Clone Name | bastl25b08 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_450983.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3192 Score = 260 bits (131), Expect = 4e-66 Identities = 228/259 (88%), Gaps = 1/259 (0%) Strand = Plus / Plus Query: 243 tggcagcccttcgccacggagaacctggccttcgaggcttactacaaggggcagcaaatt 302 ||||||||||||||||| ||||||| |||||||||| |||||||||| ||||||||| Sbjct: 311 tggcagcccttcgccaccgagaacccagccttcgaggactactacaaggcacagcaaatt 370 Query: 303 gttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattgccagccgct 362 |||| |||| ||||||||| | |||||||| |||||||||||| || |||||||| || Sbjct: 371 attccggagggagagtgggacgacttcatgaacatgctccggaaaccgctgccagccact 430 Query: 363 tttaggattaatgcgagctgtcagttttttaaagacatttgttcacaattagaaaatgac 422 || |||||||||||||||||||| |||| | |||| ||||| ||||| |||||||||||| Sbjct: 431 ttcaggattaatgcgagctgtcaattttatcaagatatttgctcacagttagaaaatgac 490 Query: 423 ttcaggaagtcgttagagactgaggtcagtgatgaccatgaa-aagaggctattcggcct 481 ||||||||||| || || |||||||| |||||||| |||||| |||| |||||||||||| Sbjct: 491 ttcaggaagtcattggaaactgaggttagtgatgagcatgaagaagatgctattcggcct 550 Query: 482 ttgccttggtaccctggca 500 ||||||||||||||||||| Sbjct: 551 ttgccttggtaccctggca 569 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 117 atggggggcggcaggaagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgag 176 ||||| ||||||||||||||||||||| ||||||| || ||||||||||||| ||| ||| Sbjct: 158 atgggaggcggcaggaagcgcgggcgcacgcagcgccgccacttcaagcaggggcgggag 217 Query: 177 aacgtctggaaggacaaccc 196 |||||||||||| ||||||| Sbjct: 218 aacgtctggaagcacaaccc 237
>dbj|AK073815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065D05, full insert sequence Length = 3191 Score = 260 bits (131), Expect = 4e-66 Identities = 228/259 (88%), Gaps = 1/259 (0%) Strand = Plus / Plus Query: 243 tggcagcccttcgccacggagaacctggccttcgaggcttactacaaggggcagcaaatt 302 ||||||||||||||||| ||||||| |||||||||| |||||||||| ||||||||| Sbjct: 311 tggcagcccttcgccaccgagaacccagccttcgaggactactacaaggcacagcaaatt 370 Query: 303 gttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattgccagccgct 362 |||| |||| ||||||||| | |||||||| |||||||||||| || |||||||| || Sbjct: 371 attccggagggagagtgggacgacttcatgaacatgctccggaaaccgctgccagccact 430 Query: 363 tttaggattaatgcgagctgtcagttttttaaagacatttgttcacaattagaaaatgac 422 || |||||||||||||||||||| |||| | |||| ||||| ||||| |||||||||||| Sbjct: 431 ttcaggattaatgcgagctgtcaattttatcaagatatttgctcacagttagaaaatgac 490 Query: 423 ttcaggaagtcgttagagactgaggtcagtgatgaccatgaa-aagaggctattcggcct 481 ||||||||||| || || |||||||| |||||||| |||||| |||| |||||||||||| Sbjct: 491 ttcaggaagtcattggaaactgaggttagtgatgagcatgaagaagatgctattcggcct 550 Query: 482 ttgccttggtaccctggca 500 ||||||||||||||||||| Sbjct: 551 ttgccttggtaccctggca 569 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 117 atggggggcggcaggaagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgag 176 ||||| ||||||||||||||||||||| ||||||| || ||||||||||||| ||| ||| Sbjct: 158 atgggaggcggcaggaagcgcgggcgcacgcagcgccgccacttcaagcaggggcgggag 217 Query: 177 aacgtctggaaggacaaccc 196 |||||||||||| ||||||| Sbjct: 218 aacgtctggaagcacaaccc 237
>gb|AY105538.1| Zea mays PCO081607 mRNA sequence Length = 2791 Score = 244 bits (123), Expect = 2e-61 Identities = 202/227 (88%), Gaps = 1/227 (0%) Strand = Plus / Plus Query: 270 gccttcgaggcttactacaaggggcagcaaattgttcctgaggaagagtgggatgccttc 329 |||||||||| |||||||||| ||||||||||||| ||||||||||||||||| |||| Sbjct: 11 gccttcgaggagtactacaaggagcagcaaattgtttctgaggaagagtgggatagcttc 70 Query: 330 atgagcatgctccggaagccattgccagccgcttttaggattaatgcgagctgtcagttt 389 ||||||||||||||||||||||| || ||| ||||||||||||||||||||||||| ||| Sbjct: 71 atgagcatgctccggaagccattacctgccacttttaggattaatgcgagctgtcaattt 130 Query: 390 tttaaagacatttgttcacaattagaaaatgacttcaggaagtcgttagagactgaggtc 449 ||| |||| || || || ||||| ||||| ||||||||||| || |||||||||||||| Sbjct: 131 tttcaagatatctgctcgcaattggaaaacgacttcaggaaatcattagagactgaggtg 190 Query: 450 agtgatgaccatgaa-aagaggctattcggcctttgccttggtaccc 495 | ||||| |||||| |||| |||||||||||||||||||||||||| Sbjct: 191 accgatgatcatgaagaagatgctattcggcctttgccttggtaccc 237
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 117 atggggggcggcaggaagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgag 176 ||||| ||||||||||||||||||||| ||||||| || ||||||||||||| ||| ||| Sbjct: 17958726 atgggaggcggcaggaagcgcgggcgcacgcagcgccgccacttcaagcaggggcgggag 17958785 Query: 177 aacgtctggaaggacaaccc 196 |||||||||||| ||||||| Sbjct: 17958786 aacgtctggaagcacaaccc 17958805 Score = 83.8 bits (42), Expect = 5e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 294 cagcaaattgttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattg 353 ||||||||| |||| |||| ||||||||| | |||||||| |||||||||||| || || Sbjct: 17959297 cagcaaattattccggagggagagtgggacgacttcatgaacatgctccggaaaccgctg 17959356 Query: 354 ccagccgcttttaggattaatgcgag 379 |||||| |||| |||||||||||||| Sbjct: 17959357 ccagccactttcaggattaatgcgag 17959382 Score = 73.8 bits (37), Expect = 5e-10 Identities = 53/57 (92%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 445 aggtcagtgatgaccatgaa-aagaggctattcggcctttgccttggtaccctggca 500 |||| |||||||| |||||| |||| ||||||||||||||||||||||||||||||| Sbjct: 17960327 aggttagtgatgagcatgaagaagatgctattcggcctttgccttggtaccctggca 17960383 Score = 69.9 bits (35), Expect = 8e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 378 agctgtcagttttttaaagacatttgttcacaattagaaaatgacttcaggaagtcgtta 437 |||||||| |||| | |||| ||||| ||||| ||||||||||||||||||||||| || Sbjct: 17960174 agctgtcaattttatcaagatatttgctcacagttagaaaatgacttcaggaagtcattg 17960233 Query: 438 gagactgaggt 448 || |||||||| Sbjct: 17960234 gaaactgaggt 17960244 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 132 aagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgagaacgtctggaaggac 191 |||||||||||| ||||||| || ||||||||||||| ||||||| | |||||||| || Sbjct: 17929080 aagcgcgggcgcacgcagcgccgccacttcaagcaggggcgcgaggtcctctggaagcac 17929139 Query: 192 aa 193 || Sbjct: 17929140 aa 17929141 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 243 tggcagcccttcgccacggagaacctggccttcgaggcttactacaagg 291 ||||||||||||||||| ||||||| |||||||||| |||||||||| Sbjct: 17958879 tggcagcccttcgccaccgagaacccagccttcgaggactactacaagg 17958927 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 145 cgcagcgtcgtcacttcaagcaggagcgcgagaacgtctggaaggacaaccccaggcgcc 204 ||||||| || ||||||||||||| |||||||||| ||| |||| |||| ||| ||||| Sbjct: 17946859 cgcagcgccgccacttcaagcaggggcgcgagaacatcttgaagcacaaaccccagcgcc 17946918 Query: 205 ctcc 208 |||| Sbjct: 17946919 ctcc 17946922 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 3600965 ctgccaccgccaccgccaccgcca 3600942 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 22024928 gccaccgccaccgccaccgcca 22024907 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 22024922 gccaccgccaccgccaccgcc 22024902 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21954655 gccaccgccaccgccaccgcc 21954675 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 20844720 ccaccgccaccgccaccgcca 20844740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 9729217 gccaccgccaccgccaccgcc 9729197 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 20844725 gccaccgccaccgccaccgc 20844744 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 19627586 gccaccgccaccgccaccgc 19627567 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 9729221 caccgccaccgccaccgcca 9729202 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 3600957 gccaccgccaccgccaccgc 3600938
>dbj|AP005573.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1509_C06 Length = 113436 Score = 103 bits (52), Expect = 5e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 117 atggggggcggcaggaagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgag 176 ||||| ||||||||||||||||||||| ||||||| || ||||||||||||| ||| ||| Sbjct: 10380 atgggaggcggcaggaagcgcgggcgcacgcagcgccgccacttcaagcaggggcgggag 10439 Query: 177 aacgtctggaaggacaaccc 196 |||||||||||| ||||||| Sbjct: 10440 aacgtctggaagcacaaccc 10459 Score = 83.8 bits (42), Expect = 5e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 294 cagcaaattgttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattg 353 ||||||||| |||| |||| ||||||||| | |||||||| |||||||||||| || || Sbjct: 10951 cagcaaattattccggagggagagtgggacgacttcatgaacatgctccggaaaccgctg 11010 Query: 354 ccagccgcttttaggattaatgcgag 379 |||||| |||| |||||||||||||| Sbjct: 11011 ccagccactttcaggattaatgcgag 11036 Score = 73.8 bits (37), Expect = 5e-10 Identities = 53/57 (92%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 445 aggtcagtgatgaccatgaa-aagaggctattcggcctttgccttggtaccctggca 500 |||| |||||||| |||||| |||| ||||||||||||||||||||||||||||||| Sbjct: 11981 aggttagtgatgagcatgaagaagatgctattcggcctttgccttggtaccctggca 12037 Score = 69.9 bits (35), Expect = 8e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 378 agctgtcagttttttaaagacatttgttcacaattagaaaatgacttcaggaagtcgtta 437 |||||||| |||| | |||| ||||| ||||| ||||||||||||||||||||||| || Sbjct: 11828 agctgtcaattttatcaagatatttgctcacagttagaaaatgacttcaggaagtcattg 11887 Query: 438 gagactgaggt 448 || |||||||| Sbjct: 11888 gaaactgaggt 11898 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 243 tggcagcccttcgccacggagaacctggccttcgaggcttactacaagg 291 ||||||||||||||||| ||||||| |||||||||| |||||||||| Sbjct: 10533 tggcagcccttcgccaccgagaacccagccttcgaggactactacaagg 10581
>ref|XM_483023.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2732 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Plus Query: 285 tacaaggggcagcaaattgttcctgaggaagagtgggatgccttcatgagcatgctccgg 344 ||||||| ||| | |||||||| ||||| |||||||||| |||||| || |||| ||| Sbjct: 266 tacaaggagcaacgaattgttcgcgaggaggagtgggatgacttcatcagtgtgctgcgg 325 Query: 345 aagccattgccagccgcttttaggattaatgcgagctgtcagttttttaaagacatttgt 404 || ||||||||||| |||||||||| ||||| |||| ||||||||||| || ||||| Sbjct: 326 aaaccattgccagcgacttttaggatcaatgccagctcccagttttttaaggatatttgc 385 Query: 405 tcacaattagaaaatgacttca 426 ||| | ||||| |||||||||| Sbjct: 386 tcaaagttagagaatgacttca 407
>dbj|AK065727.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013035I17, full insert sequence Length = 2732 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Plus Query: 285 tacaaggggcagcaaattgttcctgaggaagagtgggatgccttcatgagcatgctccgg 344 ||||||| ||| | |||||||| ||||| |||||||||| |||||| || |||| ||| Sbjct: 266 tacaaggagcaacgaattgttcgcgaggaggagtgggatgacttcatcagtgtgctgcgg 325 Query: 345 aagccattgccagccgcttttaggattaatgcgagctgtcagttttttaaagacatttgt 404 || ||||||||||| |||||||||| ||||| |||| ||||||||||| || ||||| Sbjct: 326 aaaccattgccagcgacttttaggatcaatgccagctcccagttttttaaggatatttgc 385 Query: 405 tcacaattagaaaatgacttca 426 ||| | ||||| |||||||||| Sbjct: 386 tcaaagttagagaatgacttca 407
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 299 aattgttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattgccagc 358 |||||||| ||||| |||||||||| |||||| || |||| ||||| ||||||||||| Sbjct: 23926545 aattgttcgcgaggaggagtgggatgacttcatcagtgtgctgcggaaaccattgccagc 23926486 Query: 359 cgcttttaggattaatgc 376 |||||||||| ||||| Sbjct: 23926485 gacttttaggatcaatgc 23926468 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26455115 gccaccgccaccgccaccgcca 26455094 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26191154 gccaccgccaccgccaccgcca 26191133 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26191148 gccaccgccaccgccaccgcca 26191127 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 13065498 gccaccgccaccgccaccgcca 13065519 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5607296 gccaccgccaccgccaccgcca 5607275 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5603219 gccaccgccaccgccaccgcca 5603198 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 27209665 ccaccgccaccgccaccgcca 27209645 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 26191159 ccaccgccaccgccaccgcca 26191139 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 26191142 gccaccgccaccgccaccgcc 26191122 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 22965499 gccaccgccaccgccaccgcc 22965519 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21301401 gccaccgccaccgccaccgcc 21301381 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 20088796 gccaccgccaccgccaccgcc 20088816 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5607290 gccaccgccaccgccaccgcc 5607270 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5603213 gccaccgccaccgccaccgcc 5603193 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5398150 gccaccgccaccgccaccgcc 5398130 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 2412288 gccaccgccaccgccaccgcc 2412268 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 27070598 ccaccgccaccgccaccgcc 27070579 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 25232137 gccaccgccaccgccaccgc 25232118 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 cgccaccgccaactccctcc 64 |||||||||||||||||||| Sbjct: 18722428 cgccaccgccaactccctcc 18722447 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 13065504 gccaccgccaccgccaccgc 13065523 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 9434612 gccaccgccaccgccaccgc 9434593
