ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl28h04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY613783.1| Aegilops tauschii isolate TA2468 clone 1 LZ-NBS-LRR class RGA and NBS-LRR class RGA genes, complete cds Length = 15042 Score = 198 bits (100), Expect = 1e-47 Identities = 180/204 (88%), Gaps = 2/204 (0%) Strand = Plus / Minus Query: 275 ctcctgcccaagatctttgtctgccccggcttcgacccatccgacaagctcctggagctg 334 |||||||||||| || ||| ||||| |||||||||| | || | ||||||| ||||||| Sbjct: 14868 ctcctgcccaaggtccttgcctgcctcggcttcgacgcctcgcagaagctccgggagctg 14809 Query: 335 gagatccacatcatcccggagctgaagaagacgacgcggaccgtcgatcaagagaggatg 394 ||||||||||||||||||||||||||||||||| | || |||| ||||| ||||||||| Sbjct: 14808 gagatccacatcatcccggagctgaagaagacggtgagggccgtggatcaggagaggatg 14749 Query: 395 atgcagagagaaaagagagtgaaaaccgatttggatgcgctggac-agatggccgccatg 453 |||||||||| || |||||||||||||||||||| || |||||| ||||||| |||||| Sbjct: 14748 atgcagagagggaatagagtgaaaaccgatttggacgccctggacaagatggctgccatg 14689 Query: 454 ctgaggc-cgctctcgaggatgcc 476 ||||||| |||||||||||||||| Sbjct: 14688 ctgaggcacgctctcgaggatgcc 14665
>gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR class RGA, HCBT-like putative defense response protein, and putative alliin lyase genes, complete cds; and unknown genes Length = 106618 Score = 198 bits (100), Expect = 1e-47 Identities = 180/204 (88%), Gaps = 2/204 (0%) Strand = Plus / Minus Query: 275 ctcctgcccaagatctttgtctgccccggcttcgacccatccgacaagctcctggagctg 334 |||||||||||| || ||| ||||| |||||||||| | || | ||||||| ||||||| Sbjct: 27871 ctcctgcccaaggtccttgcctgcctcggcttcgacgcctcgcagaagctccgggagctg 27812 Query: 335 gagatccacatcatcccggagctgaagaagacgacgcggaccgtcgatcaagagaggatg 394 ||||||||||||||||||||||||||||||||| | || |||| ||||| ||||||||| Sbjct: 27811 gagatccacatcatcccggagctgaagaagacggtgagggccgtggatcaggagaggatg 27752 Query: 395 atgcagagagaaaagagagtgaaaaccgatttggatgcgctggac-agatggccgccatg 453 |||||||||| || |||||||||||||||||||| || |||||| ||||||| |||||| Sbjct: 27751 atgcagagagggaatagagtgaaaaccgatttggacgccctggacaagatggctgccatg 27692 Query: 454 ctgaggc-cgctctcgaggatgcc 476 ||||||| |||||||||||||||| Sbjct: 27691 ctgaggcacgctctcgaggatgcc 27668
>gb|AC122844.4| Mus musculus BAC clone RP23-152A2 from 7, complete sequence Length = 194266 Score = 48.1 bits (24), Expect = 0.026 Identities = 24/24 (100%) Strand = Plus / Minus Query: 390 ggatgatgcagagagaaaagagag 413 |||||||||||||||||||||||| Sbjct: 64077 ggatgatgcagagagaaaagagag 64054
>gb|AY145086.1| Aegilops tauschii rust-resistance protein Lr21 gene, complete cds Length = 4687 Score = 48.1 bits (24), Expect = 0.026 Identities = 76/92 (82%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 370 gcggaccgtcgatcaagagaggatgatgcagagagaaaagagagtgaaaaccgatttgga 429 |||| |||| ||||| ||||||||||||| ||||| ||||| | || ||||| ||| Sbjct: 745 gcgggccgtagatcaggagaggatgatgctgagaggaaagaaatcaaactccgatgtggc 804 Query: 430 tgcgctggaca-gatggccgccatgctgaggc 460 || ||||||| |||||||||||||||||||| Sbjct: 805 cgcactggacaagatggccgccatgctgaggc 836
>gb|AF532104.1|AF532104S1 Aegilops tauschii strain TA1649 cosmid 69-7-1 Lr21 gene, complete cds; and unknown gene Length = 27960 Score = 48.1 bits (24), Expect = 0.026 Identities = 76/92 (82%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 370 gcggaccgtcgatcaagagaggatgatgcagagagaaaagagagtgaaaaccgatttgga 429 |||| |||| ||||| ||||||||||||| ||||| ||||| | || ||||| ||| Sbjct: 15903 gcgggccgtagatcaggagaggatgatgctgagaggaaagaaatcaaactccgatgtggc 15962 Query: 430 tgcgctggaca-gatggccgccatgctgaggc 460 || ||||||| |||||||||||||||||||| Sbjct: 15963 cgcactggacaagatggccgccatgctgaggc 15994
>gb|AY139587.1| Triticum aestivum Lr21 gene, Lr21-R-S recombinant allele, partial sequence Length = 4735 Score = 48.1 bits (24), Expect = 0.026 Identities = 76/92 (82%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 370 gcggaccgtcgatcaagagaggatgatgcagagagaaaagagagtgaaaaccgatttgga 429 |||| |||| ||||| ||||||||||||| ||||| ||||| | || ||||| ||| Sbjct: 745 gcgggccgtagatcaggagaggatgatgctgagaggaaagaaatcaaactccgatgtggc 804 Query: 430 tgcgctggaca-gatggccgccatgctgaggc 460 || ||||||| |||||||||||||||||||| Sbjct: 805 cgcactggacaagatggccgccatgctgaggc 836
>gb|AY139586.1| Triticum aestivum Lr21 gene, Lr21-S allele, partial sequence Length = 4832 Score = 48.1 bits (24), Expect = 0.026 Identities = 76/92 (82%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 370 gcggaccgtcgatcaagagaggatgatgcagagagaaaagagagtgaaaaccgatttgga 429 |||| |||| ||||| ||||||||||||| ||||| ||||| | || ||||| ||| Sbjct: 737 gcgggccgtagatcaggagaggatgatgctgagaggaaagaaatcaaactccgatgtggc 796 Query: 430 tgcgctggaca-gatggccgccatgctgaggc 460 || ||||||| |||||||||||||||||||| Sbjct: 797 cgcactggacaagatggccgccatgctgaggc 828
>emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 5 Length = 209164 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 394 gatgcagagagaaaagagagtga 416 ||||||||||||||||||||||| Sbjct: 87823 gatgcagagagaaaagagagtga 87801
>emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 43 Length = 198226 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 394 gatgcagagagaaaagagagtga 416 ||||||||||||||||||||||| Sbjct: 56813 gatgcagagagaaaagagagtga 56791
>emb|Y14403.1|ATY14403 Arabidopsis thaliana SEB1, ISA1 genes Length = 13973 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 394 gatgcagagagaaaagagagtga 416 ||||||||||||||||||||||| Sbjct: 6680 gatgcagagagaaaagagagtga 6658
>emb|AL807784.11| Mouse DNA sequence from clone RP23-448C18 on chromosome X, complete sequence Length = 127196 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 395 atgcagagagaaaagagagtgaaaacc 421 ||||||||||||||||||| ||||||| Sbjct: 102970 atgcagagagaaaagagagggaaaacc 102944
>gb|AE010366.1| Methanopyrus kandleri AV19 section 65 of 157 of the complete genome Length = 11173 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 314 tccgacaagctcctggagctggagat 339 |||||||||||| ||||||||||||| Sbjct: 2130 tccgacaagctcgtggagctggagat 2155
>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence Length = 196946 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 323 ctcctggagctggagatccaca 344 |||||||||||||||||||||| Sbjct: 136911 ctcctggagctggagatccaca 136932
