgttcgcgcccaccaag 37803

                                                                         
Query: 388   atctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctcc 447
             |||||||||   |||||||| |||||||||||||||||||| ||| | |||||||| |||
Sbjct: 37804 atctggcgccgctggcaccgccgcgtcaacatccgcctccgccgcatagccgtcgcgtcc 37863

               
Query: 448   gc 449
             ||
Sbjct: 37864 gc 37865



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  276 bits (139), Expect = 6e-71
 Identities = 306/362 (84%)
 Strand = Plus / Minus

                                                                            
Query: 88       tccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgccgcac 147
                ||||| |||||||||||||| |||||||| |||||| |||||||| ||| ||||||||| 
Sbjct: 32842037 tccgtgaaggccctggagggcgacatggcgacggactcggccggcatccagatgccgcag 32841978

                                                                            
Query: 148      gtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgc 207
                ||  |    ||||||||||||||||||||  ||||||||  ||||| |||  ||||||||
Sbjct: 32841977 gtgctccgcgcgccgatccgccccgacgtggtcaccttcacccacaagctcctctcctgc 32841918

                                                                            
Query: 208      aacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcc 267
                ||| |||||||||| |||||||| || |||   || || ||||||||||| || ||||| 
Sbjct: 32841917 aaccgccgccagccgtacgccgtgtcgcgccgcgcggggcaccagacctccgcggagtcg 32841858

                                                                            
Query: 268      tggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgc 327
                ||||||||||| ||||||||||| || |||||||| |||  |||||| || || ||||||
Sbjct: 32841857 tggggcacgggccgcgccgtgtcccgcatcccgcgcgtccccggcggcggcacgcaccgc 32841798

                                                                            
Query: 328      gccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccgg 387
                || |||||||| || ||||||||||||||||| ||||| ||||||||||||||||||  |
Sbjct: 32841797 gcggggcagggcgcgttcggcaacatgtgccgcggcgggcgcatgttcgcgcccaccaag 32841738

                                                                            
Query: 388      atctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctcc 447
                |||||||||   |||||||| |||||||||||||||||||| ||| | |||||||| |||
Sbjct: 32841737 atctggcgccgctggcaccgccgcgtcaacatccgcctccgccgcatagccgtcgcgtcc 32841678

                  
Query: 448      gc 449
                ||
Sbjct: 32841677 gc 32841676



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 428      gtcgcgtcgccgtcgcctcc 447
                ||||||||||||||||||||
Sbjct: 25755637 gtcgcgtcgccgtcgcctcc 25755618



to top

>gb|AC093713.6| Oryza sativa chromosome 3 BAC OSJNBa0094F01 genomic sequence, complete
              sequence
          Length = 151479

 Score =  276 bits (139), Expect = 6e-71
 Identities = 306/362 (84%)
 Strand = Plus / Plus

                                                                          
Query: 88     tccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgccgcac 147
              ||||| |||||||||||||| |||||||| |||||| |||||||| ||| ||||||||| 
Sbjct: 148138 tccgtgaaggccctggagggcgacatggcgacggactcggccggcatccagatgccgcag 148197

                                                                          
Query: 148    gtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgc 207
              ||  |    ||||||||||||||||||||  ||||||||  ||||| |||  ||||||||
Sbjct: 148198 gtgctccgcgcgccgatccgccccgacgtggtcaccttcacccacaagctcctctcctgc 148257

                                                                          
Query: 208    aacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcc 267
              ||| |||||||||| |||||||| || |||   || || ||||||||||| || ||||| 
Sbjct: 148258 aaccgccgccagccgtacgccgtgtcgcgccgcgcggggcaccagacctccgcggagtcg 148317

                                                                          
Query: 268    tggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgc 327
              ||||||||||| ||||||||||| || |||||||| |||  |||||| || || ||||||
Sbjct: 148318 tggggcacgggccgcgccgtgtcccgcatcccgcgcgtccccggcggcggcacgcaccgc 148377

                                                                          
Query: 328    gccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccgg 387
              || |||||||| || ||||||||||||||||| ||||| ||||||||||||||||||  |
Sbjct: 148378 gcggggcagggcgcgttcggcaacatgtgccgcggcgggcgcatgttcgcgcccaccaag 148437

                                                                          
Query: 388    atctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctcc 447
              |||||||||   |||||||| |||||||||||||||||||| ||| | |||||||| |||
Sbjct: 148438 atctggcgccgctggcaccgccgcgtcaacatccgcctccgccgcatagccgtcgcgtcc 148497

                
Query: 448    gc 449
              ||
Sbjct: 148498 gc 148499



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  276 bits (139), Expect = 6e-71
 Identities = 306/362 (84%)
 Strand = Plus / Minus

                                                                            
Query: 88       tccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgccgcac 147
                ||||| |||||||||||||| |||||||| |||||| |||||||| ||| ||||||||| 
Sbjct: 32932547 tccgtgaaggccctggagggcgacatggcgacggactcggccggcatccagatgccgcag 32932488

                                                                            
Query: 148      gtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtctcctgc 207
                ||  |    ||||||||||||||||||||  ||||||||  ||||| |||  ||||||||
Sbjct: 32932487 gtgctccgcgcgccgatccgccccgacgtggtcaccttcacccacaagctcctctcctgc 32932428

                                                                            
Query: 208      aacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcc 267
                ||| |||||||||| |||||||| || |||   || || ||||||||||| || ||||| 
Sbjct: 32932427 aaccgccgccagccgtacgccgtgtcgcgccgcgcggggcaccagacctccgcggagtcg 32932368

                                                                            
Query: 268      tggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgc 327
                ||||||||||| ||||||||||| || |||||||| |||  |||||| || || ||||||
Sbjct: 32932367 tggggcacgggccgcgccgtgtcccgcatcccgcgcgtccccggcggcggcacgcaccgc 32932308

                                                                            
Query: 328      gccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccgg 387
                || |||||||| || ||||||||||||||||| ||||| ||||||||||||||||||  |
Sbjct: 32932307 gcggggcagggcgcgttcggcaacatgtgccgcggcgggcgcatgttcgcgcccaccaag 32932248

                                                                            
Query: 388      atctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcgcctcc 447
                |||||||||   |||||||| |||||||||||||||||||| ||| | |||||||| |||
Sbjct: 32932247 atctggcgccgctggcaccgccgcgtcaacatccgcctccgccgcatagccgtcgcgtcc 32932188

                  
Query: 448      gc 449
                ||
Sbjct: 32932187 gc 32932186



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 428      gtcgcgtcgccgtcgcctcc 447
                ||||||||||||||||||||
Sbjct: 25846946 gtcgcgtcgccgtcgcctcc 25846927



to top

>gb|BT016602.1| Zea mays clone Contig435 mRNA sequence
          Length = 1376

 Score =  256 bits (129), Expect = 5e-65
 Identities = 305/364 (83%)
 Strand = Plus / Plus

                                                                       
Query: 83  tcgtctccgtcaaggccctggagggggacatggccacggacgcggccggcgtcccgatgc 142
           |||||||||| || ||||||||||| ||||||| |||||||||  ||||| || |  | |
Sbjct: 61  tcgtctccgtgaaagccctggagggcgacatggtcacggacgcccccggcatcgccttac 120

                                                                       
Query: 143 cgcacgtcatgacggcgccgatccgccccgacgtcatcaccttcgtccacaggcttgtct 202
           ||| |||| |   ||| ||||||||||| |||||  ||  ||||  ||||| |||  | |
Sbjct: 121 cgcccgtcttcggggcaccgatccgcccggacgtggtccgcttcacccacaagctgctgt 180