>dbj|AP005555.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1118_B06 Length = 106678 Score = 60.0 bits (30), Expect = 7e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 132 aagcgcgggcgctcgcagcgtcgtcacttcaagcaggagcgcgagaacgtctggaaggac 191 |||||||||||| ||||||| || ||||||||||||| ||||||| | |||||||| || Sbjct: 79899 aagcgcgggcgcacgcagcgccgccacttcaagcaggggcgcgaggtcctctggaagcac 79958 Query: 192 aa 193 || Sbjct: 79959 aa 79960 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 145 cgcagcgtcgtcacttcaagcaggagcgcgagaacgtctggaaggacaaccccaggcgcc 204 ||||||| || ||||||||||||| |||||||||| ||| |||| |||| ||| ||||| Sbjct: 97678 cgcagcgccgccacttcaagcaggggcgcgagaacatcttgaagcacaaaccccagcgcc 97737 Query: 205 ctcc 208 |||| Sbjct: 97738 ctcc 97741
>dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0419H09 Length = 143533 Score = 60.0 bits (30), Expect = 7e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 299 aattgttcctgaggaagagtgggatgccttcatgagcatgctccggaagccattgccagc 358 |||||||| ||||| |||||||||| |||||| || |||| ||||| ||||||||||| Sbjct: 59696 aattgttcgcgaggaggagtgggatgacttcatcagtgtgctgcggaaaccattgccagc 59637 Query: 359 cgcttttaggattaatgc 376 |||||||||| ||||| Sbjct: 59636 gacttttaggatcaatgc 59619
>gb|AY825542.1| Taenia saginata 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 733 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaac 57 |||||||||||||||||||||||| Sbjct: 410 gccaccgccaccgccaccgccaac 387 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 415 ccaccgccaccgccaccgcca 395
>ref|XM_450262.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1467 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 90 ctgccaccgccaccgccaccgcca 67 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 82 gccaccgccaccgccaccgc 63
>ref|XM_507426.1| PREDICTED Oryza sativa (japonica cultivar-group), P0499G10.19 mRNA Length = 1490 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 138 ctgccaccgccaccgccaccgcca 115 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 130 gccaccgccaccgccaccgc 111
>ref|XM_506639.2| PREDICTED Oryza sativa (japonica cultivar-group), P0499G10.19 mRNA Length = 1539 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 162 ctgccaccgccaccgccaccgcca 139 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 154 gccaccgccaccgccaccgc 135
>ref|XM_863870.1| PREDICTED: Bos taurus similar to CG14868-PA (LOC613278), partial mRNA Length = 1535 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 cctgccaccgccaccgccaccgcc 54 |||||||||||||||||||||||| Sbjct: 220 cctgccaccgccaccgccaccgcc 197
>gb|AC148878.2| Chlamydomonas reinhardtii clone cr-29B2, complete sequence Length = 64153 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 47725 ctgccaccgccaccgccaccgcca 47702
>gb|AC140433.3| Mus musculus BAC clone RP23-96L16 from chromosome 16, complete sequence Length = 231593 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 36122 ctgccaccgccaccgccaccgcca 36099
>gb|BC063955.1| Danio rerio type II cytokeratin, mRNA (cDNA clone MGC:77647 IMAGE:6996972), complete cds Length = 2403 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 330 ctgccaccgccaccgccaccgcca 307
>emb|AM039951.1| Xanthomonas campestris pv. vesicatoria plasmid pXCV183, complete genome Length = 182572 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 12879 ctgccaccgccaccgccaccgcca 12856 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 40510 gccaccgccaccgccaccgcca 40489 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 12871 gccaccgccaccgccaccgcca 12850
>emb|AJ507491.1|BAR507491 Bambusa bambos microsatellite DNA, clone Ba58 Length = 554 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Minus Query: 309 gaggaagagtgggatgccttcatgagcatgctccggaagccatt 352 ||||| |||||||||||||||||||| |||| ||||| ||||| Sbjct: 63 gaggaggagtgggatgccttcatgagtgtgcttcggaaaccatt 20
>gb|AC122381.2| Mus musculus BAC clone RP23-477C4 from chromosome 16, complete sequence Length = 188889 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 134209 ctgccaccgccaccgccaccgcca 134186
>gb|BT023819.1| Drosophila melanogaster SD06601 full insert cDNA Length = 2799 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 345 ctgccaccgccaccgccaccgcca 368 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 353 gccaccgccaccgccaccgc 372
>emb|CR352294.7| Zebrafish DNA sequence from clone CH211-188C24 in linkage group 23, complete sequence Length = 146924 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 86528 ctgccaccgccaccgccaccgcca 86551
>gb|AY597281.1| Pseudomonas viridiflava strain ME3.1b pathogenicity island PAI-Region-2, partial sequence Length = 39776 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaac 57 |||||||||||||||||||||||| Sbjct: 26458 gccaccgccaccgccaccgccaac 26481 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26452 gccaccgccaccgccaccgcca 26473 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26446 gccaccgccaccgccaccgcca 26467 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26440 gccaccgccaccgccaccgcca 26461 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 26435 ccaccgccaccgccaccgcca 26455
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 3946782 ctgccaccgccaccgccaccgcca 3946805 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3946796 gccaccgccaccgccaccgcca 3946817 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3946790 gccaccgccaccgccaccgcca 3946811 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3289302 gccaccgccaccgccaccgcca 3289281 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3917024 gccaccgccaccgccaccgcc 3917044 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 3710125 gccaccgccaccgccaccgc 3710144 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 696534 gccaccgccaccgccaccgc 696515
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 48.1 bits (24), Expect = 0.028 Identities = 27/28 (96%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactccc 61 |||||||||||||||||||||| ||||| Sbjct: 28818310 gccaccgccaccgccaccgccacctccc 28818337 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 28912340 gccaccgccaccgccaccgcca 28912361 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 17576687 gccaccgccaccgccaccgcca 17576666 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 16416740 gccaccgccaccgccaccgcca 16416761 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4305347 gccaccgccaccgccaccgcca 4305368 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2978354 gccaccgccaccgccaccgcca 2978375 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2978348 gccaccgccaccgccaccgcca 2978369 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccg 52 ||||||||||||||||||||| Sbjct: 16734766 ctgccaccgccaccgccaccg 16734746 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 2857333 gccaccgccaccgccaccgcc 2857313 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 810192 gccaccgccaccgccaccgcc 810172 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 ctcctgccaccgccaccgcc 48 |||||||||||||||||||| Sbjct: 29360164 ctcctgccaccgccaccgcc 29360183 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 23049932 ccaccgccaccgccaccgcc 23049913 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 21451213 ccaccgccaccgccaccgcc 21451194 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 19068767 caccgccaccgccaccgcca 19068786 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 16661726 gccaccgccaccgccaccgc 16661707 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 5568534 ccaccgccaccgccaccgcc 5568515 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 2431556 ccaccgccaccgccaccgcc 2431575
>gb|AC105046.10| Homo sapiens chromosome 8, clone CTD-3247F14, complete sequence Length = 87734 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 32609 ctgccaccgccaccgccaccgcca 32586 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 32601 gccaccgccaccgccaccgcc 32581
>emb|BX119982.8| Zebrafish DNA sequence from clone CH211-214J4 in linkage group 23, complete sequence Length = 210702 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 67232 ctgccaccgccaccgccaccgcca 67255
>dbj|AP005587.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0499G10 Length = 158375 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 86740 ctgccaccgccaccgccaccgcca 86717 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 86732 gccaccgccaccgccaccgc 86713
>dbj|AP005578.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1695_A02 Length = 156214 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 9226 ctgccaccgccaccgccaccgcca 9203 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 9218 gccaccgccaccgccaccgc 9199
>dbj|AK105777.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F09, full insert sequence Length = 1539 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 162 ctgccaccgccaccgccaccgcca 139 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 154 gccaccgccaccgccaccgc 135
>dbj|AK100131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010A16, full insert sequence Length = 4022 Score = 48.1 bits (24), Expect = 0.028 Identities = 27/28 (96%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactccc 61 |||||||||||||||||||||| ||||| Sbjct: 88 gccaccgccaccgccaccgccacctccc 115
>dbj|AK068535.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151B22, full insert sequence Length = 1489 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 137 ctgccaccgccaccgccaccgcca 114 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 129 gccaccgccaccgccaccgc 110
>dbj|AK061377.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-G08, full insert sequence Length = 1467 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 90 ctgccaccgccaccgccaccgcca 67 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 82 gccaccgccaccgccaccgc 63
>emb|AJ606680.1| Drosophila melanogaster mRNA for lamin B receptor (lbr gene) Length = 2885 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 345 ctgccaccgccaccgccaccgcca 368 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 353 gccaccgccaccgccaccgc 372
>emb|AL627128.16| Mouse DNA sequence from clone RP23-133J9 on chromosome 4, complete sequence Length = 183089 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 175781 ctgccaccgccaccgccaccgcca 175804 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 175801 gccaccgccaccgccaccgcca 175822 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 175795 gccaccgccaccgccaccgcca 175816 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 175789 gccaccgccaccgccaccgcca 175810
>gb|AC134929.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0035N21, complete sequence Length = 128331 Score = 48.1 bits (24), Expect = 0.028 Identities = 27/28 (96%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaactccc 61 |||||||||||||||||||||| ||||| Sbjct: 55157 gccaccgccaccgccaccgccacctccc 55130
>emb|Y07558.1|HSPILOT H.sapiens PILOT gene, 5' flanking region Length = 3700 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 3274 ctgccaccgccaccgccaccgcca 3251 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3266 gccaccgccaccgccaccgcca 3245 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3260 gccaccgccaccgccaccgcc 3240
>gb|AC055854.14| Homo sapiens chromosome 8, clone RP11-459E5, complete sequence Length = 138388 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||||||||| Sbjct: 84 ctgccaccgccaccgccaccgcca 107 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 92 gccaccgccaccgccaccgcc 112
>ref|NM_114972.2| Arabidopsis thaliana nucleic acid binding / protein binding / zinc ion binding AT3G51120 mRNA, complete cds Length = 4128 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgccaact 58 ||||||||||||||||||||||| Sbjct: 3554 caccgccaccgccaccgccaact 3576
>gb|AY825541.1| Taenia saginata 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 718 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 407 ccaccgccaccgccaccgccaac 385
>gb|AY825540.1| Taenia saginata 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 716 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 407 ccaccgccaccgccaccgccaac 385
>gb|AC108762.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone OSJNBb0052C07, complete sequence Length = 154528 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 122473 tgccaccgccaccgccaccgcca 122451 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 79377 gccaccgccaccgccaccgcca 79356 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 122466 gccaccgccaccgccaccgcc 122446 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 79371 gccaccgccaccgccaccgcc 79351
>gb|AY956840.1| Salmonella enterica subsp. enterica serovar Gallinarum strain SGB-9 virulence-associated protein spvB (spvB) gene, partial cds Length = 667 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 451 tgccaccgccaccgccaccgcca 473 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 464 gccaccgccaccgccaccgcca 485 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 458 gccaccgccaccgccaccgcca 479 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 470 gccaccgccaccgccaccgcc 490