>gb|AC122129.9| Homo sapiens chromosome 17, clone RP1-253P7, complete sequence Length = 159868 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 396 tgcagagagaaaagagagtgaa 417 |||||||||||||||||||||| Sbjct: 19879 tgcagagagaaaagagagtgaa 19900
>emb|AL354000.7|HS253P07 Homo from PAC RP1-253P07 and PAC RP1-281I13 (complete covert by PAC RP1-253P07), complete sequence Length = 159876 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 396 tgcagagagaaaagagagtgaa 417 |||||||||||||||||||||| Sbjct: 139997 tgcagagagaaaagagagtgaa 139976
>gb|AC145927.3| Gallus gallus BAC clone CH261-29M22 from chromosome unknown, complete sequence Length = 227692 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 385 agagaggatgatgcagagagaa 406 |||||||||||||||||||||| Sbjct: 133219 agagaggatgatgcagagagaa 133240
>gb|AY442168.1| Homo sapiens ABO glycosyltransferase (ABO) gene, ABO*A2 allele, exon 7 and partial cds Length = 631 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 44 gcaccgcggccggctggtcgg 24
>gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, complete sequence Length = 185353 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 107 ggatctcagctgctaacccca 127 ||||||||||||||||||||| Sbjct: 119148 ggatctcagctgctaacccca 119128
>gb|AY373436.1| Homo sapiens ABO blood group protein (ABO) gene, ABO-O1 variant allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AY138476.1| Gorilla gorilla ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Gogo-B4 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY138475.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-B101-var2 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY138472.1| Gorilla gorilla ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Gogo-B2 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY138470.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-O1V_G542A allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AY138469.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-O01 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AY138468.1| Gorilla gorilla ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Gogo-B1 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY138467.1| Gorilla gorilla ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Gogo-B3 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY138466.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Ov7.2 allele, partial sequence Length = 2050 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1465 gcaccgcggccggctggtcgg 1445
>gb|AY138465.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-Ovar.tlse20 allele, partial sequence Length = 2041 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1456 gcaccgcggccggctggtcgg 1436
>gb|AY138464.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-B101-var1 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY590125.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-0101(G801T) allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AY512680.1| Homo sapiens truncated nonfunctional alpha 1-3-galactosyltransferase (ABO) gene, ABO-O variant allele, exons 6, 7 and partial cds Length = 2077 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1379 gcaccgcggccggctggtcgg 1359
>gb|AY512679.1| Homo sapiens alpha 1-3-galactosyltransferase (ABO) gene, ABO-weak B variant allele, exons 6, 7 and partial cds Length = 2090 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1392 gcaccgcggccggctggtcgg 1372
>gb|AF448200.1| Homo sapiens ABO glycosyltransferase gene, B101.tlse17 allele, exons 6 and 7 and partial cds Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AF448199.1| Homo sapiens ABO glycosyltransferase gene, A101.tlse16 allele, exons 6 and 7 and partial cds Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AF182756.1|ABOOV7S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-Ov7 allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF182754.1|SEG_ABOOV6S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-Ov6 allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF182752.1|ABOOV5S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-Ov5 allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF182750.1|ABOOV3S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-Ov3 allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF182746.1|ABOAV1S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-Av1 allele, exon 7 and partial cds Length = 690 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AC117242.3| Mus musculus BAC clone RP24-151P1 from chromosome 6, complete sequence Length = 209736 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gatgatgcagagagaaaagag 411 ||||||||||||||||||||| Sbjct: 125046 gatgatgcagagagaaaagag 125066
>gb|AY268591.1| Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO) gene, complete cds Length = 23759 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 21415 gcaccgcggccggctggtcgg 21395
>gb|AF440463.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-01v-B.tlse14 allele, partial sequence Length = 2050 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1465 gcaccgcggccggctggtcgg 1445
>gb|AF440462.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-01v-B.tlse13 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440461.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse10 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440460.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse08 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440459.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse07 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440458.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse06 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440457.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse52 allele, partial sequence Length = 2050 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1465 gcaccgcggccggctggtcgg 1445
