Clone Name	bastl24c12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY314060.1| HIV-1 isolate WC10C-9 from USA, complete genome	46	0.073
2	gb|AY314057.1| HIV-1 isolate WC10C-5 from USA, complete genome	46	0.073
3	gb|AF061642.1|AF061642 HIV-1 isolate SE6165 from Sweden, complet...	46	0.073
4	gb|AY451097.1| HIV-1 isolate B97X9/30 from USA gag protein (gag)...	44	0.29
5	gb|AY161881.1| HIV-1 isolate 00PTHDF2 from Portugal gag protein ...	42	1.1
6	gb|AY456324.1| HIV-1 isolate 01AOHDC232 from Angola gag protein ...	42	1.1
7	gb|AY528646.1| Synthetic construct HIV-1 derived gag protein (ga...	40	4.5
8	gb|AY817688.1| HIV-1 isolate 2102 from Sweden 5' LTR and gag pro...	40	4.5
9	gb|AY314063.1| HIV-1 isolate WC10C-12 from USA, complete genome	40	4.5
10	gb|AY314062.1| HIV-1 isolate WC10C-11 from USA, complete genome	40	4.5
11	gb|AY314061.1| HIV-1 isolate WC10C-10 from USA, complete genome	40	4.5
12	gb|AY314059.1| HIV-1 isolate WC10C-8 from USA, complete genome	40	4.5
13	gb|AY314058.1| HIV-1 isolate WC10C-6 from USA, complete genome	40	4.5
14	gb|AY314056.1| HIV-1 isolate WC10C-4 from USA, complete genome	40	4.5
15	gb|AY314055.1| HIV-1 isolate WC10C-3 from USA, complete genome	40	4.5
16	gb|AY314054.1| HIV-1 isolate WC10C-1 from USA, complete genome	40	4.5
17	gb|AY314053.1| HIV-1 isolate WC10P-11 from USA, complete genome	40	4.5
18	gb|AY314052.1| HIV-1 isolate WC10P-10 from USA, complete genome	40	4.5
19	gb|AY314051.1| HIV-1 isolate WC10P-9 from USA, complete genome	40	4.5
20	gb|AY314050.1| HIV-1 isolate WC10P-8 from USA, complete genome	40	4.5
21	gb|AY314049.1| HIV-1 isolate WC10P-7 from USA, complete genome	40	4.5
22	gb|AY314048.1| HIV-1 isolate WC10P-6 from USA, complete genome	40	4.5
23	gb|AY314047.1| HIV-1 isolate WC10P-4 from USA, complete genome	40	4.5
24	gb|AY314046.1| HIV-1 isolate WC10P-3 from USA, complete genome	40	4.5
25	gb|AY314045.1| HIV-1 isolate WC10P-2 from USA, complete genome	40	4.5
26	gb|AY314044.1| HIV-1 isolate WC10P-1 from USA, complete genome	40	4.5
27	gb|AY819715.1| HIV-1 isolate 04RU139095 from Russia, complete ge...	40	4.5
28	gb|AY772986.1| HIV-1 clone M428gag from Kenya gag protein (gag) ...	40	4.5
29	gb|AY772984.1| HIV-1 clone M389_clone11 from Kenya nonfunctional...	40	4.5
30	gb|AY772983.1| HIV-1 clone M389_clone5 from Kenya gag protein (g...	40	4.5
31	gb|AY772982.1| HIV-1 clone M389_clone9 from Kenya gag protein (g...	40	4.5
32	gb|AY772981.1| HIV-1 clone M389_clone23 from Kenya gag protein (...	40	4.5
33	gb|AY772980.1| HIV-1 clone M389_16 from Kenya nonfunctional gag ...	40	4.5
34	gb|AY772979.1| HIV-1 clone M389_clone10 from Kenya gag protein (...	40	4.5