>gb|AC103360.9| Mus musculus chromosome 8, clone RP24-414A22, complete sequence Length = 172618 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaa 56 ||||||||||||||||||||||| Sbjct: 136413 gccaccgccaccgccaccgccaa 136391 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 136419 gccaccgccaccgccaccgcca 136398
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence Length = 384518 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 303705 tgccaccgccaccgccaccgcca 303727 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 273237 gccaccgccaccgccaccgcc 273217
>gb|AY355370.1| Rickettsia akari surface antigen (sca2) gene, partial cds Length = 5052 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 2896 tgccaccgccaccgccaccgcca 2918
>ref|XM_715404.1| Candida albicans SC5314 putative transcription factor (CaO19_2747), mRNA Length = 3090 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 920 ccaccgccaccgccaccgccaac 898
>ref|XM_715173.1| Candida albicans SC5314 putative transcription factor (CaO19_10261), mRNA Length = 3090 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 920 ccaccgccaccgccaccgccaac 898
>ref|XM_806801.1| Trypanosoma cruzi strain CL Brener dual specificity protein phosphatase (Tc00.1047053508385.40) partial mRNA Length = 2463 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaa 56 ||||||||||||||||||||||| Sbjct: 1446 gccaccgccaccgccaccgccaa 1424 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1452 gccaccgccaccgccaccgcca 1431
>ref|XM_808309.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506457.90) partial mRNA Length = 777 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 574 ctgccaccgccaccgccaccgcc 596 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 751 ccaccgccaccgccaccgcc 770
>ref|XM_811829.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053509693.130) partial mRNA Length = 774 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 574 ctgccaccgccaccgccaccgcc 596
>gb|AY597282.1| Pseudomonas viridiflava strain RMX23.1a pathogenicity island PAI-Region-2, partial sequence Length = 39285 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 25924 ccaccgccaccgccaccgccaac 25946
>emb|AL731623.3|OSJN00263 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083D01, complete sequence Length = 148353 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 130699 ctgccaccgccaccgccaccgcc 130721 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 128810 gccaccgccaccgccaccgc 128791
>emb|AL607000.3|OSJN00132 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03, complete sequence Length = 130910 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 17938 ctgccaccgccaccgccaccgcc 17960 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 77854 gccaccgccaccgccaccgcc 77874 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 77849 ccaccgccaccgccaccgcca 77869 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 16049 gccaccgccaccgccaccgc 16030
>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB Length = 1683333 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaa 56 ||||||||||||||||||||||| Sbjct: 1083613 gccaccgccaccgccaccgccaa 1083591
>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12 Length = 129516 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgccaact 58 ||||||||||||||||||||||| Sbjct: 45800 caccgccaccgccaccgccaact 45778
>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome Length = 4171146 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 3158138 tgccaccgccaccgccaccgcca 3158160 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 3158145 gccaccgccaccgccaccgc 3158164
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 1703097 ccaccgccaccgccaccgccaac 1703075 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 3889682 gccaccgccaccgccaccgc 3889701 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 3889678 caccgccaccgccaccgcca 3889697
>ref|NM_166485.1| Drosophila melanogaster Lamin B receptor CG17952-RB, transcript variant B (LBR), mRNA Length = 2891 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 464 tgccaccgccaccgccaccgcca 486 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 471 gccaccgccaccgccaccgc 490
>ref|NM_166484.1| Drosophila melanogaster Lamin B receptor CG17952-RC, transcript variant C (LBR), mRNA Length = 2773 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 346 tgccaccgccaccgccaccgcca 368 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 353 gccaccgccaccgccaccgc 372
>ref|NM_137764.2| Drosophila melanogaster Lamin B receptor CG17952-RA, transcript variant A (LBR), mRNA Length = 2688 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 261 tgccaccgccaccgccaccgcca 283 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 268 gccaccgccaccgccaccgc 287
>gb|AY070562.1| Drosophila melanogaster LD38760 full length cDNA Length = 2697 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 261 tgccaccgccaccgccaccgcca 283 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 268 gccaccgccaccgccaccgc 287
>dbj|AK165771.1| Mus musculus 13 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:G630066J12 product:unclassifiable, full insert sequence Length = 5296 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgccaactcc 60 |||||||||||||||||||||| |||| Sbjct: 1001 gccaccgccaccgccaccgccacctcc 975
>gb|AC123660.8| Mus musculus chromosome 3, clone RP23-196E24, complete sequence Length = 211632 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactcc 60 |||||||||||||||||||||| |||| Sbjct: 91613 gccaccgccaccgccaccgccacctcc 91639
>gb|AC007803.7|AC007803 Drosophila melanogaster, chromosome 2R, region 58A1-58A2, BAC clone BACR13F14, complete sequence Length = 198244 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 124235 tgccaccgccaccgccaccgcca 124213 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 124228 gccaccgccaccgccaccgc 124209
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 18550072 ctgccaccgccaccgccaccgcc 18550094 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 34353839 gccaccgccaccgccaccgcca 34353818 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||||||||||||||||||| |||| Sbjct: 33394549 ccaccgccaccgccaccgccacctcc 33394574 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 25058287 gccaccgccaccgccaccgcca 25058308 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 22196880 gccaccgccaccgccaccgcca 22196859 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21257297 gccaccgccaccgccaccgcca 21257318 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 34353833 gccaccgccaccgccaccgcc 34353813 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 31806740 ccaccgccaccgccaccgcca 31806760 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 21794340 ccaccgccaccgccaccgcca 21794320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21794335 gccaccgccaccgccaccgcc 21794315 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21257303 gccaccgccaccgccaccgcc 21257323 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 18609988 gccaccgccaccgccaccgcc 18610008 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 18609983 ccaccgccaccgccaccgcca 18610003 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 10071485 gccaccgccaccgccaccgcc 10071505 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 40 gccaccgccaccgccaactccctc 63 |||||||||||||||| ||||||| Sbjct: 33613374 gccaccgccaccgccacctccctc 33613351 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 27697978 gccaccgccaccgccaccgc 27697997 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 24377732 ccaccgccaccgccaccgcc 24377713 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 18548183 gccaccgccaccgccaccgc 18548164 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaactccct 62 ||||||||||||||||| ||| |||||| Sbjct: 16022084 ccaccgccaccgccaccaccacctccct 16022057
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 25570880 ctgccaccgccaccgccaccgcc 25570858 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 22036780 gccaccgccaccgccaccgcca 22036801 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||| |||||||||||||||||||| Sbjct: 18424898 ccaccaccaccgccaccgccaactcc 18424923 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 10395451 gccaccgccaccgccaccgcca 10395430 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6158736 gccaccgccaccgccaccgcca 6158757 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 357785 gccaccgccaccgccaccgcca 357806 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 357779 gccaccgccaccgccaccgcca 357800 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 27383076 ccaccgccaccgccaccgcca 27383096 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 26151317 gccaccgccaccgccaccgcc 26151337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 20889137 ccaccgccaccgccaccgcca 20889117 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 10395445 gccaccgccaccgccaccgcc 10395425 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5848824 gccaccgccaccgccaccgcc 5848844 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3937078 gccaccgccaccgccaccgcc 3937058 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3242377 gccaccgccaccgccaccgcc 3242397 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 357791 gccaccgccaccgccaccgcc 357811 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 27510687 gccaccgccaccgccaccgc 27510668 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 24999602 ccaccgccaccgccaccgcc 24999583 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||||| |||||||||||||||| Sbjct: 22370741 ctgccactgccaccgccaccgcca 22370764 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 20889132 gccaccgccaccgccaccgc 20889113 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 18349057 ccaccgccaccgccaccgcc 18349076 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||| |||||||||||||||||| Sbjct: 3937086 ctgccgccgccaccgccaccgcca 3937063
>gb|AC009912.5|AC009912 Drosophila melanogaster, chromosome 2R, region 57F-58A, BAC clone BACR46G10, complete sequence Length = 165158 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 138661 tgccaccgccaccgccaccgcca 138683 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 138668 gccaccgccaccgccaccgc 138687
>gb|AC112666.9| Mus musculus chromosome 3, clone RP24-119D5, complete sequence Length = 193302 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactcc 60 |||||||||||||||||||||| |||| Sbjct: 153741 gccaccgccaccgccaccgccacctcc 153767
>ref|XM_234082.3| PREDICTED: Rattus norvegicus similar to homeodomain protein Sax2 (LOC298981), mRNA Length = 1737 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 43 ctgccaccgccaccgccaccgcc 65
>gb|AY954520.1| Taenia saginata isolate Duyun 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 668 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 381 ccaccgccaccgccaccgccaac 359
>dbj|AK106406.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-H03, full insert sequence Length = 1637 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 907 ctgccaccgccaccgccaccgcc 929
>dbj|AK066817.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013081A11, full insert sequence Length = 2496 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 398 ctgccaccgccaccgccaccgcc 420
>gb|AE003455.3| Drosophila melanogaster chromosome 2R, section 63 of 73 of the complete sequence Length = 291250 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 14194 tgccaccgccaccgccaccgcca 14216 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 14201 gccaccgccaccgccaccgc 14220
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaac 57 ||||||||||||||||||||||| Sbjct: 1726657 ccaccgccaccgccaccgccaac 1726635 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 4255162 gccaccgccaccgccaccgcc 4255182 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 1510035 gccaccgccaccgccaccgcc 1510015