>gb|AF440456.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse51 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440454.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse03 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440453.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse02 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440452.1| Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Ovar.tlse01 allele, partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF440451.1| Homo sapiens ABO glycosyltransferase (ABO) gene, nonfunctional ABO-O03.tlse15 allele, partial sequence Length = 2043 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|AY374123.1| Homo sapiens nonfunctional O-specific alpha N-acetylgalactosaminyltransferase (ABO) gene, ABO-O1 variant allele, exon 7 and partial sequence Length = 797 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AC100953.12| Mus musculus chromosome 5, clone RP23-73P16, complete sequence Length = 216490 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 107 ggatctcagctgctaacccca 127 ||||||||||||||||||||| Sbjct: 213239 ggatctcagctgctaacccca 213259
>emb|AM040939.1| Homo partial sapiens ABO gene for ABO alpha 1-3 galactosyltransferase, ABO*Bw10 allele, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|DQ139865.1| Homo sapiens B(A) alpha-1,3-galactosyltransferase mRNA, complete cds Length = 1065 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 478 gcaccgcggccggctggtcgg 458
>emb|AJ973608.1| Homo sapiens partial ABO gene for alpha-3-galactosylaminyltransferase, allele Aw10, exons 6-7 Length = 926 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 339 gcaccgcggccggctggtcgg 319
>emb|AL732364.9| Human DNA sequence from clone RP11-430N14 on chromosome 9 Contains the 3' end of the ABO gene for ABO blood group (transferase A alpha 1-3-N-acetylgalactosaminyltransferase; transferase B alpha 1-3-galactosyltransferase) pseudogene ABO-*O01 allele, the gene for a novel protein similar to odorant-binding protein 2B (OBP2B), the gene for odorant-binding protein 2B (OBP2B) and two CpG islands, complete sequence Length = 87903 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 84199 gcaccgcggccggctggtcgg 84219
>gb|BC069605.1| Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), mRNA (cDNA clone IMAGE:7262442), containing frame-shift errors Length = 937 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 350 gcaccgcggccggctggtcgg 330
>ref|NM_020469.2| Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), mRNA Length = 1580 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 503 gcaccgcggccggctggtcgg 483
>gb|AC113558.8| Homo sapiens chromosome 18, clone RP11-1130K19, complete sequence Length = 165957 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 388 gaggatgatgcagagagaaaa 408 ||||||||||||||||||||| Sbjct: 149032 gaggatgatgcagagagaaaa 149052
>gb|AF006674.1| Homo sapiens blood group O protein gene, variant allele, exon 7 Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AJ920329.1| Homo sapiens ABO gene for ABO glycosyltransferase, exons 1-7, ABO*A101 allele (incomplete sequence coverage) Length = 19674 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 19087 gcaccgcggccggctggtcgg 19067
>gb|DQ124679.1| Homo sapiens B(A) glycosyltransferase (ABO) gene, ABO-B(A) 640A>G allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|DQ124678.1| Homo sapiens B(A) glycosyltransferase (ABO) gene, ABO-B(A) 641T>C allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|BC069814.1| Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), mRNA (cDNA clone IMAGE:7262418), partial cds Length = 1060 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 478 gcaccgcggccggctggtcgg 458
>gb|BC069595.1| Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), mRNA (cDNA clone MGC:97185 IMAGE:7262430), complete cds Length = 1065 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 478 gcaccgcggccggctggtcgg 458
>emb|AJ536153.1|HSA536153 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Aw08 allele, exons 2-7 Length = 6507 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5920 gcaccgcggccggctggtcgg 5900
>emb|AJ536152.1|HSA536152 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O03 allele, exons 2-7 Length = 6507 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5920 gcaccgcggccggctggtcgg 5900
>emb|AJ536139.1|HSA536139 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*B(A)03 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536138.1|HSA536138 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Bw08 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536137.1|HSA536137 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Bw07 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536136.1|HSA536136 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*B101 allele, exons 2-7, ethnic origin Bosnian Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536135.1|HSA536135 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*B101 allele, exons 2-7, ethnic origin German Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536134.1|HSA536134 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Ax08 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536132.1|HSA536132 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Ael03 allele, exons 2-7 Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536131.1|HSA536131 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Ael01 allele, exons 2-7 Length = 6505 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536129.1|HSA536129 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Aw06 allele, exons 2-7, ethnic origin Turkish Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536128.1|HSA536128 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Aw06 allele, exons 2-7, ethnic origin Bosnian Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536127.1|HSA536127 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Aw06 allele, exons 2-7, ethnic origin German Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536126.1|HSA536126 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*Aw04 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ536122.1|HSA536122 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*A101 allele, exons 2-7 Length = 6504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5917 gcaccgcggccggctggtcgg 5897
