>gb|AC154777.2| Mus musculus BAC clone RP24-459H24 from 14, complete sequence
          Length = 155730

 Score = 40.1 bits (20), Expect = 0.50
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     tttggtttccggttttcttt 47
              ||||||||||||||||||||
Sbjct: 125449 tttggtttccggttttcttt 125430

>gb|AY248742.1| Lycopersicon esculentum omega-3 fatty acid desaturase gene, complete
             cds; nuclear gene for chloroplast product
          Length = 43170

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 23    ccacatttggtttccggttttct 45
             ||||||||||||||||| |||||
Sbjct: 43090 ccacatttggtttccggctttct 43112

>emb|BX927185.15| Zebrafish DNA sequence from clone CH211-198G1 in linkage group 8,
             complete sequence
          Length = 123568

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 45164 ttttgatgccacatttgctttc 45185

>emb|BX901957.4| Zebrafish DNA sequence from clone CH211-150G5 in linkage group 15,
             complete sequence
          Length = 175019

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 67906 ttttgatgccacatttgctttc 67927

>emb|Z99196.1|SPZ99196 Streptococcus parasanguis partial sodA gene
          Length = 417

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 239 ttgatgccacatttggtt 256

>emb|BX957299.8| Zebrafish DNA sequence from clone DKEY-179E8 in linkage group 19,
             complete sequence
          Length = 168017

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 42944 ttttgatgccacatttgctttc 42965

>emb|CR536621.7| Zebrafish DNA sequence from clone CH211-158M1, complete sequence
          Length = 155945

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 82141 ttttgatgccacatttgctttc 82120

>emb|CR376838.7| Zebrafish DNA sequence from clone DKEY-15F23 in linkage group 14,
              complete sequence
          Length = 256006

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 15     ttttgatgccacatttggtttc 36
              ||||||||||||||||| ||||
Sbjct: 236456 ttttgatgccacatttgctttc 236477

>emb|BX649451.4| Zebrafish DNA sequence from clone DKEY-206M7 in linkage group 10,
             complete sequence
          Length = 97299

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 26679 ttttgatgccacatttgctttc 26700

>emb|BX950205.10| Zebrafish DNA sequence from clone CH211-226H8 in linkage group 22,
              complete sequence
          Length = 198379

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 15     ttttgatgccacatttggtttc 36
              ||||||||||||||||| ||||
Sbjct: 154109 ttttgatgccacatttgctttc 154130

>emb|BX511196.11| Zebrafish DNA sequence from clone RP71-14I8 in linkage group 5,
             complete sequence
          Length = 143654

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 90797 ttttgatgccacatttgctttc 90818

>emb|BX640522.13| Zebrafish DNA sequence from clone CH211-257O19 in linkage group 15,
             complete sequence
          Length = 154564

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 10585 ttttgatgccacatttgctttc 10564

>gb|AC011647.9| Homo sapiens chromosome 11, clone RP11-15D18, complete sequence
          Length = 143897

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 31    ggtttccggttttcttta 48
             ||||||||||||||||||
Sbjct: 50338 ggtttccggttttcttta 50355

>ref|NM_143432.2| Drosophila melanogaster CG31445-PA (CG31445) mRNA, complete cds
          Length = 3034

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 19   gatgccacatttggtttccggt 40
            ||||||||||||| ||||||||
Sbjct: 2409 gatgccacatttgatttccggt 2388

>gb|AC015691.6| Homo sapiens chromosome , clone RP11-54F1, complete sequence
          Length = 203036

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 31     ggtttccggttttcttta 48
              ||||||||||||||||||
Sbjct: 106228 ggtttccggttttcttta 106245

>dbj|AB200134.1| Streptococcus parasanguinis gene for manganese dependent superoxide
           dismutase, partial cds
          Length = 390

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229

>dbj|AB200133.1| Streptococcus parasanguinis gene for manganese dependent superoxide
           dismutase, partial cds
          Length = 390

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229

>dbj|AB200131.1| Streptococcus parasanguinis gene for manganese dependent superoxide
           dismutase, partial cds
          Length = 390

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229

>gb|AY060643.1| Drosophila melanogaster GH07390 full length cDNA
          Length = 3033

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 19   gatgccacatttggtttccggt 40
            ||||||||||||| ||||||||
Sbjct: 2389 gatgccacatttgatttccggt 2368

>emb|BX005328.9| Zebrafish DNA sequence from clone DKEY-63D15 in linkage group 8,
             complete sequence
          Length = 272840

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 15    ttttgatgccacatttggtttc 36
             ||||||||||||||||| ||||
Sbjct: 95813 ttttgatgccacatttgctttc 95792

>gb|AC007855.5|AC007855 Drosophila melanogaster, chromosome 3R, region 98F-99A, BAC clone
              BACR22E21, complete sequence
          Length = 183576

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 19     gatgccacatttggtttccggt 40
              ||||||||||||| ||||||||
Sbjct: 136877 gatgccacatttgatttccggt 136898

>gb|AC069160.7|AC069160 Arabidopsis thaliana chromosome 1 BAC T9I1 genomic sequence, complete
            sequence
          Length = 99241

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 28   tttggtttccggttttctttag 49
            ||||||||||||||||| ||||
Sbjct: 5950 tttggtttccggttttcattag 5971

>emb|AL954138.8| Zebrafish DNA sequence from clone CH211-108D22, complete sequence
          Length = 183082

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 15     ttttgatgccacatttggtttc 36
              ||||||||||||||||| ||||
Sbjct: 141338 ttttgatgccacatttgctttc 141359

>gb|AY618417.1| Maize fine streak virus, complete genome
          Length = 13782

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 19   gatgccacatttggtttc 36
            ||||||||||||||||||
Sbjct: 9518 gatgccacatttggtttc 9535

>gb|AE003768.2| Drosophila melanogaster chromosome 3R, section 106 of 118 of the complete
              sequence
          Length = 243118

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 19     gatgccacatttggtttccggt 40
              ||||||||||||| ||||||||
Sbjct: 208549 gatgccacatttgatttccggt 208570

>emb|BX908759.27| Zebrafish DNA sequence from clone DKEY-27J5 in linkage group 1,
            complete sequence
          Length = 231898

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 15   ttttgatgccacatttggtttc 36
            ||||||||||||||||| ||||
Sbjct: 1899 ttttgatgccacatttgctttc 1878

>emb|CR385050.10| Zebrafish DNA sequence from clone DKEY-22I16 in linkage group 1, complete
              sequence
          Length = 145760

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 15     ttttgatgccacatttggtttc 36
              ||||||||||||||||| ||||
Sbjct: 100338 ttttgatgccacatttgctttc 100317

>dbj|AB021636.1| Streptococcus parasanguis gene for Manganese dependent superoxide
           dismutase, partial cds
          Length = 366

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229

>dbj|AB021635.1| Streptococcus parasanguis gene for Manganese dependent superoxide
           dismutase, partial cds
          Length = 366

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229

>dbj|AB021633.1| Streptococcus parasanguis gene for Manganese dependent superoxide
           dismutase, partial cds
          Length = 366

 Score = 36.2 bits (18), Expect = 7.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  ttgatgccacatttggtt 34
           ||||||||||||||||||
Sbjct: 212 ttgatgccacatttggtt 229


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 409,942
Number of Sequences: 3902068
Number of extensions: 409942
Number of successful extensions: 106880
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106837
Number of HSP's gapped (non-prelim): 43
length of query: 55
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 35
effective length of database: 17,155,003,908
effective search space: 600425136780
effective search space used: 600425136780
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)