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 25499056 ctgccaccgccaccgccaccgcc 25499034 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21965125 gccaccgccaccgccaccgcca 21965146 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||| |||||||||||||||||||| Sbjct: 18351124 ccaccaccaccgccaccgccaactcc 18351149 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 10395333 gccaccgccaccgccaccgcca 10395312 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6158612 gccaccgccaccgccaccgcca 6158633 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 357785 gccaccgccaccgccaccgcca 357806 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 357779 gccaccgccaccgccaccgcca 357800 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 27308676 ccaccgccaccgccaccgcca 27308696 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 26079493 gccaccgccaccgccaccgcc 26079513 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 20815351 ccaccgccaccgccaccgcca 20815331 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 10395327 gccaccgccaccgccaccgcc 10395307 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5848817 gccaccgccaccgccaccgcc 5848837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3937052 gccaccgccaccgccaccgcc 3937032 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3242322 gccaccgccaccgccaccgcc 3242342 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 357791 gccaccgccaccgccaccgcc 357811 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 27436245 gccaccgccaccgccaccgc 27436226 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 24927808 ccaccgccaccgccaccgcc 24927789 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||||| |||||||||||||||| Sbjct: 22299086 ctgccactgccaccgccaccgcca 22299109 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 20815346 gccaccgccaccgccaccgc 20815327 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 18275378 ccaccgccaccgccaccgcc 18275397 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||| |||||||||||||||||| Sbjct: 3937060 ctgccgccgccaccgccaccgcca 3937037
>emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa0070E09 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144084 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 140262 ctgccaccgccaccgccaccgcc 140240
>emb|AL732537.4|CNS08C9C Oryza sativa chromosome 12, . BAC OSJNBa0036L12 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 127003 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcc 54 ||||||||||||||||||||||| Sbjct: 102838 ctgccaccgccaccgccaccgcc 102860
>emb|AL844489.6| Mouse DNA sequence from clone RP23-101P8 on chromosome 2, complete sequence Length = 213549 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 33 tgccaccgccaccgccaccgcca 55 ||||||||||||||||||||||| Sbjct: 72400 tgccaccgccaccgccaccgcca 72378
>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome Length = 1709204 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 16440 gccaccgccaccgccaccgcca 16419 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 16434 gccaccgccaccgccaccgcca 16413
>ref|XM_462827.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1033 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 246 gccaccgccaccgccaccgcca 225
>gb|AC109196.12| Mus musculus chromosome 5, clone RP23-313F5, complete sequence Length = 205369 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 7766 gccaccgccaccgccaccgcca 7745 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 7760 gccaccgccaccgccaccgcca 7739 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 7771 ccaccgccaccgccaccgcca 7751
>ref|XM_483481.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2667 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 106 gccaccgccaccgccaccgcca 127
>ref|XM_483432.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1124 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 177 gccaccgccaccgccaccgcca 156 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 171 gccaccgccaccgccaccgcca 150 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 182 ccaccgccaccgccaccgcca 162 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 165 gccaccgccaccgccaccgcc 145
>ref|XM_480530.1| Oryza sativa (japonica cultivar-group), mRNA Length = 639 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 63 gccaccgccaccgccaccgcca 42 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 57 gccaccgccaccgccaccgcc 37
>ref|XM_480529.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1863 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 142 gccaccgccaccgccaccgcca 121 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 136 gccaccgccaccgccaccgcc 116
>ref|XM_475134.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2355 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 261 gccaccgccaccgccaccgcca 240
>ref|XM_470592.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1377 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 52 gccaccgccaccgccaccgcca 73 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 58 gccaccgccaccgccaccgcc 78
>ref|XM_468349.1| Oryza sativa (japonica cultivar-group), mRNA Length = 516 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 392 gccaccgccaccgccaccgcca 371
>ref|XM_468371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1971 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 65 gccaccgccaccgccaccgcca 44
>gb|DQ115388.1| Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence Length = 74589 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 53234 tgccaccgccaccgccaccgcc 53213
>ref|XM_465147.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1191 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 181 gccaccgccaccgccaccgcca 202 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 187 gccaccgccaccgccaccgcc 207
>ref|XM_506779.1| PREDICTED Oryza sativa (japonica cultivar-group), P0572A04.25 mRNA Length = 1222 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 203 gccaccgccaccgccaccgcca 224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 209 gccaccgccaccgccaccgcc 229
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 390 gccaccgccaccgccaccgcca 369
>ref|NM_196155.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0095C06.6), mRNA Length = 432 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 380 gccaccgccaccgccaccgcca 359 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 374 gccaccgccaccgccaccgcc 354
>ref|NM_191874.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1098 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 248 gccaccgccaccgccaccgcca 269
>ref|NM_191829.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 531 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 301 gccaccgccaccgccaccgcca 322
>ref|NM_192499.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 666 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 298 gccaccgccaccgccaccgcca 277 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 292 gccaccgccaccgccaccgcc 272 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 302 caccgccaccgccaccgcca 283
>ref|XM_478040.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3267 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 507 gccaccgccaccgccaccgcca 486 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 428 ccaccgccaccgccaccgcc 409
>ref|NM_185562.1| Oryza sativa (japonica cultivar-group), mRNA Length = 600 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 51 gccaccgccaccgccaccgcca 72 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||| |||||||||||||||||| Sbjct: 43 ctgccgccgccaccgccaccgcca 66
>ref|XM_476914.1| Oryza sativa (japonica cultivar-group), mRNA Length = 465 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 284 gccaccgccaccgccaccgcca 305 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 290 gccaccgccaccgccaccgcc 310
>ref|XM_473071.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2511 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2251 gccaccgccaccgccaccgcca 2230
>ref|NM_185233.2| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 735 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 657 gccaccgccaccgccaccgcca 636 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 651 gccaccgccaccgccaccgcc 631
>gb|AC162523.9| Mus musculus chromosome 8, clone RP23-370L21, complete sequence Length = 193777 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127518 gccaccgccaccgccaccgcca 127497 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127512 gccaccgccaccgccaccgcca 127491 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 127556 ccaccgccaccgccaccgcca 127536
>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence Length = 194854 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 135179 gccaccgccaccgccaccgcca 135158
>gb|AC136221.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0077J17, complete sequence Length = 141598 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 57177 gccaccgccaccgccaccgcca 57198
>gb|AY360387.2| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0003M24, complete sequence Length = 150085 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 117953 gccaccgccaccgccaccgcca 117932 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 117947 gccaccgccaccgccaccgc 117928
>gb|AC135502.4| Oryza sativa chromosome 3 BAC OSJNBb0085A04 genomic sequence, complete sequence Length = 132292 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 13853 gccaccgccaccgccaccgcca 13874
>gb|AF442698.1| Salix burjatica clone SB88 microsatellite sequence Length = 272 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 119 gccaccgccaccgccaccgcca 140 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 113 gccaccgccaccgccaccgcca 134 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 125 gccaccgccaccgccaccgc 144
>gb|AY650917.1| Hypochaeris radicata clone HrGGCGGT microsatellite sequence Length = 463 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 195 gccaccgccaccgccaccgcca 174 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 189 gccaccgccaccgccaccgcca 168 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 183 gccaccgccaccgccaccgcca 162 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 177 gccaccgccaccgccaccgcca 156 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 171 gccaccgccaccgccaccgcca 150
>gb|AC128644.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0009F15, complete sequence Length = 142289 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 128046 gccaccgccaccgccaccgcca 128067 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 128052 gccaccgccaccgccaccgcc 128072 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 128041 ccaccgccaccgccaccgcca 128061
>gb|AC146523.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0045D11 map near 50283S, complete sequence Length = 148306 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 124425 ctgccaccgccaccgccaccgc 124404
>gb|AC016781.6| Oryza sativa (japonica cultivar-group) clone OSJNBa0084C09, complete sequence Length = 151269 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 128662 gccaccgccaccgccaccgcca 128683
>gb|BC101932.1| Rattus norvegicus nucleosome assembly protein 1-like 3, mRNA (cDNA clone MGC:124570 IMAGE:7938895), complete cds Length = 2824 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 228 gccaccgccaccgccaccgcca 249 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 222 gccaccgccaccgccaccgcca 243 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 216 gccaccgccaccgccaccgcca 237 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 210 gccaccgccaccgccaccgcca 231 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 204 gccaccgccaccgccaccgcca 225 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 234 gccaccgccaccgccaccgcc 254
>gb|AC165080.4| Mus musculus BAC clone RP24-93F20 from chromosome 9, complete sequence Length = 194427 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 119580 gccaccgccaccgccaccgcca 119559
>gb|AC164557.3| Mus musculus BAC clone RP23-282G1 from chromosome 8, complete sequence Length = 175078 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 137990 gccaccgccaccgccaccgcca 138011 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 137985 ccaccgccaccgccaccgcca 138005
>gb|AC136228.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0672D07, complete sequence Length = 136465 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 59954 gccaccgccaccgccaccgcca 59975
>gb|AC093493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0072C16, complete sequence Length = 159525 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 72370 gccaccgccaccgccaccgcca 72391 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 72364 gccaccgccaccgccaccgcca 72385
>gb|AC123616.11| Mus musculus chromosome 8, clone RP23-4F1, complete sequence Length = 228851 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 166045 gccaccgccaccgccaccgcca 166066 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 166039 gccaccgccaccgccaccgcca 166060 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 166001 ccaccgccaccgccaccgcca 166021
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 301259 gccaccgccaccgccaccgcca 301238 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 301253 gccaccgccaccgccaccgcca 301232
>ref|XM_362970.1| Magnaporthe grisea 70-15 predicted protein (MG08467.4) partial cds Length = 1236 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 703 tgccaccgccaccgccaccgcc 682
>ref|XM_580298.2| PREDICTED: Bos taurus similar to trinucleotide repeat containing 6C (LOC504217), mRNA Length = 8979 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3337 gccaccgccaccgccaccgcca 3358
>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence, complete sequence Length = 130272 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactccctccgcg 67 ||||||||||||||||| ||| ||||||||||| Sbjct: 26987 gccaccgccaccgccacggccccctccctccgcg 27020 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26981 gccaccgccaccgccaccgcca 27002