>emb|AJ426064.1|HSA426064 Homo sapiens partial ABO gene for B(A) glycosyltransferase, allele ABO*B(A)03, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AJ276689.1|HSA276689 Homo sapiens partial ABO transferase gene for B transferase, exon 7, B1037 variant Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AJ276687.1|HSA276687 Homo sapiens partial ABO transferase gene for A transferase, exon 7, A502 variant Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AL669825.10| Mouse DNA sequence from clone RP23-327K3 on chromosome 11 Contains a cyclic AMP phosphoprotein (Arpp19) pseudogene, a heat shock protein (Hsp) pseudogene and a ribosomal protein S6 (Rps6) pseudogene, complete sequence Length = 199649 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 319 caagctcctggagctggagat 339 ||||||||||||||||||||| Sbjct: 108275 caagctcctggagctggagat 108255
>gb|AF408431.1| Homo sapiens isolate VIGMI ABO glycosyltransferase (ABO) gene, ABO-cisABt01 allele, exons 6 and 7 and partial cds Length = 2045 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1458 gcaccgcggccggctggtcgg 1438
>gb|DQ407740.1| Homo sapiens ABO blood group transferase B (ABO) gene, ABO-B(A) allele, exons 6, 7 and partial cds Length = 2075 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1390 gcaccgcggccggctggtcgg 1370
>gb|AC108077.3| Homo sapiens BAC clone RP11-739G21 from 4, complete sequence Length = 106983 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 392 atgatgcagagagaaaagaga 412 ||||||||||||||||||||| Sbjct: 78667 atgatgcagagagaaaagaga 78687
>gb|AF324020.1|AF324020 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-7 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324019.1|AF324019 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-6 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324018.1|AF324018 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-2 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324017.1|AF324017 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-8 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324016.1|AF324016 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-4 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324015.1|AF324015 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-5 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324014.1|AF324014 Homo sapiens alpha-3-galactosyltransferase (ABO) gene, ABO-Bw-3 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324013.1|AF324013 Homo sapiens alpha-3-galactosylaminyltransferase (ABO) gene, ABO-Ax-6 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324012.1|AF324012 Homo sapiens alpha-3-galactosylaminyltransferase (ABO) gene, ABO-Aw-5 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324011.1|AF324011 Homo sapiens alpha-3-galactosylaminyltransferase (ABO) gene, ABO-Aw-4 allele, exon 7 and partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF324007.1|AF324007 Homo sapiens alpha-3-galactosylaminyltransferase (ABO) gene, ABO-Ax-5 allele, exons 6 and 7 and partial cds Length = 1942 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>gb|AF324006.1|AF324006 Homo sapiens alpha-3-galactosylaminyltransferase (ABO) gene, ABO-Ax-4 allele, exons 6 and 7 and partial cds Length = 1942 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>gb|AF280465.2|AF280465 Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Otlse12 allele, exons 6 and 7, and partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF280464.2|AF280464 Homo sapiens ABO glycosyltransferase (ABO) pseudogene, ABO-Otlse11 allele, exons 6 and 7, and partial sequence Length = 2042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1457 gcaccgcggccggctggtcgg 1437
>gb|AF268887.1|AF268886S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse10 allele, exon 7 Length = 1203 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 596 gcaccgcggccggctggtcgg 576
>gb|AF268884.1|AF268883S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse08 allele, exon 7 Length = 1209 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 600 gcaccgcggccggctggtcgg 580
>gb|AF268882.1|AF268881S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse07 allele, exon 7 Length = 1205 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 598 gcaccgcggccggctggtcgg 578
>gb|AF268880.1|AF268879S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse06 allele, exon 7 Length = 1205 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 598 gcaccgcggccggctggtcgg 578
>gb|AF268878.1|AF268877S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse05 allele, exon 7 Length = 1201 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 594 gcaccgcggccggctggtcgg 574
>gb|AF268874.1|AF268873S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse03 allele, exon 7 Length = 1204 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 597 gcaccgcggccggctggtcgg 577
>gb|AF267502.1|AF267501S2 Homo sapiens ABO glycosyltransferase pseudogene, Otlse02 allele, exon 7 Length = 800 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 193 gcaccgcggccggctggtcgg 173
>gb|AF267500.1|AF267499S2 Homo sapiensABO glycosyltransferase pseudogene, Otlse01 allele, exon 7 Length = 801 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 194 gcaccgcggccggctggtcgg 174
>emb|BX842659.5| Human DNA sequence from clone RP11-654H17 on chromosome 9, complete sequence Length = 9404 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5700 gcaccgcggccggctggtcgg 5720
>gb|S53071.1| A glycosyltransferase [Pan troglodytes=chimpanzees, Genomic, 405 nt] Length = 405 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 25 gcaccgcggccggctggtcgg 5
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 55 acggcggcggacggcaacacctcgtcgac 83 |||||||| ||||||| |||||||||||| Sbjct: 2830289 acggcggccgacggcaccacctcgtcgac 2830261
>gb|AC009453.13|AC009453 Homo sapiens chromosome 18, clone RP11-59F14, complete sequence Length = 168947 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 388 gaggatgatgcagagagaaaa 408 ||||||||||||||||||||| Sbjct: 81484 gaggatgatgcagagagaaaa 81464
>gb|AF062487.2|AF062487 Homo sapiens glycosyltransferase (ABO) gene, ABO-B796C allele, exon 7 and partial cds Length = 455 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 49 gcaccgcggccggctggtcgg 29
>gb|AC011438.3|AC011438 Genomic sequence for Arabidopsis thaliana BAC T23G18 from chromosome I, complete sequence Length = 91470 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 383 caagagaggatgatgcagagagaaa 407 |||||||||||| |||||||||||| Sbjct: 88924 caagagaggatgttgcagagagaaa 88900
>gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis thaliana BAC T27G7 from chromosome I, complete sequence Length = 89479 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 383 caagagaggatgatgcagagagaaa 407 |||||||||||| |||||||||||| Sbjct: 11840 caagagaggatgttgcagagagaaa 11816
>dbj|D82843.2| Homo sapiens ABO gene for glycosyltransferase, partial cds Length = 1878 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>dbj|D82842.2| Homo sapiens ABO gene for glycosyltransferase, partial cds Length = 1878 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>dbj|D82841.2| Homo sapiens ABO gene for glycosyltransferase, partial cds Length = 1878 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>emb|AJ536151.1|HSA536151 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O40 allele, exons 2-7 Length = 6520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5933 gcaccgcggccggctggtcgg 5913
>emb|AJ536150.1|HSA536150 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O39 allele, exons 2-7 Length = 6522 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5935 gcaccgcggccggctggtcgg 5915
>emb|AJ536149.1|HSA536149 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O12 allele, exons 2-7 Length = 6520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5933 gcaccgcggccggctggtcgg 5913
>emb|AJ536148.1|HSA536148 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O06 allele, exons 2-7 Length = 6520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5933 gcaccgcggccggctggtcgg 5913
>emb|AJ536147.1|HSA536147 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O02 allele, exons 2-7, ethnic origin Turkish Length = 6520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5933 gcaccgcggccggctggtcgg 5913
>emb|AJ536146.1|HSA536146 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O02 allele, exons 2-7, ethnic origin German Length = 6520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5933 gcaccgcggccggctggtcgg 5913
>emb|AJ536144.1|HSA536144 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O26 allele, exons 2-7 Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5916 gcaccgcggccggctggtcgg 5896
>emb|AJ536143.1|HSA536143 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O011 allele, exons 2-7 Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5916 gcaccgcggccggctggtcgg 5896
>emb|AJ536142.1|HSA536142 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O01 allele, exons 2-7, ethnic origin Bosnian Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5916 gcaccgcggccggctggtcgg 5896
>emb|AJ536141.1|HSA536141 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O01 allele, exons 2-7, ethnic origin African Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5916 gcaccgcggccggctggtcgg 5896
>emb|AJ536140.1|HSA536140 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O01 allele, exons 2-7, ethnic origin German Length = 6503 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5916 gcaccgcggccggctggtcgg 5896
>emb|AJ536133.1|HSA536133 Homo sapiens partial ABO gene for ABO glycosyltransferase, ABO*O41 allele, exons 2-7 Length = 6505 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5918 gcaccgcggccggctggtcgg 5898
>gb|AY720852.1|AY720851S2 Homo sapiens non-functional ABO glycosyltransferase (ABO) gene, ABO-O306 allele, exon 7 and partial cds Length = 745 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AY720850.1|AY720849S2 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-O305 allele, exon 7 and partial cds Length = 745 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AY720848.1|AY720847S2 Homo sapiens non-functional ABO glycosyltransferase (ABO) gene, ABO-O103.1 allele, exon 7 and partial cds Length = 745 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AY720846.1|AY720845S2 Homo sapiens non-functional ABO glycosyltransferase (ABO) gene, ABO-O217 allele, exon 7 and partial cds Length = 745 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180268.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#014 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180267.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#013 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180266.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#012 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180265.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#011 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180264.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#010 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB180259.1| Homo sapiens ABO gene for ABO glycosyltransferase, exon 7, partial cds, isolate:ORC#05 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AJ276685.1|HSA276685 Homo sapiens partial ABO transferase gene, exon 7, O1v-6 variant Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF100984.1|MFABOB3 Macaca fascicularis ABO histo-blood group B transferase (ABO) gene, exon 7 and partial cds Length = 744 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 188 gcaccgcggccggctggtcgg 168
>gb|AF100965.1|GGABOB5 Gorilla gorilla ABO histo-blood group B transferase (ABO) gene, exon 7 and partial cds Length = 742 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 186 gcaccgcggccggctggtcgg 166
>gb|AF094693.1|MAMUABO2 Macaca mulatta ABO glycosyltransferase (Mamu_ABO) gene, Mamu_ABO-O allele, exon 7 and partial cds Length = 700 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 113 gcaccgcggccggctggtcgg 93
>gb|AF071830.1|AF071830 Macaca mulatta histo-blood group ABO glycosyltransferase (RH*ABO) mRNA, RH*ABO*O1 allele, partial cds Length = 868 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 313 gcaccgcggccggctggtcgg 293
>gb|AF170891.1|AF170891 Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-O1v allele exon 7 Length = 805 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 154 gcaccgcggccggctggtcgg 134
>gb|AF170889.1|AF170889 Homo sapiens Ael glycosyltransferase (ABO) gene, ABO-Ael allele, exon 7 and partial cds Length = 852 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 154 gcaccgcggccggctggtcgg 134