                                                                       
Query: 203 cctgcaacagccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccg 262
           |||||||||  |||||||| ||||| |||||||||   || || |||||||| |||||||
Sbjct: 181 cctgcaacaagcgccagccttacgcagtctcccgccgcgctggccaccagacgtcggccg 240

                                                                       
Query: 263 agtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaaccc 322
           |||||||||| ||||| ||||| ||||| |||||||| || |||  |||||| || ||||
Sbjct: 241 agtcctggggtacgggccgcgctgtgtcccgtatcccccgcgtccccggcggcggcaccc 300

                                                                       
Query: 323 accgcgccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgccca 382
           | |||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 301 atcgcgccggccagggagcattcggcaacatgtgccgcggcggacgcatgttcgcgccca 360

                                                                       
Query: 383 cccggatctggcgcaagtggcaccgncgcgtcaacatccgcctccgtcgcgtcgccgtcg 442
           ||  ||||||||||||||||||||| ||||||||| ||  |||||| |||||||||||||
Sbjct: 361 ccaagatctggcgcaagtggcaccgccgcgtcaacgtcaacctccgccgcgtcgccgtcg 420

               
Query: 443 cctc 446
           ||||
Sbjct: 421 cctc 424



to top

>gb|AF134732.1|AF134732 Prunus armeniaca 60S ribosomal protein L1 mRNA, complete cds
          Length = 1552

 Score =  151 bits (76), Expect = 2e-33
 Identities = 157/184 (85%)
 Strand = Plus / Plus

                                                                       
Query: 213 ccgccagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctgggg 272
           |||||||||||| |||||||||   |||||||| ||||||||||| ||||||||||||||
Sbjct: 207 ccgccagccctatgccgtctccaagaaggccggccaccagacctcagccgagtcctgggg 266

                                                                       
Query: 273 cacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgg 332
            ||||| || ||||| || |||||||| ||||||  ||| || || |||||||| |||||
Sbjct: 267 tacgggccgagccgtctcccgtatccctcgtgtccccggaggcgggacccaccgggccgg 326

                                                                       
Query: 333 gcagggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacccggatctg 392
            |||||||| |||||||| ||||| || || || ||||||||||||||||||  ||||||
Sbjct: 327 ccagggagctttcggcaatatgtgtcgaggtggccgcatgttcgcgcccaccaagatctg 386

               
Query: 393 gcgc 396
           ||||
Sbjct: 387 gcgc 390



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 146 acgtcatgacggcgccgatccgccccgacgtcatcaccttcgtccac 192
           ||||||||| |||  ||||||| |||||| || ||||||||||||||
Sbjct: 140 acgtcatgaaggcctcgatccggcccgacatcgtcaccttcgtccac 186



to top

>ref|XM_323058.1| Neurospora crassa OR74A hypothetical protein (NCU03757.1) partial
           mRNA
          Length = 1086

 Score =  135 bits (68), Expect = 1e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 238 aaggccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatc 297
           ||||| |||||||||||||| || |||||||||||||| |||||||| ||  | ||||||
Sbjct: 166 aaggctggtcaccagacctctgctgagtcctggggcactggtcgcgctgttgcccgtatc 225

                                                                       
Query: 298 ccgcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgc 357
           || ||||||  ||| ||||| || ||||||||||| ||||  || ||||| |||||||||
Sbjct: 226 ccccgtgtctccggtggtggtactcaccgcgccggtcaggccgctttcggtaacatgtgc 285

                                                           
Query: 358 cgtggcggacgcatgttcgcgcccacccggatctggcgcaagtggcac 405
           |||  ||| ||||||||||| ||||||  |||||||||||||||||||
Sbjct: 286 cgttccggtcgcatgttcgctcccaccaagatctggcgcaagtggcac 333



to top

>ref|XM_956011.1| Neurospora crassa OR74A hypothetical protein (NCU03757.1) partial
           mRNA
          Length = 1086

 Score =  135 bits (68), Expect = 1e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 238 aaggccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatc 297
           ||||| |||||||||||||| || |||||||||||||| |||||||| ||  | ||||||
Sbjct: 166 aaggctggtcaccagacctctgctgagtcctggggcactggtcgcgctgttgcccgtatc 225

                                                                       
Query: 298 ccgcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgc 357
           || ||||||  ||| ||||| || ||||||||||| ||||  || ||||| |||||||||
Sbjct: 226 ccccgtgtctccggtggtggtactcaccgcgccggtcaggccgctttcggtaacatgtgc 285

                                                           
Query: 358 cgtggcggacgcatgttcgcgcccacccggatctggcgcaagtggcac 405
           |||  ||| ||||||||||| ||||||  |||||||||||||||||||
Sbjct: 286 cgttccggtcgcatgttcgctcccaccaagatctggcgcaagtggcac 333



to top

>emb|BX071698.1|CNS09RHI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 26  gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 85

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 86  cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 145

                            
Query: 361 ggcggacgcatgttcgc 377
           ||| |||||||||||||
Sbjct: 146 ggccgacgcatgttcgc 162



to top

>emb|BX071539.1|CNS09RD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 327

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 328 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 387

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 388 ggtggacgcatgttcgc 404



to top

>emb|BX071106.1|CNS09R12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX071300.1|CNS09R6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 612

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 167 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 226

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 227 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 286

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 287 ggtggacgcatgttcgc 303



to top

>emb|BX070109.1|CNS09Q9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 569

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 149 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 208

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 209 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 268

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 269 ggtggacgcatgttcgc 285



to top

>emb|BX069884.1|CNS09Q34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 389

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 390 ggtggacgcatgttcgc 406



to top

>emb|BX068549.1|CNS09P21 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 647

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 389

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 390 ggtggacgcatgttcgc 406



to top

>emb|BX068537.1|CNS09P1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 254 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 313

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 314 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 373

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 374 ggtggacgcatgttcgc 390



to top

>emb|BX067761.1|CNS09OG5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX067621.1|CNS09OC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 227 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 286

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 287 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 346

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 347 ggtggacgcatgttcgc 363



to top

>emb|BX067602.1|CNS09OBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX066250.1|CNS09NA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 198 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 257

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 258 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 317

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 318 ggtggacgcatgttcgc 334



to top

>emb|BX066050.1|CNS09N4M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 393 ggtggacgcatgttcgc 409



to top

>emb|BX065642.1|CNS09MTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX064972.1|CNS09MAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 254 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 313

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 314 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 373

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 374 ggtggacgcatgttcgc 390



to top

>emb|BX064946.1|CNS09M9Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 166 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 225

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 226 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 285

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 286 ggtggacgcatgttcgc 302



to top

>emb|BX064613.1|CNS09M0P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 443

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 252 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 311

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 312 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 371

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 372 ggtggacgcatgttcgc 388



to top

>emb|BX064230.1|CNS09LQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX064060.1|CNS09LLC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 247 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 306

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 307 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 366

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 367 ggtggacgcatgttcgc 383



to top

>emb|BX063285.1|CNS09KZT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 272 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 332 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 391

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 392 ggtggacgcatgttcgc 408



to top

>emb|BX063035.1|CNS09KSV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX062606.1|CNS09KGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 254 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 313

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 314 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 373

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 374 ggaggacgcatgttcgc 390



to top

>emb|BX062486.1|CNS09KDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 256 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 315

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 316 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX060737.1|CNS09J11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 275 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 334

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 335 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 394

