>emb|BX942833.8| Zebrafish DNA sequence from clone DKEY-177F17 in linkage group 20
Contains part of the gene for a novel protein similar to
rat kinase D-interacting substance of 220 kDa
(RGD:619949), complete sequence
Length = 42729
Score = 40.1 bits (20), Expect = 5.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 259 atccagttagagctttctac 278
||||||||||||||||||||
Sbjct: 2463 atccagttagagctttctac 2444
>gb|AC005771.1|AC005771 Homo sapiens chromosome 17, clone hRPK.1058_G_23, complete sequence
Length = 190434
Score = 40.1 bits (20), Expect = 5.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 187 gagatattcctgtttgtcag 206
||||||||||||||||||||
Sbjct: 90498 gagatattcctgtttgtcag 90479
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,477,815
Number of Sequences: 3902068
Number of extensions: 3477815
Number of successful extensions: 62613
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62510
Number of HSP's gapped (non-prelim): 103
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)