>gb|DQ472188.1| Trypanosoma cruzi strain CL Brener formin 120 kDa gene, complete cds Length = 3294 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1569 gccaccgccaccgccaccgcca 1590 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1720 ccaccgccaccgccaccgcca 1740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1618 ccaccgccaccgccaccgcca 1638 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1564 ccaccgccaccgccaccgcca 1584 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 1666 ccaccgccaccgccaccgcc 1685
>gb|AC134326.3| Mus musculus BAC clone RP24-262M13 from chromosome 10, complete sequence Length = 155718 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 81528 gccaccgccaccgccaccgcca 81507 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 81522 gccaccgccaccgccaccgcca 81501
>gb|BC027927.1| Homo sapiens cDNA clone IMAGE:5200165, partial cds Length = 2447 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 193 gccaccgccaccgccaccgcca 172 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 187 gccaccgccaccgccaccgcca 166 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 181 gccaccgccaccgccaccgcc 161
>gb|AC137608.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complete sequence Length = 148731 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 66633 gccaccgccaccgccaccgcca 66654
>ref|XM_718043.1| Candida albicans SC5314 putative transcription factor (CaO19_5924), mRNA Length = 3393 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||||||||||||||||||| |||| Sbjct: 928 ccaccgccaccgccaccgccacctcc 953
>ref|XM_717896.1| Candida albicans SC5314 putative transcription factor (CaO19_13345), mRNA Length = 3393 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||||||||||||||||||| |||| Sbjct: 928 ccaccgccaccgccaccgccacctcc 953
>gb|AC104847.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0480H08, complete sequence Length = 156301 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 28192 gccaccgccaccgccaccgcca 28171 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 28186 gccaccgccaccgccaccgcc 28166
>ref|XM_712952.1| Candida albicans SC5314 acyl CoA ligase-like protein (CaO19_5702), mRNA Length = 4803 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4164 gccaccgccaccgccaccgcca 4143
>ref|XM_712886.1| Candida albicans SC5314 acyl CoA ligase-like protein (CaO19_13125), mRNA Length = 4803 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4164 gccaccgccaccgccaccgcca 4143
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 106492 gccaccgccaccgccaccgcca 106471
>gb|AC137588.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0060K21, complete sequence Length = 153973 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 152879 gccaccgccaccgccaccgcca 152858 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 152873 gccaccgccaccgccaccgcc 152853
>gb|AC125780.2| Oryza sativa (japonica culitvar-group) chromosome 11 BAC clone OSJNBa0030I15, complete sequence Length = 148498 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 134438 gccaccgccaccgccaccgcca 134459
>ref|NM_133402.2| Rattus norvegicus nucleosome assembly protein 1-like 3 (Nap1l3), mRNA Length = 2824 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 228 gccaccgccaccgccaccgcca 249 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 222 gccaccgccaccgccaccgcca 243 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 216 gccaccgccaccgccaccgcca 237 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 210 gccaccgccaccgccaccgcca 231 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 204 gccaccgccaccgccaccgcca 225 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 234 gccaccgccaccgccaccgcc 254
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactccctccgcg 67 ||||||||||||||||| ||| ||||||||||| Sbjct: 35026086 gccaccgccaccgccacggccccctccctccgcg 35026119 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 35026080 gccaccgccaccgccaccgcca 35026101 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 32554958 ctgccaccgccaccgccaccgc 32554979 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21508959 gccaccgccaccgccaccgcca 21508980 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 20210578 gccaccgccaccgccaccgcca 20210599 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5627345 gccaccgccaccgccaccgcca 5627324 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 198554 gccaccgccaccgccaccgcca 198533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 34054985 gccaccgccaccgccaccgcc 34054965 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 29077826 gccaccgccaccgccaccgcc 29077846 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 23093021 ccaccgccaccgccaccgcca 23093001 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 23093016 gccaccgccaccgccaccgcc 23092996 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 13791491 gccaccgccaccgccaccgcc 13791511 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11682807 gccaccgccaccgccaccgcc 11682827 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 11682802 ccaccgccaccgccaccgcca 11682822 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11682713 gccaccgccaccgccaccgcc 11682733 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 11682708 ccaccgccaccgccaccgcca 11682728 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5627339 gccaccgccaccgccaccgcc 5627319 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 198559 ccaccgccaccgccaccgcca 198539 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 198548 gccaccgccaccgccaccgcc 198528 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 31559239 ccaccgccaccgccaccgcc 31559258 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 30636974 gccaccgccaccgccaccgc 30636993 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 42 caccgccaccgccaactccctccgcgcc 69 |||||||||| |||||||||||||||| Sbjct: 28984697 caccgccacctacaactccctccgcgcc 28984670 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 20901180 caccgccaccgccaccgcca 20901199 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 9972221 gccaccgccaccgccaccgc 9972240 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 5588908 gccaccgccaccgccaccgc 5588889 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 600061 gccaccgccaccgccaccgc 600080
>gb|AC166937.2| Mus musculus BAC clone RP24-121A12 from chromosome 10, complete sequence Length = 183115 Score = 44.1 bits (22), Expect = 0.44 Identities = 28/30 (93%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgccaactccc 61 ||||||||||| |||||||||||| ||||| Sbjct: 40696 ctgccaccgccgccgccaccgccacctccc 40667
>gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, complete sequence Length = 177877 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 108072 gccaccgccaccgccaccgcca 108051 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 108076 caccgccaccgccaccgcca 108057
>gb|AY510084.1| Vibriophage VP5, complete genome Length = 39786 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 11478 gccaccgccaccgccaccgcca 11457 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 11482 caccgccaccgccaccgcca 11463
>ref|XM_752045.1| Ustilago maydis 521 hypothetical protein (UM00991.1) partial mRNA Length = 2313 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1120 gccaccgccaccgccaccgcca 1141 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 1116 caccgccaccgccaccgcca 1135
>ref|XM_542234.2| PREDICTED: Canis familiaris similar to mastermind-like 2 (LOC485116), mRNA Length = 3872 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1863 gccaccgccaccgccaccgcca 1884
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 26658 gccaccgccaccgccaccgcca 26679
>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence Length = 208417 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 184037 gccaccgccaccgccaccgcca 184058 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 184031 gccaccgccaccgccaccgcca 184052 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 184027 caccgccaccgccaccgcca 184046
>gb|AC127411.3| Mus musculus BAC clone RP23-60E24 from chromosome 5, complete sequence Length = 217636 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 132355 gccaccgccaccgccaccgcca 132376
>gb|AC123056.4| Mus musculus BAC clone RP23-182H4 from chromosome 13, complete sequence Length = 183076 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 62127 gccaccgccaccgccaccgcca 62148 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 62121 gccaccgccaccgccaccgcca 62142 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 62115 gccaccgccaccgccaccgcca 62136 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 62109 gccaccgccaccgccaccgcca 62130 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 62103 gccaccgccaccgccaccgcca 62124 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 62098 ccaccgccaccgccaccgcca 62118
>ref|XM_801283.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507077.30) partial mRNA Length = 1089 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 303 gccaccgccaccgccaccgcca 324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 298 ccaccgccaccgccaccgcca 318
>ref|XM_802136.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510899.40) partial mRNA Length = 1095 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 309 gccaccgccaccgccaccgcca 330 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 303 gccaccgccaccgccaccgcca 324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 298 ccaccgccaccgccaccgcca 318
>ref|XM_806556.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510091.110) partial mRNA Length = 906 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 786 gccaccgccaccgccaccgcca 765 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 780 gccaccgccaccgccaccgcca 759 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 774 gccaccgccaccgccaccgcca 753 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 768 gccaccgccaccgccaccgcca 747 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 762 gccaccgccaccgccaccgcca 741 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 756 gccaccgccaccgccaccgcca 735 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 750 gccaccgccaccgccaccgcca 729
>ref|XM_808076.1| Trypanosoma cruzi strain CL Brener I/6 autoantigen (Tc00.1047053508323.100) partial mRNA Length = 648 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 594 gccaccgccaccgccaccgcca 615
>ref|XM_809309.1| Trypanosoma cruzi strain CL Brener formin (Tc00.1047053511755.80) partial mRNA Length = 3294 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1569 gccaccgccaccgccaccgcca 1590 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1720 ccaccgccaccgccaccgcca 1740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1618 ccaccgccaccgccaccgcca 1638 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1564 ccaccgccaccgccaccgcca 1584 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 1666 ccaccgccaccgccaccgcc 1685
>ref|XM_809790.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053509105.50) partial mRNA Length = 966 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 828 gccaccgccaccgccaccgcca 849
>ref|XM_811223.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507801.100) partial mRNA Length = 1893 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 795 gccaccgccaccgccaccgcca 816 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 790 ccaccgccaccgccaccgcca 810
>gb|AY186602.1| Chlamydomonas reinhardtii long flagella (LF3) gene, complete cds Length = 7467 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 7391 gccaccgccaccgccaccgcca 7412 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 7397 gccaccgccaccgccaccgcc 7417
>ref|XM_812950.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053511771.70) partial mRNA Length = 10404 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4878 gccaccgccaccgccaccgcca 4899 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 4873 ccaccgccaccgccaccgcca 4893
>ref|XM_812951.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053511771.210) partial mRNA Length = 10365 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4938 gccaccgccaccgccaccgcca 4959 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 4933 ccaccgccaccgccaccgcca 4953
>ref|XM_797111.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053427237.9) partial mRNA Length = 1230 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 746 gccaccgccaccgccaccgcca 767
>ref|XM_800392.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053508845.9) partial mRNA Length = 5623 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4896 gccaccgccaccgccaccgcca 4917
>ref|XM_808826.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053510607.29) partial mRNA Length = 9781 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4932 gccaccgccaccgccaccgcca 4953