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 395 ggtggacgcatgttcgc 411



to top

>emb|BX060695.1|CNS09IZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX059648.1|CNS09I6S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 393 ggaggacgcatgttcgc 409



to top

>emb|BX059093.1|CNS09HRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX058908.1|CNS09HM8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 249 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 308

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 309 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 368

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 369 ggtggacgcatgttcgc 385



to top

>emb|BX058752.1|CNS09HHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX058656.1|CNS09HF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX058654.1|CNS09HF6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 216 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 275

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 276 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 335

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 336 ggtggacgcatgttcgc 352



to top

>emb|BX057887.1|CNS09GTV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX056228.1|CNS09FJS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 360

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 172 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 231

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 232 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 291

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 292 ggtggacgcatgttcgc 308



to top

>emb|BX055681.1|CNS09F4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 393 ggtggacgcatgttcgc 409



to top

>emb|BX054853.1|CNS09EHL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 252 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 311

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 312 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 371

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 372 ggtggacgcatgttcgc 388



to top

>emb|BX054427.1|CNS09E5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 170 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 229

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 230 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 289

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 290 ggtggacgcatgttcgc 306



to top

>emb|BX054030.1|CNS09DUQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 186 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 245

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 246 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 305

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 306 ggtggacgcatgttcgc 322



to top

>emb|BX051715.1|CNS09C2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 516

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 250 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 309

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 310 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 369

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 370 ggtggacgcatgttcgc 386



to top

>emb|BX051440.1|CNS09BUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX051418.1|CNS09BU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX050326.1|CNS09AZU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 393 ggtggacgcatgttcgc 409



to top

>emb|BX031031.1|CNS08W3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 192 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 251

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 252 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 311

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 312 ggtggacgcatgttcgc 328



to top

>emb|BX030880.1|CNS08VZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 266 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 325

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 326 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 385

                            
Query: 361 ggcggacgcatgttcgc 377
           ||| |||||||||||||
Sbjct: 386 ggccgacgcatgttcgc 402



to top

>emb|BX048824.1|CNS099U4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 222 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 281

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 282 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 341

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 342 ggtggacgcatgttcgc 358



to top

>emb|BX048817.1|CNS099TX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 563

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 276 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 335

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 336 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 395

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 396 ggtggacgcatgttcgc 412



to top

>emb|BX048453.1|CNS099JT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 744

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX047452.1|CNS098S0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX046088.1|CNS097Q4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX046005.1|CNS097NT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 708

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX045175.1|CNS0970R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 389

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 390 ggtggacgcatgttcgc 406



to top

>emb|BX045169.1|CNS0970L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 389

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 390 ggtggacgcatgttcgc 406



to top

>emb|BX044809.1|CNS096QL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 271 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 330

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 331 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 390

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 391 ggtggacgcatgttcgc 407



to top

>emb|BX044681.1|CNS096N1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 620

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 264 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 323

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 324 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 383

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 384 ggtggacgcatgttcgc 400



to top

>emb|BX043379.1|CNS095MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 269 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 328

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 329 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 388

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 389 ggtggacgcatgttcgc 405



to top

>emb|BX042571.1|CNS0950F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggctcgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX041947.1|CNS094J3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX041632.1|CNS094AC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 232 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 291

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 292 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 351

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 352 ggtggacgcatgttcgc 368



to top

>emb|BX041411.1|CNS09447 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX040059.1|CNS0932N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX039722.1|CNS092TA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 193 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 252

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 253 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 312

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 313 ggtggacgcatgttcgc 329



to top

>emb|BX039619.1|CNS092QF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 255 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 314

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 315 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 374

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 375 ggtggacgcatgttcgc 391



to top

>emb|BX039363.1|CNS092JB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 287 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 346

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 347 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 406

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 407 ggtggacgcatgttcgc 423



to top

>emb|BX037413.1|CNS09115 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 248 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 307

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 308 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 367

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 368 ggtggacgcatgttcgc 384



to top

>emb|BX037122.1|CNS090T2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX036904.1|CNS090N0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX036825.1|CNS090KT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 266 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 325

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 326 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 385

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 386 ggtggacgcatgttcgc 402



to top

>emb|BX035067.1|CNS08Z7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 248 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 307

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 308 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 367

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 368 ggtggacgcatgttcgc 384



to top

>emb|BX034799.1|CNS08Z0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 256 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 315

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 316 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX034660.1|CNS08YWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 254 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 313

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 314 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 373

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 374 ggtggacgcatgttcgc 390



to top

>emb|BX033560.1|CNS08Y24 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX032994.1|CNS08XME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX032856.1|CNS08XIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 389

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 390 ggtggacgcatgttcgc 406



to top

>emb|BX032542.1|CNS08X9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 280 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 339

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 340 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 399

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 400 ggtggacgcatgttcgc 416



to top

>emb|BX032047.1|CNS08WW3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 280 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 339

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 340 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 399

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 400 ggtggacgcatgttcgc 416



to top

>emb|BX031890.1|CNS08WRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX031850.1|CNS08WQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX031568.1|CNS08WIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX031343.1|CNS08WCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX030784.1|CNS08VX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 214 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 273

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 274 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 333

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 334 ggtggacgcatgttcgc 350



to top

>emb|BX030270.1|CNS08VIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 656

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX029941.1|CNS08V9L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 215 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 274

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 275 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 334

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 335 ggtggacgcatgttcgc 351



to top

>emb|BX029405.1|CNS08UUP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 255 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 314

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 315 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 374

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 375 ggtggacgcatgttcgc 391



to top

>emb|BX029718.1|CNS08V3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX029654.1|CNS08V1M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX029582.1|CNS08UZM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 240 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 299

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 300 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 359

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 360 ggtggacgcatgttcgc 376



to top

>emb|BX028809.1|CNS08UE5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX022385.1|CNS08PFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 276 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 335

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 336 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 395

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 396 ggtggacgcatgttcgc 412



to top

>emb|BX027803.1|CNS08TM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 255 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 314

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 315 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 374

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 375 ggtggacgcatgttcgc 391



to top

>emb|BX027324.1|CNS08T8W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 280 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 339

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 340 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 399

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 400 ggtggacgcatgttcgc 416



to top

>emb|BX027271.1|CNS08T7F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX027230.1|CNS08T6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 327

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 328 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtgcgggaacatgtgccgt 387

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 388 ggtggacgcatgttcgc 404



to top

>emb|BX027166.1|CNS08T4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 274 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 333

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 334 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 393

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 394 ggtggacgcatgttcgc 410



to top

>emb|BX026891.1|CNS08SWV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 138 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 197

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 198 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 257

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 258 ggtggacgcatgttcgc 274



to top

>emb|BX026633.1|CNS08SPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 256 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 315

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 316 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX026544.1|CNS08SN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 276 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 335

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 336 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 395

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 396 ggtggacgcatgttcgc 412



to top

>emb|BX025273.1|CNS08RNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 709

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX025114.1|CNS08RJI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX024925.1|CNS08RE9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX024604.1|CNS08R5C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 213 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 272

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 273 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 332

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 333 ggtggacgcatgttcgc 349



to top

>emb|BX024150.1|CNS08QSQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX022076.1|CNS08P74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 194 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 253

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 254 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 313

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 314 ggtggacgcatgttcgc 330



to top

>emb|BX019595.1|CNS08NA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 220 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 279

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 280 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 339

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 340 ggtggacgcatgttcgc 356



to top

>emb|BX021406.1|CNS08OOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 266 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 325

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 326 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 385

