>gb|AY483155.1| Hordeum vulgare putative cellulose synthase catalytic subunit
          (CesA6) mRNA, complete cds
          Length = 3745

 Score =  151 bits (76), Expect = 8e-34
 Identities = 76/76 (100%)
 Strand = Plus / Plus

                                                                      
Query: 12 gagctccgagagtagttcttctccctctcgagagccagctcgcgggggatctgggaatgg 71
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23 gagctccgagagtagttcttctccctctcgagagccagctcgcgggggatctgggaatgg 82

                          
Query: 72 tgcccatctccgccga 87
          ||||||||||||||||
Sbjct: 83 tgcccatctccgccga 98



 Score =  119 bits (60), Expect = 3e-24
 Identities = 63/64 (98%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgccggatctagagcggccttcccgtgcccctctcgactgaagcgagcgagagtccgccg 166
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 118 cgccggatctagagcggccttcccgtgcccctctcgactgaagcgagcgagaggccgccg 177

               
Query: 167 ccgg 170
           ||||
Sbjct: 178 ccgg 181

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 38.2 bits (19), Expect = 8.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 37     tctcgagagccagctcgcggggg 59
              ||||||| |||||||||||||||
Sbjct: 541589 tctcgagcgccagctcgcggggg 541567


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 731,283
Number of Sequences: 3902068
Number of extensions: 731283
Number of successful extensions: 47872
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47858
Number of HSP's gapped (non-prelim): 14
length of query: 170
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 148
effective length of database: 17,147,199,772
effective search space: 2537785566256
effective search space used: 2537785566256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)