35	gb|AY772976.1| HIV-1 clone M389_clone35 from Kenya gag protein (...	40	4.5
36	gb|AY772975.1| HIV-1 clone M389_clone22 from Kenya gag protein (...	40	4.5
37	gb|AY772974.1| HIV-1 clone M389_clone20 from Kenya gag protein (...	40	4.5
38	gb|AY772973.1| HIV-1 clone M389_clone17 from Kenya gag protein (...	40	4.5
39	gb|AY772971.1| HIV-1 clone M369gag from Kenya gag protein (gag) ...	40	4.5
40	gb|AY772970.1| HIV-1 clone M264_gag from Kenya gag protein (gag)...	40	4.5
41	gb|AY772955.1| HIV-1 clone M141gag from Kenya gag protein (gag) ...	40	4.5
42	gb|DQ234790.1| HIV-1 isolate HK001 from Hong Kong, complete genome	40	4.5
43	gb|AY818644.1| HIV-1 isolate Phcsffull04 from Australia, complet...	40	4.5
44	gb|AY818643.1| HIV-1 isolate Ph01full from Australia, complete g...	40	4.5
45	gb|AY818642.1| HIV-1 isolate Ph99full from Australia, complete g...	40	4.5
46	gb|AY818641.1| HIV-1 isolate Ph00full from Australia, complete g...	40	4.5
47	gb|AY968312.1| HIV-1 isolate ARE195FL from Argentina, complete g...	40	4.5
48	gb|DQ149132.1| HIV-1 isolate IR-176-2 from Iran nonfunctional ga...	40	4.5
49	gb|DQ149131.1| HIV-1 isolate IR-176-1-r from Iran nonfunctional ...	40	4.5
50	gb|DQ149130.1| HIV-1 isolate IR-176-1 from Iran gag protein (gag...	40	4.5
51	gb|DQ149129.1| HIV-1 isolate IR-176-5-n-r from Iran nonfunctiona...	40	4.5
52	gb|DQ149128.1| HIV-1 isolate IR-176-5-n from Iran nonfunctional ...	40	4.5
53	gb|AY751407.1| HIV-1 isolate 04RU139089 from Russia, complete ge...	40	4.5
54	gb|AY751406.1| HIV-1 isolate 04RU129005 from Russia, complete ge...	40	4.5
55	gb|AY779564.1| HIV-1 isolate CANA1FULL from Canada, complete genome	40	4.5
56	gb|AY779563.1| HIV-1 isolate CANC8FULL from Canada, complete genome	40	4.5
57	gb|AY779562.1| HIV-1 isolate CANC6FULL from Canada, complete genome	40	4.5
58	gb|AY779561.1| HIV-1 isolate CANC5FULL from Canada, complete genome	40	4.5
59	gb|AY779560.1| HIV-1 isolate CANC3FULL from Canada, complete genome	40	4.5
60	gb|AY779557.1| HIV-1 isolate CANC10FULL from Canada, complete ge...	40	4.5
61	gb|AY779555.1| HIV-1 isolate CANB5FULL from Canada, complete genome	40	4.5
62	gb|AY779553.1| HIV-1 isolate CANB3FULL from Canada, complete genome	40	4.5
63	gb|AY779552.1| HIV-1 isolate CANA6FULL from Canada, complete genome	40	4.5
64	gb|AY779551.1| HIV-1 isolate CANA5FULL from Canada, complete genome	40	4.5
65	gb|AY779550.1| HIV-1 isolate CANA3FULL from Canada, complete genome	40	4.5
66	gb|AY118161.1| HIV-1 isolate 93CB76 from the Caribbean, 5'UTR	40	4.5
67	gb|AY118160.1| HIV-1 isolate 94BR77 from Brazil, 5'UTR	40	4.5