>ref|NM_001975.2| Homo sapiens enolase 2 (gamma, neuronal) (ENO2), mRNA Length = 2423 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 160 gccaccgccaccgccaccgcca 181
>ref|XM_547504.2| PREDICTED: Canis familiaris similar to 1D-myo-inositol-trisphosphate 3-kinase B (LOC490383), mRNA Length = 2811 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1137 gccaccgccaccgccaccgcca 1116 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1131 gccaccgccaccgccaccgcca 1110 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1125 gccaccgccaccgccaccgcca 1104 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1119 gccaccgccaccgccaccgcca 1098 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1113 gccaccgccaccgccaccgcca 1092
>emb|AL606632.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete sequence Length = 163738 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 70771 gccaccgccaccgccaccgcca 70792 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 70777 gccaccgccaccgccaccgcc 70797
>emb|AL606652.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0004A17, complete sequence Length = 159894 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 78242 gccaccgccaccgccaccgcca 78221 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 78236 gccaccgccaccgccaccgcc 78216
>ref|XM_843518.1| PREDICTED: Canis familiaris similar to Potassium voltage-gated channel subfamily G member 2 (Voltage-gated potassium channel subunit Kv6.2) (Cardiac potassium channel subunit) (LOC607004), mRNA Length = 684 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 577 gccaccgccaccgccaccgcca 598 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 571 gccaccgccaccgccaccgcca 592 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 565 gccaccgccaccgccaccgcca 586
>gb|AC162035.5| Mus musculus chromosome 18, clone RP23-434N7, complete sequence Length = 200472 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 144109 gccaccgccaccgccaccgcca 144088
>ref|NM_015073.1| Homo sapiens signal-induced proliferation-associated 1 like 3 (SIPA1L3), mRNA Length = 7984 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 678 gccaccgccaccgccaccgcca 699 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 672 gccaccgccaccgccaccgcca 693
>gb|BC036863.1| Homo sapiens signal-induced proliferation-associated 1 like 3, mRNA (cDNA clone IMAGE:5203416), partial cds Length = 1549 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 657 gccaccgccaccgccaccgcca 678 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 651 gccaccgccaccgccaccgcca 672
>emb|AL590408.15| Human DNA sequence from clone RP11-227F8 on chromosome 1 Contains the 5' end of a novel gene (DKFZP586L151), a novel gene, the 5' end of the gene for C-terminal PDZ domain ligand of neuronal nitric oxide synthase (CAPON) and two CpG islands, complete sequence Length = 103523 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 64919 gccaccgccaccgccaccgcca 64940
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3602303 gccaccgccaccgccaccgcca 3602282
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3474928 gccaccgccaccgccaccgcca 3474907 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127722 gccaccgccaccgccaccgcca 127743 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127716 gccaccgccaccgccaccgcca 127737 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127710 gccaccgccaccgccaccgcca 127731 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127704 gccaccgccaccgccaccgcca 127725 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127698 gccaccgccaccgccaccgcca 127719 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127692 gccaccgccaccgccaccgcca 127713 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127686 gccaccgccaccgccaccgcca 127707 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127680 gccaccgccaccgccaccgcca 127701 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127674 gccaccgccaccgccaccgcca 127695 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127668 gccaccgccaccgccaccgcca 127689 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 127662 gccaccgccaccgccaccgcca 127683 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3474922 gccaccgccaccgccaccgcc 3474902
>emb|AL359513.12| Human DNA sequence from clone RP11-245D16 on chromosome 13 Contains the gene for TMTSP for transmembrane molecule with thrombospondin module (LOC55901), the gene fpr CGI-145 protein (LOC51028), the CKAP2 gene for cytoskeleton associated protein 2 (LB1, FLJ10749) and 3 CpG islands, complete sequence Length = 116430 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 90876 gccaccgccaccgccaccgcca 90855 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 90870 gccaccgccaccgccaccgcca 90849 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 90864 gccaccgccaccgccaccgcca 90843 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 90858 gccaccgccaccgccaccgc 90839
>emb|AL355132.19| Human DNA sequence from clone RP11-181D10 on chromosome 13 Contains a ring finger protein 12 (RNF12) pseudogene, the 5' end of the FOXO1A gene for forkhead box O1A (rhabdomyosarcoma), the 3' end of the MRPS31 gene for mitochondrial ribosomal protein S31 and a CpG island, complete sequence Length = 151261 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 59486 gccaccgccaccgccaccgcca 59507 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 59492 gccaccgccaccgccaccgcc 59512
>emb|AL160281.17| Human DNA sequence from clone RP11-21M7 on chromosome 1 Contains a novel gene, the 5' end of the RASAL2 gene for RAS protein activator like 2 and a CpG island, complete sequence Length = 180954 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4884 gccaccgccaccgccaccgcca 4905 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4878 gccaccgccaccgccaccgcca 4899 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 4890 gccaccgccaccgccaccgcc 4910
>emb|X75254.1|RNPEABP2 R.norvegicus phosphatidylethanolamine binding protein gene Length = 2695 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2060 gccaccgccaccgccaccgcca 2039 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 2065 ccaccgccaccgccaccgcca 2045
>emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D Length = 741 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 83 gccaccgccaccgccaccgcca 104 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 77 gccaccgccaccgccaccgcca 98
>emb|X56727.1|STPSDL2V S. typhimurium plasmid pSDL2 vsdA-F genes for virulence proteins Length = 8279 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 4609 tgccaccgccaccgccaccgcc 4630
>emb|X51956.1|HSENO2 Human ENO2 gene for neuron specific (gamma) enolase Length = 10905 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1259 gccaccgccaccgccaccgcca 1280
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 721052 gccaccgccaccgccaccgcca 721073 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 721046 gccaccgccaccgccaccgcca 721067
>gb|AC078840.6| Oryza sativa chromosome 10 BAC OSJNBb0073N24 genomic sequence, complete sequence Length = 130058 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 63306 gccaccgccaccgccaccgcca 63327
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2570800 gccaccgccaccgccaccgcca 2570821 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2302998 gccaccgccaccgccaccgcca 2302977 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2302992 gccaccgccaccgccaccgcca 2302971 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 2302986 gccaccgccaccgccaccgcc 2302966
>emb|CR759761.9| Human DNA sequence from clone DAMC-157M7 on chromosome 6, complete sequence Length = 83849 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 9401 gccaccgccaccgccaccgcca 9380
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 56761 gccaccgccaccgccaccgcca 56782 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 56767 gccaccgccaccgccaccgcc 56787
>emb|AL606446.1|OSJN00016 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F16, complete sequence Length = 119535 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgccaactcc 60 ||||||||||||||||||||| |||| Sbjct: 40428 ccaccgccaccgccaccgccacctcc 40453
>emb|CR942276.1| Human DNA sequence from clone XX-NCIH2171_5AM21, complete sequence Length = 110743 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 99881 gccaccgccaccgccaccgcca 99902
>emb|AJ430531.1|CRE430531 Chlamydomonas reinhardtii partial mRNA for light regulation of gametogenesis 6 protein (lrg6 gene) Length = 3129 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1873 gccaccgccaccgccaccgcca 1894 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 1879 gccaccgccaccgccaccgcc 1899
>emb|AJ431665.1|CRE431665 Chlamydomonas reinhardtii lrg6 gene for putative transporter, exons 1-11 Length = 6720 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5282 gccaccgccaccgccaccgcca 5303 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5288 gccaccgccaccgccaccgcc 5308
>gb|AC161602.4| Mus musculus BAC clone RP23-336I5 from chromosome 6, complete sequence Length = 224158 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 189048 gccaccgccaccgccaccgcca 189027
>gb|AC134399.12| Mus musculus chromosome 5, clone RP24-282I19, complete sequence Length = 155228 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 87299 gccaccgccaccgccaccgcca 87320 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 87295 caccgccaccgccaccgcca 87314
>emb|CR753892.5| Human DNA sequence from clone DADB-70P7 on chromosome 6, complete sequence Length = 101422 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 77816 gccaccgccaccgccaccgcca 77795
>gb|AC092316.5| Homo sapiens chromosome 19 clone LLNLR-309F9, complete sequence Length = 36246 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 24011 gccaccgccaccgccaccgcca 23990 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 24005 gccaccgccaccgccaccgcca 23984 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 23999 gccaccgccaccgccaccgcca 23978 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 24015 caccgccaccgccaccgcca 23996
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0080O10, from chromosome 3, complete sequence Length = 127917 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 35621 gccaccgccaccgccaccgcca 35600 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 35626 ccaccgccaccgccaccgcca 35606 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 35615 gccaccgccaccgccaccgcc 35595
>dbj|AB254812.1| Cryptomeria japonica mRNA for putative ORFX, complete cds Length = 885 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 149 gccaccgccaccgccaccgcca 170 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 155 gccaccgccaccgccaccgcc 175
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAb0079B22, from chromosome 3, complete sequence Length = 156933 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 132554 gccaccgccaccgccaccgcca 132533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 132559 ccaccgccaccgccaccgcca 132539 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 132548 gccaccgccaccgccaccgcc 132528
>dbj|AK075169.1| Homo sapiens cDNA FLJ90688 fis, clone PLACE1006208, highly similar to Homo sapiens nGAP mRNA Length = 1914 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 70 gccaccgccaccgccaccgcca 91 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 76 gccaccgccaccgccaccgcc 96
>emb|CR597233.1| full-length cDNA clone CS0DK001YL13 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 2307 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 202 gccaccgccaccgccaccgcca 181 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 196 gccaccgccaccgccaccgcca 175 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 190 gccaccgccaccgccaccgcc 170
>gb|AE011703.1| Xanthomonas axonopodis pv. citri str. 306, section 81 of 469 of the complete genome Length = 11430 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6039 gccaccgccaccgccaccgcca 6060 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6033 gccaccgccaccgccaccgcca 6054 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6027 gccaccgccaccgccaccgcca 6048 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6021 gccaccgccaccgccaccgcca 6042 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6015 gccaccgccaccgccaccgcca 6036 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 6009 gccaccgccaccgccaccgcca 6030 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5595 gccaccgccaccgccaccgcca 5616 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 6045 gccaccgccaccgccaccgcc 6065 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5601 gccaccgccaccgccaccgcc 5621 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 2853 gccaccgccaccgccaccgcc 2873
>emb|BX000345.4|CNS08CDB Oryza sativa chromosome 12, . BAC OSJNBb0111J10 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 128678 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 98874 gccaccgccaccgccaccgcca 98853