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 386 ggtggacgcatgttcgc 402



to top

>emb|BX020675.1|CNS08O47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX020239.1|CNS08NS3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           ||| |||||||||||||
Sbjct: 387 ggccgacgcatgttcgc 403



to top

>emb|BX019840.1|CNS08NH0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 327

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 328 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 387

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 388 ggtggacgcatgttcgc 404



to top

>emb|BX019458.1|CNS08N6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX018909.1|CNS08MR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 249 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 308

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 309 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 368

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 369 ggtggacgcatgttcgc 385



to top

>emb|BX017960.1|CNS08M0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX016402.1|CNS08KTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 451

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 284 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 343

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 344 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 403

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 404 ggtggacgcatgttcgc 420



to top

>emb|BX015414.1|CNS08K22 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 225 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 284

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 285 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 344

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 345 ggtggacgcatgttcgc 361



to top

>emb|BX015216.1|CNS08JWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 327

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 328 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 387

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 388 ggtggacgcatgttcgc 404



to top

>emb|BX015196.1|CNS08JW0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 266 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 325

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 326 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 385

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 386 ggtggacgcatgttcgc 402



to top

>emb|BX014706.1|CNS08JIE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 228 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 287

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 288 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 347

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 348 ggtggacgcatgttcgc 364



to top

>emb|BX014916.1|CNS08JO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 250 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 309

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 310 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 369

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 370 ggtggacgcatgttcgc 386



to top

>emb|BX014856.1|CNS08JMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           ||| |||||||||||||
Sbjct: 382 ggccgacgcatgttcgc 398



to top

>emb|BX013748.1|CNS08IRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 327

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 328 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 387

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 388 ggtggacgcatgttcgc 404



to top

>emb|BX013627.1|CNS08IOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX013270.1|CNS08IEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1064

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 275 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 334

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 335 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 394

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 395 ggtggacgcatgttcgc 411



to top

>emb|BX012265.1|CNS08HML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 269 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 328

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 329 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 388

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 389 ggtggacgcatgttcgc 405



to top

>emb|BX011982.1|CNS08HEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 256 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 315

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 316 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX011974.1|CNS08HEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX010132.1|CNS08FZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX010011.1|CNS08FVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 250 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 309

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 310 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 369

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 370 ggtggacgcatgttcgc 386



to top

>emb|BX009959.1|CNS08FUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX009257.1|CNS08FB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 275 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 334

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 335 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 394

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 395 ggtggacgcatgttcgc 411



to top

>emb|BX008853.1|CNS08EZT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 299

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 23  gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 82

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 83  cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 142

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 143 ggtggacgcatgttcgc 159



to top

>emb|BX008455.1|CNS08EOR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 274 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 333

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 334 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 393

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 394 ggtggacgcatgttcgc 410



to top

>emb|BX007776.1|CNS08E5W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 285 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 344

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 345 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 404

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 405 ggtggacgcatgttcgc 421



to top

>emb|BX005962.1|CNS08CRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 202 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 261

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 262 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 321

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 322 ggtggacgcatgttcgc 338



to top

>emb|BX005882.1|CNS08CPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 378

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 379 ggtggacgcatgttcgc 395



to top

>emb|BX005776.1|CNS08CMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 244 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 303

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 304 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 363

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 364 ggtggacgcatgttcgc 380



to top

>emb|BX005555.1|CNS08CG7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>ref|XM_312665.2| Anopheles gambiae str. PEST ENSANGP00000020662
           (ENSANGG00000018173), partial mRNA
          Length = 1224

 Score =  129 bits (65), Expect = 8e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 193 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 252

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 253 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 312

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 313 ggtggacgcatgttcgc 329



to top

>emb|BX016572.1|CNS08KY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score =  125 bits (63), Expect = 1e-25
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                       
Query: 243 cggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcg 302
           |||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||||
Sbjct: 1   cggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccgcg 60

                                                                       
Query: 303 tgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtgg 362
           |||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||||
Sbjct: 61  tgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgtgg 120

                          
Query: 363 cggacgcatgttcgc 377
            ||||||||||||||
Sbjct: 121 tggacgcatgttcgc 135



to top

>emb|BX053942.1|CNS09DSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score =  123 bits (62), Expect = 5e-25
 Identities = 120/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 92  gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 151

                                                                       
Query: 301 cgtgtcggcgg-cggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           |||||| |||| |||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 152 cgtgtccgcggccggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 211

                             
Query: 360 tggcggacgcatgttcgc 377
           ||||||||||||||||||
Sbjct: 212 tggcggacgcatgttcgc 229



to top

>emb|BX036130.1|CNS0901I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score =  123 bits (62), Expect = 5e-25
 Identities = 120/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 241 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 300

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccg-cgccgggcagggagccttcggcaacatgtgccg 359
           |||||| |||||||||| |||||||| | |||| ||||| || | ||| |||||||||||
Sbjct: 301 cgtgtccgcggcggtggtacccaccgcccccggccagggtgcgtacggtaacatgtgccg 360

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 361 tggtggacgcatgttcgc 378



to top

>emb|BX071015.1|CNS09QYJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 316

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 317 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 376

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 377 ggtggacgcatgttcgc 393



to top

>emb|BX070157.1|CNS09QAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           | |||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 catgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX068805.1|CNS09P95 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           ||  |||||||||||||
Sbjct: 380 ggttgacgcatgttcgc 396



to top

>emb|BX060249.1|CNS09INH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 278 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 336

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 337 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 396

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 397 ggtggacgcatgttcgc 413



to top

>emb|BX057837.1|CNS09GSH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 253 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 312

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 313 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 372

                            
Query: 361 ggcggacgcatgttcgc 377
           |||  ||||||||||||
Sbjct: 373 ggcccacgcatgttcgc 389



to top

>emb|BX049803.1|CNS09ALB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 223 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 281

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 282 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 341

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 342 ggtggacgcatgttcgc 358



to top

>emb|BX046083.1|CNS097PZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 414

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 267 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| || || || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccacggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX044586.1|CNS096KE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 247 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 306

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 307 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 366

                            
Query: 361 ggcggacgcatgttcgc 377
            | ||||||||||||||
Sbjct: 367 aggggacgcatgttcgc 383



to top

>emb|BX043521.1|CNS095QT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 280 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 339

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 340 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 399

                            
Query: 361 ggcggacgcatgttcgc 377
           ||  |||||||||||||
Sbjct: 400 ggttgacgcatgttcgc 416



to top

>emb|BX033912.1|CNS08YBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 243 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 302

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 303 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 362

                            
Query: 361 ggcggacgcatgttcgc 377
           |||  ||||||||||||
Sbjct: 363 ggcttacgcatgttcgc 379



to top

>emb|BX033780.1|CNS08Y88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 328

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 329 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 388

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 389 ggtggacgcatgttcgc 405



to top

>emb|BX032883.1|CNS08XJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||  |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgttcgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 381

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 382 ggtggacgcatgttcgc 398



to top

>emb|BX029876.1|CNS08V7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 276 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 335

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 336 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 395

                            
Query: 361 ggcggacgcatgttcgc 377
           || |||||||| |||||
Sbjct: 396 ggtggacgcattttcgc 412



to top

>emb|BX029038.1|CNS08UKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX028617.1|CNS08U8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           ||  |||||||||||||
Sbjct: 380 ggttgacgcatgttcgc 396



to top

>emb|BX028094.1|CNS08TUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score =  121 bits (61), Expect = 2e-24
 Identities = 115/133 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                        
Query: 361 ggcggacgcatgt 373
           || ||||||||||
Sbjct: 380 ggtggacgcatgt 392



to top

>emb|BX025515.1|CNS08RUN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 251 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 310