68	gb|AY118158.1| HIV-1 isolate 93ZM45 from Zambia gag protein (gag...	40	4.5
69	gb|AY118156.1| HIV-1 isolate 94LB12 from Liberia, 5'UTR	40	4.5
70	gb|AY118155.1| HIV-1 isolate 97TH87 from Thailand, 5'UTR	40	4.5
71	gb|AY118154.1| HIV-1 isolate 93UG66 from Uganda gag protein (gag...	40	4.5
72	gb|AY703911.1| HIV-1 isolate 04ZASK144B1 from South Africa, comp...	40	4.5
73	gb|AY703910.1| HIV-1 isolate 04ZASK143B1 from South Africa, comp...	40	4.5
74	gb|AY703909.1| HIV-1 isolate 04ZASK134B1 from South Africa, comp...	40	4.5
75	gb|AY508158.1| HIV-1 isolate 8-H11 from USA gag protein (gag) ge...	40	4.5
76	gb|AY508157.1| HIV-1 isolate 8-G7 from USA nonfunctional gag pro...	40	4.5
77	gb|AY508156.1| HIV-1 isolate 8-G12 from USA nonfunctional gag pr...	40	4.5
78	gb|AY508155.1| HIV-1 isolate 8-G11 from USA nonfunctional gag pr...	40	4.5
79	gb|AY508154.1| HIV-1 isolate 8-F9 from USA gag protein (gag) gen...	40	4.5
80	gb|AY508153.1| HIV-1 isolate 8-F5 from USA gag protein (gag) gen...	40	4.5
81	gb|AY508152.1| HIV-1 isolate 8-E7 from USA nonfunctional gag pro...	40	4.5
82	gb|AY508151.1| HIV-1 isolate 8-E3 from USA gag protein (gag) gen...	40	4.5
83	gb|AY508150.1| HIV-1 isolate 8-D11 from USA gag protein (gag) ge...	40	4.5
84	gb|AY508149.1| HIV-1 isolate 8-C7 from USA nonfunctional gag pro...	40	4.5
85	gb|AY508148.1| HIV-1 isolate 8-C1 from USA nonfunctional gag pro...	40	4.5
86	gb|AY508147.1| HIV-1 isolate 8-B9 from USA gag protein (gag) gen...	40	4.5
87	gb|AY508146.1| HIV-1 isolate 8-B8 from USA gag protein (gag) gen...	40	4.5
88	gb|AY508144.1| HIV-1 isolate 8-B12 from USA gag protein (gag) ge...	40	4.5
89	gb|AY508143.1| HIV-1 isolate 8-A10 from USA gag protein (gag) ge...	40	4.5
90	gb|AY508142.1| HIV-1 isolate 7-H9 from USA gag protein (gag) gen...	40	4.5
91	gb|AY508141.1| HIV-1 isolate 7-H5 from USA gag protein (gag) gen...	40	4.5
92	gb|AY508140.1| HIV-1 isolate 7-H10 from USA gag protein (gag) ge...	40	4.5
93	gb|AY508139.1| HIV-1 isolate 7-G8 from USA gag protein (gag) gen...	40	4.5
94	gb|AY508137.1| HIV-1 isolate 7-F10 from USA gag protein (gag) ge...	40	4.5
95	gb|AY508136.1| HIV-1 isolate 7-E6 from USA nonfunctional gag pro...	40	4.5
96	gb|AY508135.1| HIV-1 isolate 7-E5 from USA nonfunctional gag pro...	40	4.5
97	gb|AY508134.1| HIV-1 isolate 7-D12 from USA gag protein (gag) ge...	40	4.5
98	gb|AY508133.1| HIV-1 isolate 7-C4 from USA gag protein (gag) gen...	40	4.5
99	gb|AY508132.1| HIV-1 isolate 7-B8 from USA gag protein (gag) gen...	40	4.5
100	gb|AY508130.1| HIV-1 isolate 7-B2 from USA nonfunctional gag pro...	40	4.5
101	gb|AY508129.1| HIV-1 isolate 7-B10 from USA nonfunctional gag pr...	40	4.5