>gb|AF134434.1|HABOBA1G2 Homo sapiens B(A)-specific alpha 1->3 galactosyltransferase (ABO) gene, ABO-*B(A)01 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134432.1|HABOB31G2 Homo sapiens B3-specific alpha 1->3 galactosyltransferase (ABO) gene, ABO-*B301 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134430.1|HABOB1G2 Homo sapiens B-specific alpha 1->3 galactosyltransferase (ABO) gene, ABO-*B101 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134424.1|HABOA31G2 Homo sapiens A3-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) gene, ABO-*A301 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134414.1|AF134414 Homo sapiens B-specific alpha 1->3 galactosyltransferase (ABO) mRNA, ABO-*B101 allele, complete cds Length = 1065 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 478 gcaccgcggccggctggtcgg 458
>gb|AF134440.1|HABOO3G2 Homo sapiens O-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) gene, ABO-*O03 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134436.1|HABOO1G2 Homo sapiens O-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) pseudogene, ABO-*O01 allele, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134438.1|HABOO2G2 Homo sapiens O-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) pseudogene, ABO-*O02 allele, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134426.1|HABOAX1G2 Homo sapiens Ax-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) gene, ABO-*Ax01 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134412.1|AF134412 Homo sapiens A1-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) mRNA, ABO-*A101 allele, complete cds Length = 1065 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 478 gcaccgcggccggctggtcgg 458
>gb|AF134418.1|HABOA11G2 Homo sapiens A1-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) gene, ABO-*A101 allele, exon 7 and partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>gb|AF134416.1|AF134416 Homo sapiens O-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) pseudogene, ABO-*O02 allele, mRNA sequence Length = 1064 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 477 gcaccgcggccggctggtcgg 457
>gb|AF134415.1|AF134415 Homo sapiens O-specific alpha 1->3 N-acetylgalactosaminyltransferase (ABO) pseudogene, ABO-*O01 allele, mRNA sequence Length = 1064 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 477 gcaccgcggccggctggtcgg 457
>gb|AF016625.1|AF016625 Homo sapiens alpha-3-galactosyltransferase ABO gene (Ax (A1-O1v) allele), partial cds Length = 1942 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>gb|AF016624.1|AF016624 Homo sapiens alpha-3-galactosyltransferase ABO gene (Ax (B-O1v) allele), partial cds Length = 1942 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>gb|AF016623.1|AF016623 Homo sapiens truncated alpha-3-galactosyltransferase ABO gene (O1v allele), partial cds Length = 1941 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1290 gcaccgcggccggctggtcgg 1270
>gb|AF016622.1|AF016622 Homo sapiens alpha-3-galactosyltransferase ABO gene (B allele), partial cds Length = 1942 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1291 gcaccgcggccggctggtcgg 1271
>emb|AM231715.1| Homo sapiens partial ABO gene for truncated ABO glycosyltransferase, ABO*O.01.11.1 allele Length = 824 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 238 gcaccgcggccggctggtcgg 218
>gb|DQ323502.1| Homo sapiens ABO blood group transferase A (ABO) gene, ABO-Ax new allele, exons 6, 7 and partial cds Length = 2075 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1390 gcaccgcggccggctggtcgg 1370
>gb|DQ323501.1| Homo sapiens ABO blood group transferase A (ABO) gene, ABO-A allele, exons 6, 7 and partial cds Length = 2075 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1390 gcaccgcggccggctggtcgg 1370
>gb|DQ323500.1| Homo sapiens ABO blood group transferase B (ABO) gene, ABO-Bm allele, exons 6, 7 and partial cds Length = 2075 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1390 gcaccgcggccggctggtcgg 1370
>gb|AF052086.1|AF052086 Macaca mulatta histo-blood group protein ABO gene (Rh*B103 allele), partial cds Length = 571 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 46 gcaccgcggccggctggtcgg 26
>gb|AF052085.1|AF052085 Macaca mulatta histo-blood group protein ABO gene (Rh*B102 allele), partial cds Length = 571 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 46 gcaccgcggccggctggtcgg 26
>gb|AF052084.1|AF052084 Macaca mulatta histo-blood group protein ABO gene (Rh*B101 allele), partial cds Length = 571 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 46 gcaccgcggccggctggtcgg 26
>gb|AF052083.1|AF052083 Macaca fascicularis histo-blood group protein ABO gene (Cy*B102 allele), partial cds Length = 571 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 46 gcaccgcggccggctggtcgg 26
>gb|AC138118.4| Mus musculus BAC clone RP24-219A21 from 8, complete sequence Length = 168752 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 agaaaagagagtgaaaaccga 423 ||||||||||||||||||||| Sbjct: 15697 agaaaagagagtgaaaaccga 15677
>gb|AF006673.1|AF006673 Homo sapiens histo-blood group protein (ABO) gene, partial cds Length = 755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>emb|AM158904.1| Homo sapiens partial ABO gene for ABO glycosyltransferase,ABO*O.02 allele, exons 6-7 Length = 824 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 238 gcaccgcggccggctggtcgg 218
>gb|AC000397.1|AC000397 Genomic sequence from Human 9q34, complete sequence Length = 38448 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 195 gcaccgcggccggctggtcgg 215
>gb|AY805749.1| Homo sapiens ABO glycosyltransferase (ABO) gene, ABO-O1bantu allele, exons 2 through 7 and partial cds Length = 6552 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 5915 gcaccgcggccggctggtcgg 5895
>emb|AJ426066.1|HSA426066 Homo sapiens partial ABO pseudogene for ABO glycosyltransferase, allele ABO*Ovariant, exon 7 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB048862.1| Gorilla gorilla gene for ABO blood group glycosyltransferase, partial cds Length = 2099 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1707 gcaccgcggccggctggtcgg 1687
>dbj|AB048861.1| Gorilla gorilla gene for ABO blood group glycosyltransferase, partial cds Length = 2219 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1827 gcaccgcggccggctggtcgg 1807
>dbj|AB041529.1| Macaca fuscata ABO gene, partial cds, isolate:#015 Length = 1678 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1267 gcaccgcggccggctggtcgg 1247