>gb|AE012283.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 191 of 460 of the complete genome Length = 11449 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3329 gccaccgccaccgccaccgcca 3308 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3323 gccaccgccaccgccaccgcca 3302 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3317 gccaccgccaccgccaccgcca 3296
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3628845 gccaccgccaccgccaccgcca 3628824 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 3628850 ccaccgccaccgccaccgcca 3628830 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgc 53 ||||||||||||||||||||| Sbjct: 1715365 tgccaccgccaccgccaccgc 1715385
>gb|AC079935.3| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar Nipponbare clone OSJNBa0095C06, from Chromosome 10, complete sequence Length = 156159 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 55036 gccaccgccaccgccaccgcca 55057 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 55042 gccaccgccaccgccaccgcc 55062
>gb|AC036176.8| Homo sapiens chromosome 18, clone RP11-635N19, complete sequence Length = 173252 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 161390 gccaccgccaccgccaccgcca 161369
>gb|U78308.2|HSU78308 Human olfactory receptor olfr17-201-1 (OR17-201-1) gene, olfactory receptor olfr17-32 (OR17-32) gene and olfactory receptor pseudo_olfr17-01 (OR17-01) pseudogene, complete cds Length = 38960 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 37686 gccaccgccaccgccaccgcca 37707
>ref|XM_938233.1| PREDICTED: Homo sapiens similar to Splicing factor U2AF 35 kDa subunit (U2 auxiliary factor 35 kDa subunit) (U2 snRNP auxiliary factor small subunit) (LOC649163), mRNA Length = 1222 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1144 gccaccgccaccgccaccgcca 1123
>ref|XM_497450.2| PREDICTED: Homo sapiens similar to Splicing factor U2AF 35 kDa subunit (U2 auxiliary factor 35 kDa subunit) (U2 snRNP auxiliary factor small subunit) (LOC441722), mRNA Length = 1222 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1150 gccaccgccaccgccaccgcca 1129 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 1144 gccaccgccaccgccaccgcca 1123
>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome Length = 2679306 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 10909 gccaccgccaccgccaccgcca 10930 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 10904 ccaccgccaccgccaccgcca 10924
>dbj|AK158820.1| Mus musculus visual cortex cDNA, RIKEN full-length enriched library, clone:K430335F13 product:formin-like 1, full insert sequence Length = 2831 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 934 tgccaccgccaccgccaccgcc 955
>gb|AC021231.8| Homo sapiens chromosome , clone RP11-323I15, complete sequence Length = 185062 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 94445 gccaccgccaccgccaccgcca 94424 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 94439 gccaccgccaccgccaccgcca 94418
>gb|AC152413.5| Mus musculus BAC clone RP23-431A21 from chromosome 10, complete sequence Length = 195951 Score = 44.1 bits (22), Expect = 0.44 Identities = 28/30 (93%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgccaactccc 61 ||||||||||| |||||||||||| ||||| Sbjct: 94106 ctgccaccgccgccgccaccgccacctccc 94135
>gb|AY517905.1| Salmonella enterica strain OU7025 plasmid pOU1113, complete sequence Length = 80156 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 3451 tgccaccgccaccgccaccgcc 3472
>gb|DQ099569.1| Taenia pisiformis isolate KAP218 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 538 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 334 gccaccgccaccgccaccgcca 313
>gb|DQ099568.1| Taenia pisiformis isolate KAP221 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 543 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 343 gccaccgccaccgccaccgcca 322 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 337 gccaccgccaccgccaccgc 318
>gb|DQ099566.1| Taenia pisiformis isolate KAP703 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 556 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 352 gccaccgccaccgccaccgcca 331 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 346 gccaccgccaccgccaccgc 327
>gb|AY155576.1| Bordetella avium strain 197N ABC transporter gene, partial cds; and adhesin FhaB (fhaB), complete cds; fimbrial gene cluster, complete sequence; and FHA accessory protein FhaC (fhaC) gene, complete cds Length = 16356 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 7925 gccaccgccaccgccaccgcca 7946 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 7919 gccaccgccaccgccaccgcca 7940 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 7931 gccaccgccaccgccaccgcc 7951
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 2874193 gccaccgccaccgccaccgcca 2874214
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 769072 gccaccgccaccgccaccgcca 769051 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 769066 gccaccgccaccgccaccgcca 769045 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 769060 gccaccgccaccgccaccgcc 769040
>ref|NG_002302.1| Homo sapiens olfactory receptor, family 1, subfamily R, member 1 pseudogene (OR1R1P) on chromosome 17 Length = 1239 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 940 gccaccgccaccgccaccgcca 919
>tpg|BK004550.1| TPA: TPA_exp: Homo sapiens olfactory receptor OR17-21 pseudogene, complete sequence Length = 1037 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 841 gccaccgccaccgccaccgcca 820
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 390074 gccaccgccaccgccaccgcca 390095 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 390080 gccaccgccaccgccaccgcc 390100
>gb|AC152954.1| Mus musculus 6 BAC RP23-296N5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203474 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 84398 gccaccgccaccgccaccgcca 84419 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 84392 gccaccgccaccgccaccgcca 84413 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 84386 gccaccgccaccgccaccgcca 84407 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 84380 gccaccgccaccgccaccgcca 84401
>gb|AC084404.8|AC084404 Oryza sativa chromosome 3 BAC OSJNBa0026A15 genomic sequence, complete sequence Length = 156929 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5885 gccaccgccaccgccaccgcca 5906
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 24066571 gccaccgccaccgccaccgcca 24066592 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21270720 gccaccgccaccgccaccgcca 21270699 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 13991588 ctgccaccgccaccgccaccgc 13991567 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4476683 gccaccgccaccgccaccgcca 4476704 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21270714 gccaccgccaccgccaccgcc 21270694 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 6030033 gccaccgccaccgccaccgcc 6030053 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 4476689 gccaccgccaccgccaccgcc 4476709 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 4476678 ccaccgccaccgccaccgcca 4476698 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 21770246 ccaccgccaccgccaccgcc 21770227 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 3294570 gccaccgccaccgccaccgc 3294589
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 22302962 gccaccgccaccgccaccgcca 22302941 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 18702028 gccaccgccaccgccaccgcca 18702049 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 18186470 gccaccgccaccgccaccgcca 18186449 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 17425626 gccaccgccaccgccaccgcca 17425605 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 11471043 gccaccgccaccgccaccgcca 11471064 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 22310106 gccaccgccaccgccaccgcc 22310086 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 22302967 ccaccgccaccgccaccgcca 22302947 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 15915235 ccaccgccaccgccaccgcca 15915255 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 14936949 ccaccgccaccgccaccgcca 14936929 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 14936944 gccaccgccaccgccaccgcc 14936924 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11471049 gccaccgccaccgccaccgcc 11471069 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 18930649 ccaccgccaccgccaccgcc 18930630 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgcca 55 |||||||||||||||||| ||||| Sbjct: 13929521 ctgccaccgccaccgccatcgcca 13929544
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 29405627 gccaccgccaccgccaccgcca 29405606 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 16840557 gccaccgccaccgccaccgcca 16840536 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4613883 gccaccgccaccgccaccgcca 4613904 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3710341 gccaccgccaccgccaccgcca 3710362 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 26246478 gccaccgccaccgccaccgcc 26246458 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21323621 gccaccgccaccgccaccgcc 21323641 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 21323616 ccaccgccaccgccaccgcca 21323636 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgccaactccctcc 64 ||||||| ||||| ||||||||||||||| Sbjct: 14614721 caccgccgccgccgccgccaactccctcc 14614693 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 12230713 ccaccgccaccgccaccgcca 12230693 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 4922164 gccaccgccaccgccaccgcc 4922184 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 4922159 ccaccgccaccgccaccgcca 4922179 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 4613889 gccaccgccaccgccaccgcc 4613909 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 3710347 gccaccgccaccgccaccgcc 3710367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 2910239 gccaccgccaccgccaccgcc 2910259 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||| |||||||||||||||||| Sbjct: 29405635 ctgccgccgccaccgccaccgcca 29405612 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 16840478 ccaccgccaccgccaccgcc 16840459 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 9109453 gccaccgccaccgccaccgc 9109472 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 9109449 caccgccaccgccaccgcca 9109468 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 7791032 gccaccgccaccgccaccgc 7791051 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 2070457 caccgccaccgccaccgcca 2070438
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 28804094 gccaccgccaccgccaccgcca 28804115 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21477270 gccaccgccaccgccaccgcca 21477249 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 12275295 gccaccgccaccgccaccgcca 12275274 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 246712 gccaccgccaccgccaccgcca 246691 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 27970312 gccaccgccaccgccaccgcc 27970332 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 12275289 gccaccgccaccgccaccgcc 12275269 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 28804100 gccaccgccaccgccaccgc 28804119 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 28453150 ccaccgccaccgccaccgcc 28453169 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 cgccaccgccaccgccaact 58 |||||||||||||||||||| Sbjct: 13648249 cgccaccgccaccgccaact 13648268 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 3180585 ccaccgccaccgccaccgcc 3180566 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 2965591 ccaccgccaccgccaccgcc 2965610
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgccaactccctccgcg 67 ||||||||||||||||| ||| ||||||||||| Sbjct: 35116158 gccaccgccaccgccacggccccctccctccgcg 35116191 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 35116152 gccaccgccaccgccaccgcca 35116173 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 32645468 ctgccaccgccaccgccaccgc 32645489 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 21501988 gccaccgccaccgccaccgcca 21502009 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 20203605 gccaccgccaccgccaccgcca 20203626 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 5626558 gccaccgccaccgccaccgcca 5626537 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 198554 gccaccgccaccgccaccgcca 198533 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 34145457 gccaccgccaccgccaccgcc 34145437 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 29169248 gccaccgccaccgccaccgcc 29169268 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 23086049 ccaccgccaccgccaccgcca 23086029 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 23086044 gccaccgccaccgccaccgcc 23086024 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 13786466 gccaccgccaccgccaccgcc 13786486 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11679570 gccaccgccaccgccaccgcc 11679590 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 11679565 ccaccgccaccgccaccgcca 11679585 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11679476 gccaccgccaccgccaccgcc 11679496 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 11679471 ccaccgccaccgccaccgcca 11679491 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5626552 gccaccgccaccgccaccgcc 5626532 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 198559 ccaccgccaccgccaccgcca 198539 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 198548 gccaccgccaccgccaccgcc 198528 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 31649745 ccaccgccaccgccaccgcc 31649764 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 30728396 gccaccgccaccgccaccgc 30728415 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 42 caccgccaccgccaactccctccgcgcc 69 |||||||||| |||||||||||||||| Sbjct: 29076119 caccgccacctacaactccctccgcgcc 29076092 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 20894209 caccgccaccgccaccgcca 20894228 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 9970342 gccaccgccaccgccaccgc 9970361 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 5588123 gccaccgccaccgccaccgc 5588104 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 600059 gccaccgccaccgccaccgc 600078