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 311 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 370

                            
Query: 361 ggcggacgcatgttcgc 377
           || || |||||||||||
Sbjct: 371 ggtgggcgcatgttcgc 387



to top

>emb|BX022958.1|CNS08PVM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 579

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| || |||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaaaatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 393 ggtggacgcatgttcgc 409



to top

>emb|BX022235.1|CNS08PBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 332 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 391

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 392 ggtggacgcatgttcgc 408



to top

>emb|BX021578.1|CNS08OTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1061

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 285 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 344

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||| ||||||
Sbjct: 345 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatttgccgt 404

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 405 ggtggacgcatgttcgc 421



to top

>emb|BX016278.1|CNS08KQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 256 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 314

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 315 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 374

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 375 ggtggacgcatgttcgc 391



to top

>emb|BX011461.1|CNS08H09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 225 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 284

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 285 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 344

                            
Query: 361 ggcggacgcatgttcgc 377
           || |||||| |||||||
Sbjct: 345 ggtggacgcttgttcgc 361



to top

>emb|BX009034.1|CNS08F4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 333 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 392

                            
Query: 361 ggcggacgcatgttcgc 377
           ||  |||||||||||||
Sbjct: 393 ggttgacgcatgttcgc 409



to top

>emb|BX007697.1|CNS08E3P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||  | |||||||||
Sbjct: 240 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtagcccgtatcccg 299

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 300 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 359

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 360 ggtggacgcatgttcgc 376



to top

>emb|BX007185.1|CNS08DPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score =  121 bits (61), Expect = 2e-24
 Identities = 119/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 273 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 332 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 391

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 392 ggtggacgcatgttcgc 408



to top

>emb|BX006719.1|CNS08DCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| |||   |||||||||
Sbjct: 263 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtgggccgtatcccg 322

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 323 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 382

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 383 ggtggacgcatgttcgc 399



to top

>emb|BX006260.1|CNS08CZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||| ||| ||| | |||||||||
Sbjct: 227 gccggtcaccagacgtcggccgaatcgtggggtaccggtcacgctgtggcccgtatcccg 286

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 287 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 346

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 347 ggtggacgcatgttcgc 363



to top

>ref|XM_753952.1| Ustilago maydis 521 hypothetical protein (UM02898.1) partial mRNA
          Length = 1002

 Score =  119 bits (60), Expect = 8e-24
 Identities = 141/168 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 cagccctacgccgtctcccgcaaggccggtcaccagacctcggccgagtcctggggcacg 276
           |||||||| |||||||||   ||||| |||||||||||||| |||||||||||||| || 
Sbjct: 55  cagccctatgccgtctccactaaggctggtcaccagacctctgccgagtcctggggtacc 114

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           ||||| |||||  | |||||||| ||||||||||| ||||| ||||||||  |||| |||
Sbjct: 115 ggtcgtgccgtcgctcgtatcccccgtgtcggcggtggtggtacccaccgatccggtcag 174

                                                           
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgcgcccacc 384
           |  |||||||| ||||||  |||||| || | ||||||||| ||||||
Sbjct: 175 gccgccttcggtaacatggtccgtggtggtcacatgttcgcccccacc 222



to top

>gb|DQ440454.1| Aedes aegypti clone AET-617a ribosomal protein L4 mRNA, complete
           cds
          Length = 1296

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||||||||||||||| |||||||| || ||||| |||||| | ||||| |||
Sbjct: 181 gccggtcaccagacctcggccgaatcctggggaaccggtcgtgccgtggcccgtattccg 240

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | || ||||| || |||||  |||| ||||| |||||||| ||||||||||||
Sbjct: 241 cgtgtccgtggtggtggtactcaccgttccggccagggtgccttcggtaacatgtgccgt 300

                         
Query: 361 ggcggacgcatgtt 374
           || ||||| |||||
Sbjct: 301 ggtggacgtatgtt 314



to top

>emb|BX071467.1|CNS09RB3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 312

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacc-tcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           ||||||||||||||  |||||||| || ||||| || |||||||| ||| | ||||||||
Sbjct: 16  gccggtcaccagacgatcggccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 75

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 76  gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 135

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 136 tggtggacgcatgttcgc 153



to top

>emb|BX065961.1|CNS09N25 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 257 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 316

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 317 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 376

                             
Query: 361 gg-cggacgcatgttcgc 377
           ||  ||||||||||||||
Sbjct: 377 ggtgggacgcatgttcgc 394



to top

>emb|BX064526.1|CNS09LYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 586

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccag-acctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||||| || |||||||| || ||||| || |||||||| ||| | ||||||||
Sbjct: 240 gccggtcaccagtacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 299

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 300 gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 359

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 360 tggtggacgcatgttcgc 377



to top

>emb|BX054632.1|CNS09EBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 412

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 11  gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 70

                                                                       
Query: 301 cgtgtcggcgg-cggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           |||||| |||| |||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 71  cgtgtccgcggacggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 130

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 131 tggtggacgcatgttcgc 148



to top

>emb|BX048459.1|CNS099JZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 167

 Score =  115 bits (58), Expect = 1e-22
 Identities = 112/130 (86%)
 Strand = Plus / Plus

                                                                       
Query: 248 accagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcg 307
           ||||||| |||||||| || ||||| || |||||||| ||| | ||||||||||||||| 
Sbjct: 1   accagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccgcgtgtcc 60

                                                                       
Query: 308 gcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggcggac 367
           |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||||| ||||
Sbjct: 61  gcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgtggtggac 120

                     
Query: 368 gcatgttcgc 377
           ||||||||||
Sbjct: 121 gcatgttcgc 130



to top

>emb|BX035657.1|CNS08ZOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggcc-gagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||||||| |||||| || || ||||| || |||||||| ||| | ||||||||
Sbjct: 280 gccggtcaccagacgtcggcccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 339

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 340 gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 399

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 400 tggtggacgcatgttcgc 417



to top

>emb|BX034646.1|CNS08YWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtgg-aacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           |||||| |||||||||| | |||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 318 cgtgtccgcggcggtggtaccccaccgttccggccagggtgcgtacggtaacatgtgccg 377

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 378 tggtggacgcatgttcgc 395



to top

>emb|BX032528.1|CNS08X9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcg-gccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||||||| ||| ||||| || ||||| || |||||||| ||| | ||||||||
Sbjct: 278 gccggtcaccagacgtcgcgccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 337

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 338 gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 397

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 398 tggtggacgcatgttcgc 415



to top

>emb|BX031361.1|CNS08WD1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 252 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 311

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgc-cgggcagggagccttcggcaacatgtgccg 359
           |||||| |||||||||| ||||||||  | ||| ||||| || | ||| |||||||||||
Sbjct: 312 cgtgtccgcggcggtggtacccaccgttcgcggccagggtgcgtacggtaacatgtgccg 371

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 372 tggtggacgcatgttcgc 389



to top

>emb|BX021630.1|CNS08OUQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcg-gccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||||||| ||| ||||| || ||||| || |||||||| ||| | ||||||||
Sbjct: 274 gccggtcaccagacgtcgcgccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 333

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 334 gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 393

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 394 tggtggacgcatgttcgc 411



to top

>emb|CR938469.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YM09AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 540

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||||||||||||||| |||||||| || ||||| |||||| | ||||| |||
Sbjct: 246 gccggtcaccagacctcggccgaatcctggggaaccggtcgtgccgtggcccgtattccg 305