102	gb|AY508128.1| HIV-1 isolate 7-A7 from USA gag protein (gag) gen...	40	4.5
103	gb|AY508126.1| HIV-1 isolate 7-A5 from USA gag protein (gag) gen...	40	4.5
104	gb|AY531116.1| HIV-1 isolate LTG0218 clone 30 from China, comple...	40	4.5
105	gb|AY560110.1| HIV-1 isolate 98USHVTN941c1 from USA, complete ge...	40	4.5
106	gb|AY560109.1| HIV-1 isolate 98USHVTN8229c6 from USA, complete g...	40	4.5
107	gb|AY560108.1| HIV-1 isolate 98USHVTN3605c9 from USA, complete g...	40	4.5
108	gb|AY560107.1| HIV-1 isolate 98USHVTN1925c1 from USA, complete g...	40	4.5
109	gb|AY322193.1| HIV-1 isolate ML752-3-1997 from Kenya, complete g...	40	4.5
110	gb|AY322189.1| HIV-1 isolate ML415-2-1997 from Kenya, complete g...	40	4.5
111	gb|AY322185.1| HIV-1 isolate ML013-2-1997 from Kenya, complete g...	40	4.5
112	gb|AY322184.1| HIV-1 isolate ML013-10-1986 from Kenya, complete ...	40	4.5
113	gb|AY682547.1| HIV-1 isolate 04RU128005 from Russia, complete ge...	40	4.5
114	gb|AY536238.1| HIV-1 isolate X1241 from Argentina, complete genome	40	4.5
115	gb|AY536237.1| HIV-1 isolate R140 from Argentina, complete genome	40	4.5
116	gb|AY536234.1| HIV-1 isolate CH6 from Chile, complete genome	40	4.5
117	gb|U51188.1|HIVU51188 HIV-1 clone 90cf402 from the Central Afric...	40	4.5
118	gb|U51189.1|HIVU51189 HIV-1 clone 93th253 from Thailand, complet...	40	4.5
119	gb|DQ487191.1| HIV-1 isolate WCM32P0896 from USA, complete genome	40	4.5
120	gb|DQ487190.1| HIV-1 isolate WCM32P0793 from USA, complete genome	40	4.5
121	gb|DQ487189.1| HIV-1 isolate WCD32P1195 from USA, complete genome	40	4.5
122	gb|DQ487188.1| HIV-1 isolate WCD32P0793 from USA, complete genome	40	4.5
123	gb|DQ057032.1| HIV-1 isolate LT66 from Cameroon gag protein (gag...	40	4.5
124	gb|DQ396400.1| HIV-1 isolate 04ZASK162B1 from South Africa, comp...	40	4.5
125	gb|DQ396399.1| HIV-1 isolate 03ZAPS152MB1 from South Africa, com...	40	4.5
126	gb|DQ396398.1| HIV-1 isolate 03ZAPS045MB2 from South Africa, com...	40	4.5
127	gb|DQ396397.1| HIV-1 isolate 04ZASK201B1 from South Africa, comp...	40	4.5
128	gb|DQ396396.1| HIV-1 isolate 04ZASK193B1 from South Africa, comp...	40	4.5
129	gb|DQ396395.1| HIV-1 isolate 03ZASK104B1 from South Africa, comp...	40	4.5
130	gb|DQ396394.1| HIV-1 isolate 04ZAPS177MB1 from South Africa, com...	40	4.5
131	gb|DQ396393.1| HIV-1 isolate 04ZAPS169MB1 from South Africa, com...	40	4.5
132	gb|DQ396392.1| HIV-1 isolate 03ZAPS151MB1 from South Africa, com...	40	4.5
133	gb|DQ396391.1| HIV-1 isolate 03ZAPS143MB1 from South Africa, com...	40	4.5
134	gb|DQ396390.1| HIV-1 isolate 03ZAPS125MB1 from South Africa, com...	40	4.5