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 34906851 gccaccgccaccgccaccgcca 34906872 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 34786355 gccaccgccaccgccaccgcca 34786376 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgccaactcc 60 |||||||||||||||||||| ||||| Sbjct: 32692266 ccaccgccaccgccaccgcctactcc 32692241 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 31830004 gccaccgccaccgccaccgcca 31830025 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 201 cgccctcccgcctccgccggcg 222 |||||||||||||||||||||| Sbjct: 29964417 cgccctcccgcctccgccggcg 29964396 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 27779073 tgccaccgccaccgccaccgcc 27779094 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 27137000 gccaccgccaccgccaccgcca 27136979 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 11884758 gccaccgccaccgccaccgcca 11884737 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 10522548 gccaccgccaccgccaccgcca 10522527 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 10522542 gccaccgccaccgccaccgcca 10522521 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 425950 ctgccaccgccaccgccaccgc 425929 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 33801978 gccaccgccaccgccaccgcc 33801998 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 30452520 ccaccgccaccgccaccgcca 30452500 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 30452515 gccaccgccaccgccaccgcc 30452495 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 27136994 gccaccgccaccgccaccgcc 27136974 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 25702058 gccaccgccaccgccaccgcc 25702038 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 22595561 gccaccgccaccgccaccgcc 22595581 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 21069623 gccaccgccaccgccaccgcc 21069603 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgccaactcc 60 |||||||||||||||||||| ||| |||| Sbjct: 19955655 ctgccaccgccaccgccacctccacctcc 19955683 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 11884752 gccaccgccaccgccaccgcc 11884732 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 10947375 gccaccgccaccgccaccgcc 10947395 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 35802027 ccaccgccaccgccaccgcc 35802008 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 31830010 gccaccgccaccgccaccgc 31830029 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 ccgccaccgccaccgccaac 57 |||||||||||||||||||| Sbjct: 25823086 ccgccaccgccaccgccaac 25823067 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 22608805 ccaccgccaccgccaccgcc 22608824
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 30415840 gccaccgccaccgccaccgcca 30415819 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 30206269 gccaccgccaccgccaccgcca 30206290 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 27054672 gccaccgccaccgccaccgcca 27054693 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 3721900 gccaccgccaccgccaccgcca 3721921 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 39771028 gccaccgccaccgccaccgcc 39771048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 36039244 gccaccgccaccgccaccgcc 36039264 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 30578887 ccaccgccaccgccaccgcca 30578907 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 27054678 gccaccgccaccgccaccgcc 27054698 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 cctgccaccgccaccgccacc 51 ||||||||||||||||||||| Sbjct: 27019137 cctgccaccgccaccgccacc 27019117 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 9518756 gccaccgccaccgccaccgcc 9518776 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 6662504 gccaccgccaccgccaccgcc 6662524 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 40324396 gccaccgccaccgccaccgc 40324377 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 36660815 caccgccaccgccaccgcca 36660834 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 ccgccaccgccaccgccaac 57 |||||||||||||||||||| Sbjct: 35705349 ccgccaccgccaccgccaac 35705330 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 30578892 gccaccgccaccgccaccgc 30578911 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 caccgccaccgccaccgcca 55 |||||||||||||||||||| Sbjct: 27054668 caccgccaccgccaccgcca 27054687 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 21415024 ccaccgccaccgccaccgcc 21415005 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 20702934 gccaccgccaccgccaccgc 20702953 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 13309677 ccaccgccaccgccaccgcc 13309696 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 3804020 ccaccgccaccgccaccgcc 3804001
>gb|AC016993.4|AC016993 Homo sapiens clone RP11-18J9, complete sequence Length = 172241 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 114799 gccaccgccaccgccaccgcca 114778 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 114793 gccaccgccaccgccaccgcca 114772 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 114804 ccaccgccaccgccaccgcca 114784
>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome Length = 335593 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 227064 gccaccgccaccgccaccgcca 227043 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 224454 gccaccgccaccgccaccgcca 224433 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 224448 gccaccgccaccgccaccgcca 224427 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 224442 gccaccgccaccgccaccgcca 224421 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 32 ctgccaccgccaccgccaccgcca 55 ||||| |||||||||||||||||| Sbjct: 224414 ctgcccccgccaccgccaccgcca 224391
>gb|AC009267.15|AC009267 Homo sapiens chromosome 18, clone RP11-495C15, complete sequence Length = 188923 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 81065 gccaccgccaccgccaccgcca 81086
>gb|AC060755.9|AC060755 Oryza sativa chromosome 10 BAC OSJNBa0003O19 genomic sequence, complete sequence Length = 172427 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 120205 gccaccgccaccgccaccgcca 120184 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 127349 gccaccgccaccgccaccgcc 127329 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 120210 ccaccgccaccgccaccgcca 120190
>dbj|AK131173.1| Mus musculus mRNA for mFLJ00304 protein Length = 2910 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 1107 tgccaccgccaccgccaccgcc 1128
>gb|U47924.1|HSU47924 Human chromosome 12p13 sequence, complete sequence Length = 222930 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 126619 gccaccgccaccgccaccgcca 126640
>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0022F10 Length = 150498 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 111091 gccaccgccaccgccaccgcca 111112
>gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055P24 genomic sequence, complete sequence Length = 134058 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 54621 gccaccgccaccgccaccgcca 54600
>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0583G08 Length = 135295 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 130380 gccaccgccaccgccaccgcca 130401
>dbj|AP003142.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0435H01 Length = 160141 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 44103 gccaccgccaccgccaccgcca 44082
>dbj|AP002899.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0456A01 Length = 143710 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 101567 gccaccgccaccgccaccgcca 101546
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 4390184 gccaccgccaccgccaccgcca 4390205 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 5146067 gccaccgccaccgccaccgcc 5146087 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 4390179 ccaccgccaccgccaccgcca 4390199 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 1147913 ccaccgccaccgccaccgcca 1147893 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 275936 gccaccgccaccgccaccgcc 275956 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 4390190 gccaccgccaccgccaccgc 4390209 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcc 54 |||||||||||||||||||| Sbjct: 3453663 ccaccgccaccgccaccgcc 3453682
>gb|AC124243.3| Homo sapiens chromosome 8, clone CTD-3077F2, complete sequence Length = 188240 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 184622 gccaccgccaccgccaccgcca 184643 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 184628 gccaccgccaccgccaccgcc 184648
>gb|AC087096.11| Oryza sativa chromosome 3 BAC OSJNBa0087O09 genomic sequence, complete sequence Length = 119134 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 32 ctgccaccgccaccgccaccgc 53 |||||||||||||||||||||| Sbjct: 88407 ctgccaccgccaccgccaccgc 88428
>gb|AF006466.1|AF006466 Mus musculus lymphocyte specific formin related protein (Fr1) mRNA, complete cds Length = 3195 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 1718 tgccaccgccaccgccaccgcc 1739
>gb|AF215666.1|AF215666 Mus musculus formin-like protein mRNA, partial cds Length = 3282 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 tgccaccgccaccgccaccgcc 54 |||||||||||||||||||||| Sbjct: 1796 tgccaccgccaccgccaccgcc 1817
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence Length = 162241 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 64102 gccaccgccaccgccaccgcca 64123 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 64108 gccaccgccaccgccaccgcc 64128 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ccaccgccaccgccaccgcca 55 ||||||||||||||||||||| Sbjct: 64097 ccaccgccaccgccaccgcca 64117
>gb|AC093128.3| Papio anubis clone RP41-374D15, complete sequence Length = 135622 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 98943 gccaccgccaccgccaccgcca 98964 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 98937 gccaccgccaccgccaccgcca 98958 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 98931 gccaccgccaccgccaccgcca 98952 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 98949 gccaccgccaccgccaccgcc 98969
>gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0014O06, complete sequence Length = 168031 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 91044 gccaccgccaccgccaccgcca 91023 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 91038 gccaccgccaccgccaccgcc 91018 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgc 53 |||||||||||||||||||| Sbjct: 52607 gccaccgccaccgccaccgc 52588
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region Length = 2229817 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 323091 gccaccgccaccgccaccgcca 323112
>dbj|AP003753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1339_B08 Length = 119212 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 79223 gccaccgccaccgccaccgcca 79244 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 gccaccgccaccgccaccgcc 54 ||||||||||||||||||||| Sbjct: 79229 gccaccgccaccgccaccgcc 79249
>dbj|AB062910.1| Physcomitrella patens PpGRP2 mRNA for glycine-rich RNA-binding protein, complete cds Length = 1338 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 gccaccgccaccgccaccgcca 55 |||||||||||||||||||||| Sbjct: 610 gccaccgccaccgccaccgcca 589 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,523,778 Number of Sequences: 3902068 Number of extensions: 4523778 Number of successful extensions: 128502 Number of sequences better than 10.0: 1171 Number of HSP's better than 10.0 without gapping: 1241 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 113579 Number of HSP's gapped (non-prelim): 13841 length of query: 504 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 482 effective length of database: 17,147,199,772 effective search space: 8264950290104 effective search space used: 8264950290104 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)