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | || ||||| || |||||  |||| ||||| |||||||| ||||||||||||
Sbjct: 306 cgtgtccgtggtggtggtactcaccgttccggccagggtgccttcggtaacatgtgccgt 365

                         
Query: 361 ggcggacgcatgtt 374
           || ||||| |||||
Sbjct: 366 ggtggacgtatgtt 379



to top

>emb|CR938086.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK24AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 816

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||||||||||||||| |||||||| || ||||| |||||| | ||||| |||
Sbjct: 273 gccggtcaccagacctcggccgaatcctggggaaccggtcgtgccgtggcccgtattccg 332

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | || ||||| || |||||  |||| ||||| |||||||| ||||||||||||
Sbjct: 333 cgtgtccgtggtggtggtactcaccgttccggtcagggtgccttcggtaacatgtgccgt 392

                         
Query: 361 ggcggacgcatgtt 374
           || ||||| |||||
Sbjct: 393 ggtggacgtatgtt 406



to top

>emb|CR938041.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YM11AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 781

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||||||||||||||| |||||||| || ||||| |||||| | ||||| |||
Sbjct: 272 gccggtcaccagacctcggccgaatcctggggaaccggtcgtgccgtggcccgtattccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | || ||||| || |||||  |||| ||||| |||||||| ||||||||||||
Sbjct: 332 cgtgtccgtggtggtggtactcaccgttccggtcagggtgccttcggtaacatgtgccgt 391

                         
Query: 361 ggcggacgcatgtt 374
           || ||||| |||||
Sbjct: 392 ggtggacgtatgtt 405



to top

>gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete sequence
          Length = 172362

 Score =  113 bits (57), Expect = 5e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                         
Query: 244   ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
             |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 35140 ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 35199

                                                                         
Query: 304   gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
             ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 35200 gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 35259

                                  
Query: 364   ggacgcatgttcgcgcccacc 384
             |||||||||||||| ||||||
Sbjct: 35260 ggacgcatgttcgcccccacc 35280



to top

>emb|BX060779.1|CNS09J27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 269 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 328

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 329 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 388

                            
Query: 361 ggcggacgcatgttcgc 377
           ||   ||||||||||||
Sbjct: 389 ggtaaacgcatgttcgc 405



to top

>emb|BX058138.1|CNS09H0U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||  || |||||||| ||| | |||||||||
Sbjct: 268 gccggtcaccagacgtcggccgaatcgtgggt-accggtcgcgctgtggcccgtatcccg 326

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 327 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 386

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 387 ggtggacgcatgttcgc 403



to top

>emb|BX054627.1|CNS09EBB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||| | || ||||| || |||||||| ||| | |||||||||
Sbjct: 243 gccggtcaccagacgtcggccaa-tcgtggggtaccggtcgcgctgtggcccgtatcccg 301

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 302 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 361

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 362 ggtggacgcatgttcgc 378



to top

>emb|BX052380.1|CNS09CKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX052359.1|CNS09CKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 247 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 306

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 307 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 365

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 366 ggtggacgcatgttcgc 382



to top

>emb|BX051843.1|CNS09C5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 167 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 225

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | | | ||||||||||||
Sbjct: 226 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacagtaacatgtgccgt 285

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 286 ggtggacgcatgttcgc 302



to top

>emb|BX048690.1|CNS099QE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score =  113 bits (57), Expect = 5e-22
 Identities = 115/133 (86%), Gaps = 1/133 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 157 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 215

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 216 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 275

                        
Query: 361 ggcggacgcatgt 373
           || ||||||||||
Sbjct: 276 ggtggacgcatgt 288



to top

>emb|BX047476.1|CNS098SO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 215 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 274

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 275 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 333

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 334 ggtggacgcatgttcgc 350



to top

>emb|BX043964.1|CNS09634 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 257 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 316

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 317 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX043794.1|CNS095YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 272 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 332 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 390

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 391 ggtggacgcatgttcgc 407



to top

>emb|BX039890.1|CNS092XY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 261 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 321 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 380 ggtggacgcatgttcgc 396



to top

>emb|BX036997.1|CNS090PL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 658

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 257 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 316

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 317 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 375

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 376 ggtggacgcatgttcgc 392



to top

>emb|BX030333.1|CNS08VKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 568

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 319

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 320 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 379

                            
Query: 361 ggcggacgcatgttcgc 377
           ||   ||||||||||||
Sbjct: 380 ggaaaacgcatgttcgc 396



to top

>emb|BX024520.1|CNS08R30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 270 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 329

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 330 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 388

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 389 ggtggacgcatgttcgc 405



to top

>emb|BX023770.1|CNS08QI6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 277 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 336

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 337 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 395

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 396 ggtggacgcatgttcgc 412



to top

>emb|BX011625.1|CNS08H4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 239 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 298

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 299 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 357

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 358 ggtggacgcatgttcgc 374



to top

>emb|BX009620.1|CNS08FL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 264 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 323

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 324 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 382

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 383 ggtggacgcatgttcgc 399



to top

>emb|BX006833.1|CNS08DFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 262 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 321

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 322 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 380

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 381 ggtggacgcatgttcgc 397



to top

>emb|BX005633.1|CNS08CID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score =  113 bits (57), Expect = 5e-22
 Identities = 118/137 (86%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 272 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 331

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 332 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 390

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 391 ggtggacgcatgttcgc 407



to top

>emb|X13382.1|DMRPL1R Drosophila melanogaster mRNA for put. ribosomal protein L1
          Length = 1334

 Score =  113 bits (57), Expect = 5e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
           |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 253 ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 312

                                                                       
Query: 304 gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
           ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 313 gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 372

                                
Query: 364 ggacgcatgttcgcgcccacc 384
           |||||||||||||| ||||||
Sbjct: 373 ggacgcatgttcgcccccacc 393



to top

>ref|NM_079814.2| Drosophila melanogaster Ribosomal protein L4 CG5502-RA (RpL4), mRNA
          Length = 1462

 Score =  113 bits (57), Expect = 5e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
           |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 308 ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 367

                                                                       
Query: 304 gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
           ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 368 gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 427

                                
Query: 364 ggacgcatgttcgcgcccacc 384
           |||||||||||||| ||||||
Sbjct: 428 ggacgcatgttcgcccccacc 448



to top

>gb|AY069485.1| Drosophila melanogaster LD21756 full length cDNA
          Length = 1386

 Score =  113 bits (57), Expect = 5e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
           |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 246 ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 305

                                                                       
Query: 304 gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
           ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 306 gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 365

                                
Query: 364 ggacgcatgttcgcgcccacc 384
           |||||||||||||| ||||||
Sbjct: 366 ggacgcatgttcgcccccacc 386



to top

>gb|AE003763.3| Drosophila melanogaster chromosome 3R, section 101 of 118 of the
             complete sequence
          Length = 206189

 Score =  113 bits (57), Expect = 5e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                         
Query: 244   ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
             |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 30916 ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 30975

                                                                         
Query: 304   gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
             ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 30976 gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 31035

                                  
Query: 364   ggacgcatgttcgcgcccacc 384
             |||||||||||||| ||||||
Sbjct: 31036 ggacgcatgttcgcccccacc 31056



to top

>emb|BX040293.1|CNS09395 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score =  109 bits (55), Expect = 8e-21
 Identities = 120/139 (86%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 275 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 334

                                                                       
Query: 301 cgtgtcggcggcggt-ggaacccaccgcgccgggcagggagc-cttcggcaacatgtgcc 358
           |||||| |||||||| || ||||||||  |||| ||||| || || ||| ||||||||||
Sbjct: 335 cgtgtccgcggcggtgggtacccaccgttccggccagggtgcgctacggtaacatgtgcc 394