>dbj|AB041528.1| Macaca fuscata ABO gene, partial cds, isolate:#014 Length = 1733 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1322 gcaccgcggccggctggtcgg 1302
>dbj|AB041527.1| Macaca fuscata ABO gene, partial cds, isolate:#013 Length = 487 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 76 gcaccgcggccggctggtcgg 56
>dbj|AB041526.1| Macaca fuscata ABO gene, partial cds, isolate:#012 Length = 487 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 76 gcaccgcggccggctggtcgg 56
>dbj|AB041525.1| Macaca fuscata ABO gene, partial cds, isolate:#011 Length = 487 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 76 gcaccgcggccggctggtcgg 56
>dbj|D82838.1| Homo sapiens DNA for glycosyltransferase, partial cds Length = 480 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 58 gcaccgcggccggctggtcgg 38
>dbj|D82837.1| Homo sapiens DNA for glycosyltransferase, partial cds Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|D82833.1| Homo sapiens DNA for glycosyltransferase, exon 7, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|D82830.1| Homo sapiens DNA for glycosyltransferase, exon 7, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|D82827.1| Homo sapiens DNA for glycosyltransferase, exon 7, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|D82822.1| Homo sapiens DNA for glycosyltransferase, exon 7, partial sequence Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB052651.1| Homo sapiens gene for ABO glycosyltransferase, partial cds, allele:R103.2 Length = 1130 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 543 gcaccgcggccggctggtcgg 523
>dbj|AB052650.1| Homo sapiens gene for ABO glycosyltransferase, partial cds, allele:R102 Length = 1743 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 1156 gcaccgcggccggctggtcgg 1136
>dbj|AB052643.1| Homo sapiens gene for ABO glycosyltransferase, exon 7 and partial cds, allele:A113 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>dbj|AB052642.1| Homo sapiens gene for ABO glycosyltransferase, exon 7 and partial cds, allele:O302 Length = 691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaccgcggccggctggtcgg 156 ||||||||||||||||||||| Sbjct: 104 gcaccgcggccggctggtcgg 84
>ref|NM_213896.1| Sus scrofa N-acylamino acid aminohydrolase (Aminoacylase 1) (ACY1), mRNA Length = 1341 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 tggtgaccgtgctgacctgg 250 |||||||||||||||||||| Sbjct: 233 tggtgaccgtgctgacctgg 252
>gb|BC073012.1| Xenopus laevis MGC82597 protein, mRNA (cDNA clone MGC:82597 IMAGE:4970985), complete cds Length = 2109 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 440 agatggccgccatgctgagg 459 |||||||||||||||||||| Sbjct: 1559 agatggccgccatgctgagg 1540
>gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q24.13, complete sequence Length = 199966 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 391 gatgatgcagagagaaaagagagtgaaa 418 ||||| |||||||||||||||| ||||| Sbjct: 198161 gatgaggcagagagaaaagagattgaaa 198134
>gb|AF216672.5| Homo sapiens chromosome 8 clone RP11-293H22 map q24.13, complete sequence Length = 174030 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 391 gatgatgcagagagaaaagagagtgaaa 418 ||||| |||||||||||||||| ||||| Sbjct: 47746 gatgaggcagagagaaaagagattgaaa 47719
>gb|AC129212.4| Mus musculus BAC clone RP24-373G21 from chromosome 15, complete sequence Length = 174846 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 401 agagaaaagagagtgaaaac 420 |||||||||||||||||||| Sbjct: 50192 agagaaaagagagtgaaaac 50173
>emb|Z72512.1|CER07B5 Caenorhabditis elegans Cosmid R07B5, complete sequence Length = 27254 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 gagagaaaagagagtgaaaa 419 |||||||||||||||||||| Sbjct: 26220 gagagaaaagagagtgaaaa 26239
>gb|AC122059.1| Mus musculus BAC clone RP24-468J3 from 1, complete sequence Length = 162681 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 ctcctggagctggagatcca 342 |||||||||||||||||||| Sbjct: 99357 ctcctggagctggagatcca 99338
>emb|AL034548.25|HS1103G7 Human DNA sequence from clone RP5-1103G7 on chromosome 20p12.2-13 Contains the C20orf96 gene, the C20orf99 gene, a novel gene, the SOX12 gene for SRY (sex-determining region Y)-box 12, the C20orf98 gene for chromosome 20 open reading frame 98 (similar to mouse VMP, FLJ23329), the C20orf97 gene for a novel kinase domain-containing protein similar to phosphoprotein C8FW and rat NIPK, the gene for a novel defensin protein (DEFB32, UNQ827, KFLL827) and five CpG islands, complete sequence Length = 153170 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 agagagaaaagagagtgaaa 418 |||||||||||||||||||| Sbjct: 26653 agagagaaaagagagtgaaa 26634
>emb|BX035803.1|CNS08ZSF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 547 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 333 catcccggagctgaagaaga 314
>emb|BX033123.1|CNS08XPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 466 catcccggagctgaagaaga 447
>emb|BX033122.1|CNS08XPY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 588 catcccggagctgaagaaga 607
>emb|BX028347.1|CNS08U1B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 315 catcccggagctgaagaaga 296
>emb|BX024286.1|CNS08QWI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 310 catcccggagctgaagaaga 291
>emb|BX021517.1|CNS08ORL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31DF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 327 catcccggagctgaagaaga 308
>emb|BX019274.1|CNS08N1A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 551 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 282 catcccggagctgaagaaga 263
>emb|BX017947.1|CNS08M0F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 299 catcccggagctgaagaaga 280
>emb|BX016161.1|CNS08KMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 561 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 302 catcccggagctgaagaaga 283
>emb|BX014789.1|CNS08JKP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 503 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 307 catcccggagctgaagaaga 288
>emb|BX012982.1|CNS08I6I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 450 catcccggagctgaagaaga 431
>emb|BX012138.1|CNS08HJ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19BD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 303 catcccggagctgaagaaga 284