                              
Query: 359 gtggcggacgcatgttcgc 377
           |||| ||||||||||||||
Sbjct: 395 gtggtggacgcatgttcgc 413



to top

>emb|BX059255.1|CNS09HVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score =  107 bits (54), Expect = 3e-20
 Identities = 118/138 (85%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| | |||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 213 gccggtcaccagacgtgggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 272

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcg-gcaacatgtgccg 359
           |||||| |||||||||| ||||||||  |||| ||||| || | || | |||||||||||
Sbjct: 273 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacgcgtaacatgtgccg 332

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 333 tggtggacgcatgttcgc 350



to top

>emb|BX049372.1|CNS09A9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score =  107 bits (54), Expect = 3e-20
 Identities = 118/138 (85%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 258 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 317

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgc-cgggcagggagccttcggcaacatgtgccg 359
           |||||| |||||||||| ||||||||  | ||| ||||| || | ||| |||||||||||
Sbjct: 318 cgtgtccgcggcggtggtacccaccgttcacggccagggtgcgtacggtaacatgtgccg 377

                             
Query: 360 tggcggacgcatgttcgc 377
           | | ||||||||||||||
Sbjct: 378 ttgtggacgcatgttcgc 395



to top

>emb|BX034795.1|CNS08Z0F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score =  107 bits (54), Expect = 3e-20
 Identities = 105/122 (86%)
 Strand = Plus / Plus

                                                                       
Query: 256 tcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggt 315
           |||||||| || ||||| || |||||||| ||| | ||||||||||||||| ||||||||
Sbjct: 274 tcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccgcgtgtccgcggcggt 333

                                                                       
Query: 316 ggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttc 375
           || ||||||||  |||| ||||| || | ||| |||||||||||||| ||||||||||||
Sbjct: 334 ggtacccaccgttccggccagggtgcgtacggtaacatgtgccgtggtggacgcatgttc 393

             
Query: 376 gc 377
           ||
Sbjct: 394 gc 395



to top

>emb|BX027534.1|CNS08TEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 451

 Score =  107 bits (54), Expect = 3e-20
 Identities = 119/138 (86%), Gaps = 2/138 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacct-cggccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||||||| | ||||||| || ||||| |||| |||||| ||| | ||||||||
Sbjct: 272 gccggtcaccagacgttcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatccc 330

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| |||||||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 331 gcgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 390

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 391 tggtggacgcatgttcgc 408



to top

>ref|XM_778380.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L4 (LOC578192), mRNA
          Length = 1350

 Score =  107 bits (54), Expect = 3e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                       
Query: 292 cgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaac 351
           |||||||| |||||| | || ||||| ||||||||| | || |||||||||||||| |||
Sbjct: 272 cgtatcccccgtgtccggggtggtggtacccaccgctctggtcagggagccttcggtaac 331

                                                                 
Query: 352 atgtgccgtggcggacgcatgttcgcgcccacccggatctggcgcaagtggcac 405
           ||||||||||||||||||||||| || || |||  ||||||||| |||||||||
Sbjct: 332 atgtgccgtggcggacgcatgtttgcccctaccaagatctggcgtaagtggcac 385



to top

>emb|X06881.1|DMRPL1 Drosophila gene for ribosomal protein L1 fragment
          Length = 720

 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgt 303
           |||||||||||||| |||||||||||||| || || || || ||| | ||||| || |||
Sbjct: 9   ggtcaccagacctccgccgagtcctggggtaccggacgtgctgtggcccgtattccccgt 68

                                                                       
Query: 304 gtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggc 363
           ||  | || || || ||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 69  gtgcgtggtggcggtacccaccgttccggccagggagccttcggcaacatgtgccgtggt 128

                         
Query: 364 ggacgcatgttcgc 377
           ||||||||||||||
Sbjct: 129 ggacgcatgttcgc 142



to top

>emb|CR938640.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YD06AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 500

 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||| ||||||||||| |||||||| || ||||| |||||| | ||||| |||
Sbjct: 261 gccggtcaccaaacctcggccgaatcctggggaaccggtcgtgccgtggcccgtattccg 320

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | || ||||| || |||||  |||| ||||| |||||||| ||||||||||||
Sbjct: 321 cgtgtccgtggtggtggtactcaccgttccggccagggtgccttcggtaacatgtgccgt 380

                         
Query: 361 ggcggacgcatgtt 374
           || ||||| |||||
Sbjct: 381 ggtggacgtatgtt 394



to top

>gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 10, complete
              sequence
          Length = 1085720

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Minus

                                                                          
Query: 241    gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
              ||||||||||||||||| |||||||||||||| || ||||| |||||  |||||||||| 
Sbjct: 562066 gccggtcaccagacctctgccgagtcctggggtaccggtcgtgccgttgcgcgtatcccc 562007

                                                                          
Query: 301    cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
              ||||| ||||| ||||| ||||| ||  |||| ||||  || ||||| ||||||||||| 
Sbjct: 562006 cgtgttggcggtggtggtacccagcgatccggccaggccgcgttcggtaacatgtgccga 561947

                               
Query: 361    ggcggacgcatgttcgc 377
              ||||| || ||||||||
Sbjct: 561946 ggcggtcgaatgttcgc 561930



to top

>ref|XM_567364.1| Cryptococcus neoformans var. neoformans JEC21 Ras2 (CNJ01920)
           partial mRNA
          Length = 1164

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||||||||||||||| |||||||||||||| || ||||| |||||  |||||||||| 
Sbjct: 189 gccggtcaccagacctctgccgagtcctggggtaccggtcgtgccgttgcgcgtatcccc 248

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           ||||| ||||| ||||| ||||| ||  |||| ||||  || ||||| ||||||||||| 
Sbjct: 249 cgtgttggcggtggtggtacccagcgatccggccaggccgcgttcggtaacatgtgccga 308

                            
Query: 361 ggcggacgcatgttcgc 377
           ||||| || ||||||||
Sbjct: 309 ggcggtcgaatgttcgc 325



to top

>emb|BX059712.1|CNS09I8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 411

 Score =  105 bits (53), Expect = 1e-19
 Identities = 118/137 (86%), Gaps = 2/137 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 16  gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 74

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| ||| |||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 75  cgtgtccgcg-cggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 133

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 134 ggtggacgcatgttcgc 150



to top

>emb|BX058351.1|CNS09H6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 cggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtg 316
           ||||||| || ||||| || |||||||| ||| | ||||||||||||||| |||||||||
Sbjct: 1   cggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccgcgtgtccgcggcggtg 60

                                                                       
Query: 317 gaacccaccgcgccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcg 376
           | ||||||||  |||| ||||| || | ||| |||||||||||||| |||||||||||||
Sbjct: 61  gtacccaccgttccggccagggtgcgtacggtaacatgtgccgtggtggacgcatgttcg 120

            
Query: 377 c 377
           |
Sbjct: 121 c 121



to top

>emb|BX057329.1|CNS09GED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score =  105 bits (53), Expect = 1e-19
 Identities = 118/137 (86%), Gaps = 2/137 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| |||| |||||| ||| | |||||||||
Sbjct: 260 gccggtcaccagacgtcggccgaatcgtggggtacgg-tcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| ||| |||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 319 cgtgtccgcg-cggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX044408.1|CNS096FG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score =  105 bits (53), Expect = 1e-19
 Identities = 117/137 (85%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 259 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 318

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| ||||||||  |||| ||||| || | ||| |||||| |||||
Sbjct: 319 cgtgtccgc-gcggtggtacccaccgttccggccagggtgcgtacggtaacatgcgccgt 377

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 378 ggtggacgcatgttcgc 394



to top

>emb|BX026422.1|CNS08SJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 561

 Score =  105 bits (53), Expect = 1e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 24  gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 83

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 84  cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 143

            
Query: 361 g 361
           |
Sbjct: 144 g 144



to top

>emb|BX013720.1|CNS08IR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| | | | |||||||||
Sbjct: 265 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgcggcccgtatcccg 324

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||||||
Sbjct: 325 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccgt 384

                            
Query: 361 ggcggacgcatgttcgc 377
           ||   ||||||||||||
Sbjct: 385 ggtttacgcatgttcgc 401



to top

>emb|BX006709.1|CNS08DC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score =  105 bits (53), Expect = 1e-19
 Identities = 117/137 (85%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 266 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 325

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| || ||||||| |||||| | | ||| ||||| || | ||| ||||||||||||
Sbjct: 326 cgtgtccgc-gcggtggtacccacgggggcggccagggtgcgtacggtaacatgtgccgt 384

                            
Query: 361 ggcggacgcatgttcgc 377
           || ||||||||||||||
Sbjct: 385 ggtggacgcatgttcgc 401



to top

>emb|BX012712.1|CNS08HZ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score =  103 bits (52), Expect = 5e-19
 Identities = 118/139 (84%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 183 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 242

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtg--cc 358
           |||||| |||||||||| ||||||||  |||| ||||| || | ||| ||||||||  | 
Sbjct: 243 cgtgtccgcggcggtggtacccaccgttccggccagggtgcgtacggtaacatgtgcacg 302

                              
Query: 359 gtggcggacgcatgttcgc 377
           |||| ||||||||||||||
Sbjct: 303 gtggtggacgcatgttcgc 321



to top

>emb|BX044279.1|CNS096BV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 664

 Score =  101 bits (51), Expect = 2e-18
 Identities = 119/139 (85%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           |||||||||||||| |||||||| || ||||| || |||||||| ||| | |||||||||
Sbjct: 252 gccggtcaccagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatcccg 311

                                                                       
Query: 301 cgtgtcggc-ggcggtggaacccaccg-cgccgggcagggagccttcggcaacatgtgcc 358
           |||||| || |||||||| ||||||||   |||| ||||| || | ||| ||||||||||
Sbjct: 312 cgtgtccgcgggcggtggtacccaccgtatccggccagggtgcgtacggtaacatgtgcc 371

                              
Query: 359 gtggcggacgcatgttcgc 377
           |||| ||||||||||||||
Sbjct: 372 gtggtggacgcatgttcgc 390



to top

>emb|BX020278.1|CNS08NT6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 gccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtgga 318
           ||||| || ||||| || |||||||| ||| | ||||||||||||||| |||||||||| 
Sbjct: 286 gccgaatcgtggggtaccggtcgcgctgtggcccgtatcccgcgtgtccgcggcggtggt 345

                                                                      
Query: 319 acccaccgcgccgggcagggagccttcggcaacatgtgccgtggcggacgcatgttcgc 377
           ||||||||  |||| ||||| || | ||| |||||||||||||| ||||||||||||||
Sbjct: 346 acccaccgttccggccagggtgcgtacggtaacatgtgccgtggtggacgcatgttcgc 404



to top

>emb|BX025743.1|CNS08S0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 118/138 (85%), Gaps = 2/138 (1%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcacc-agacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatccc 299
           |||||||||| |||| |||||||| || ||||| || |||||||| ||| | ||||||||
Sbjct: 247 gccggtcacctagacgtcggccgaatcgtggggtaccggtcgcgctgtggcccgtatccc 306

                                                                       
Query: 300 gcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccg 359
           ||||||| ||| |||||| ||||||||  |||| ||||| || | ||| |||||||||||
Sbjct: 307 gcgtgtccgcg-cggtggtacccaccgttccggccagggtgcgtacggtaacatgtgccg 365

                             
Query: 360 tggcggacgcatgttcgc 377
           ||| ||||||||||||||
Sbjct: 366 tggtggacgcatgttcgc 383



to top

>ref|XM_966541.1| PREDICTED: Tribolium castaneum similar to CG5502-PA (LOC660298),
           mRNA
          Length = 1369

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 241 gccggtcaccagacctcggccgagtcctggggcacgggtcgcgccgtgtcgcgtatcccg 300
           ||||| ||||||||||| ||||||||||||||||| || || |||||| ||||||| || 
Sbjct: 244 gccggccaccagacctctgccgagtcctggggcactggccgtgccgtggcgcgtattccc 303

                                                                       
Query: 301 cgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaacatgtgccgt 360
           |||||| | ||||| || ||||||||| | || ||||| || ||||| |||||||| || 
Sbjct: 304 cgtgtccggggcggcggcacccaccgctcgggacagggtgcgttcgggaacatgtgtcgc 363

                            
Query: 361 ggcggacgcatgttcgc 377
           || || |||||||||||
Sbjct: 364 ggggggcgcatgttcgc 380



to top

>emb|BX024418.1|CNS08R06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 212

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 277 ggtcgcgccgtgtcgcgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcag 336
           |||||||| ||| | ||||||||||||||| |||||||||| ||||||||  |||| |||
Sbjct: 1   ggtcgcgctgtggcccgtatcccgcgtgtccgcggcggtggtacccaccgttccggccag 60

                                                    
Query: 337 ggagccttcggcaacatgtgccgtggcggacgcatgttcgc 377
           || || | ||| |||||||||||||| ||||||||||||||
Sbjct: 61  ggtgcgtacggtaacatgtgccgtggtggacgcatgttcgc 101



to top

>emb|AJ312335.1|OMY312335 Oncorhynchus mykiss partial mRNA for putative ribosomal protein
           L4B(L1B) protein
          Length = 620

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                       
Query: 292 cgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaac 351
           |||||||| |||||  | || ||||||||||||||| |||| ||||||||||||||||| 
Sbjct: 188 cgtatcccccgtgtgaggggaggtggaacccaccgctccggccagggagccttcggcaat 247

                                            
Query: 352 atgtgccgtggcggacgcatgttcgcgcccacc 384
           ||||| ||||| || ||||||||||||||||||
Sbjct: 248 atgtgtcgtggaggtcgcatgttcgcgcccacc 280



to top

>emb|AJ315139.1|OMY315139 Oncorhynchus mykiss partial mRNA for putative ribosomal protein L4
          Length = 1000

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                       
Query: 292 cgtatcccgcgtgtcggcggcggtggaacccaccgcgccgggcagggagccttcggcaac 351
           |||||||| |||||  | || ||||||||||||||| |||| ||||||||||||||||| 
Sbjct: 263 cgtatcccccgtgtgaggggaggtggaacccaccgctccggccagggagccttcggcaat 322

                                            
Query: 352 atgtgccgtggcggacgcatgttcgcgcccacc 384
           ||||| ||||| || ||||||||||||||||||
Sbjct: 323 atgtgtcgtggaggtcgcatgttcgcgcccacc 355


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,823,956
Number of Sequences: 3902068
Number of extensions: 1823956
Number of successful extensions: 45007
Number of sequences better than 10.0: 377
Number of HSP's better than 10.0 without gapping: 382
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43501
Number of HSP's gapped (non-prelim): 1439
length of query: 450
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 428
effective length of database: 17,147,199,772
effective search space: 7339001502416
effective search space used: 7339001502416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top