>emb|BX007495.1|CNS08DY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 320 catcccggagctgaagaaga 301
>emb|X68564.1|SCAC1 S.scrofa mRNA for aminoacylase I Length = 1304 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 tggtgaccgtgctgacctgg 250 |||||||||||||||||||| Sbjct: 218 tggtgaccgtgctgacctgg 237
>gb|AC094963.9| Rattus norvegicus X BAC CH230-6L20 (Children's Hospital Oakland Research Institute) complete sequence Length = 213440 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 agagagaaaagagagtgaaa 418 |||||||||||||||||||| Sbjct: 86570 agagagaaaagagagtgaaa 86551
>gb|AC154487.2| Mus musculus BAC clone RP24-119I4 from chromosome 14, complete sequence Length = 199036 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 384 aagagaggatgatgcagaga 403 |||||||||||||||||||| Sbjct: 142152 aagagaggatgatgcagaga 142133
>emb|CR859112.1| Pongo pygmaeus mRNA; cDNA DKFZp459E0928 (from clone DKFZp459E0928) Length = 3126 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 386 gagaggatgatgcagagaga 405 |||||||||||||||||||| Sbjct: 27 gagaggatgatgcagagaga 46
>emb|CR857109.1| Pongo pygmaeus mRNA; cDNA DKFZp469K1922 (from clone DKFZp469K1922) Length = 3239 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 386 gagaggatgatgcagagaga 405 |||||||||||||||||||| Sbjct: 142 gagaggatgatgcagagaga 161
>gb|AE005824.1| Caulobacter crescentus CB15 section 150 of 359 of the complete genome Length = 10405 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 146 cggctggtcggacggtcgtcgtcg 169 |||||||||||||||||| ||||| Sbjct: 1109 cggctggtcggacggtcgacgtcg 1086
>gb|AC025464.5| Homo sapiens chromosome 5 clone CTD-2260C5, complete sequence Length = 115265 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 392 atgatgcagagagaaaagagagtgaaaa 419 ||||||||||| ||||||||| |||||| Sbjct: 36209 atgatgcagagtgaaaagagattgaaaa 36236
>gb|AC010608.7| Homo sapiens chromosome 5 clone CTB-3M24, complete sequence Length = 210408 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 392 atgatgcagagagaaaagagagtgaaaa 419 ||||||||||| ||||||||| |||||| Sbjct: 142575 atgatgcagagtgaaaagagattgaaaa 142548
>emb|BX664603.6| Zebrafish DNA sequence from clone CH211-127L8 in linkage group 7, complete sequence Length = 190963 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 401 agagaaaagagagtgaaaac 420 |||||||||||||||||||| Sbjct: 166238 agagaaaagagagtgaaaac 166257
>gb|AC084551.1|CBRG33E23 Caenorhabditis briggsae cosmid G33E23, complete sequence Length = 34948 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 gagaaaagagagtgaaaacc 421 |||||||||||||||||||| Sbjct: 15891 gagaaaagagagtgaaaacc 15910
>gb|AE004877.1| Pseudomonas aeruginosa PAO1, section 438 of 529 of the complete genome Length = 10479 Score = 40.1 bits (20), Expect = 6.4 Identities = 29/32 (90%) Strand = Plus / Minus Query: 234 tgaccgtgctgacctggttcttgtcgcccatc 265 |||||||| ||||||| |||||||||||||| Sbjct: 4550 tgaccgtggcgacctgggtcttgtcgcccatc 4519
>gb|AC011134.15| Homo sapiens chromosome 8, clone RP11-1A23, complete sequence Length = 156756 Score = 40.1 bits (20), Expect = 6.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 391 gatgatgcagagagaaaagagagtgaaa 418 ||||| |||||||||||||||| ||||| Sbjct: 29849 gatgaggcagagagaaaagagattgaaa 29876
>gb|AC099744.3| Papio anubis clone RP41-65E12, complete sequence Length = 173295 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 gagagaaaagagagtgaaaa 419 |||||||||||||||||||| Sbjct: 134743 gagagaaaagagagtgaaaa 134762
>gb|AC159186.4| Mus musculus BAC clone RP24-281N15 from chromosome 12, complete sequence Length = 180125 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 caaaagccgccggcgagcctgaca 49 |||||||||||||| ||||||||| Sbjct: 73391 caaaagccgccggctagcctgaca 73368
>ref|XM_321163.2| Anopheles gambiae str. PEST ENSANGP00000020184 (ENSANGG00000017695), partial mRNA Length = 942 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 catcccggagctgaagaaga 365 |||||||||||||||||||| Sbjct: 885 catcccggagctgaagaaga 904
>gb|AC099736.10| Mus musculus chromosome 15, clone RP23-228F5, complete sequence Length = 186137 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 401 agagaaaagagagtgaaaac 420 |||||||||||||||||||| Sbjct: 89793 agagaaaagagagtgaaaac 89812
>dbj|AB017196.1| Sus scrofa ACY-1 and rpL29/HIP genes, complete cds Length = 9361 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 tggtgaccgtgctgacctgg 250 |||||||||||||||||||| Sbjct: 2884 tggtgaccgtgctgacctgg 2903
>gb|AY609826.1| Sus scrofa clone Clu_33100.scr.msk.p1.Contig2, mRNA sequence Length = 1406 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 tggtgaccgtgctgacctgg 250 |||||||||||||||||||| Sbjct: 267 tggtgaccgtgctgacctgg 286
>emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in linkage group 3, complete sequence Length = 170964 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 395 atgcagagagaaaagagagt 414 |||||||||||||||||||| Sbjct: 168631 atgcagagagaaaagagagt 168650
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 229 catggtgaccgtgctgacct 248 |||||||||||||||||||| Sbjct: 4508078 catggtgaccgtgctgacct 4508097
>gb|U62866.1|VCU62866 Volvox carteri f. nagariensis GDP dissociation inhibitor protein GDIV1p (gdiV1) mRNA, complete cds Length = 2529 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 gacaagaagaaggtcttgca 211 |||||||||||||||||||| Sbjct: 152 gacaagaagaaggtcttgca 171
>dbj|D13514.1|PIGACY1 Porcine mRNA for N-acylamino acid aminohydrolase (Aminoacylase 1), complete cds Length = 1341 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 tggtgaccgtgctgacctgg 250 |||||||||||||||||||| Sbjct: 233 tggtgaccgtgctgacctgg 252 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,085,523 Number of Sequences: 3902068 Number of extensions: 4085523 Number of successful extensions: 94555 Number of sequences better than 10.0: 242 Number of HSP's better than 10.0 without gapping: 242 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94163 Number of HSP's gapped (non-prelim): 388 length of query: 476 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 454 effective length of database: 17,147,199,772 effective search space: 7784828696488 effective search space used: 7784828696488 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