135	gb|DQ396389.1| HIV-1 isolate 03ZAPS067MB2 from South Africa, com...	40	4.5
136	gb|DQ396387.1| HIV-1 isolate 04ZASK165B1 from South Africa, comp...	40	4.5
137	gb|DQ396386.1| HIV-1 isolate 03ZAPS112MB2 from South Africa, com...	40	4.5
138	gb|DQ396385.1| HIV-1 isolate 03ZAPS051MB1 from South Africa, com...	40	4.5
139	gb|DQ396384.1| HIV-1 isolate 03ZAPS044MB1 from South Africa, com...	40	4.5
140	gb|DQ396383.1| HIV-1 isolate 04ZASK200B1 from South Africa, comp...	40	4.5
141	gb|DQ396381.1| HIV-1 isolate 04ZASK169B1 from South Africa, comp...	40	4.5
142	gb|DQ396380.1| HIV-1 isolate 03ZAPS131MB1 from South Africa, com...	40	4.5
143	gb|DQ396379.1| HIV-1 isolate 03ZAPS11MB2 from South Africa, comp...	40	4.5
144	gb|DQ396378.1| HIV-1 isolate 03ZAPS108MB1 from South Africa, com...	40	4.5
145	gb|DQ396376.1| HIV-1 isolate 03ZAPS071MB1 from South Africa, com...	40	4.5
146	gb|DQ396375.1| HIV-1 isolate 03ZAPS066MB2 from South Africa, com...	40	4.5
147	gb|DQ396374.1| HIV-1 isolate 03ZAPS056MB1 from South Africa, com...	40	4.5
148	gb|DQ396373.1| HIV-1 isolate 03ZAPS055MB1 from South Africa, com...	40	4.5
149	gb|DQ396372.1| HIV-1 isolate 05ZASK243B1 from South Africa, comp...	40	4.5
150	gb|DQ396371.1| HIV-1 isolate 03ZAPS155MB1 from South Africa, com...	40	4.5
151	gb|DQ396369.1| HIV-1 isolate 03ZAPS123MB1 from South Africa, com...	40	4.5
152	gb|DQ396368.1| HIV-1 isolate 03ZAPS118MB1 from South Africa, com...	40	4.5
153	gb|DQ396367.1| HIV-1 isolate 03ZAPS024MB1 from South Africa, com...	40	4.5
154	gb|DQ396366.1| HIV-1 isolate 04ZASK052MB2 from South Africa, com...	40	4.5
155	gb|DQ396365.1| HIV-1 isolate 03ZAPS113MB2 from South Africa, com...	40	4.5
156	gb|DQ396364.1| HIV-1 isolate 03ZAPS048MB1 from South Africa, com...	40	4.5
157	gb|DQ115707.1| HIV-1 isolate IR-g-146-4 from Iran gag protein (g...	40	4.5
158	gb|DQ115706.1| HIV-1 isolate IR-g-146-3 from Iran gag protein (g...	40	4.5
159	gb|DQ115705.1| HIV-1 isolate IR-g-169-2 from Iran gag protein (g...	40	4.5
160	gb|DQ115704.1| HIV-1 isolate IR-g-169-1 from Iran gag protein (g...	40	4.5
161	gb|DQ115703.1| HIV-1 isolate IR-g-169-3 from Iran gag protein (g...	40	4.5
162	gb|DQ115702.1| HIV-1 isolate IR-g-169-4 from Iran gag protein (g...	40	4.5
163	gb|DQ115701.1| HIV-1 isolate IR-g-174-5 from Iran gag protein (g...	40	4.5
164	gb|DQ115700.1| HIV-1 isolate IR-g-174-2 from Iran gag protein (g...	40	4.5
165	gb|DQ115699.1| HIV-1 isolate IR-g-174-1 from Iran gag protein (g...	40	4.5
166	gb|DQ115698.1| HIV-1 isolate IR-g-174-4 from Iran gag protein (g...	40	4.5
167	gb|DQ115695.1| HIV-1 isolate IR-g-141-6 from Iran gag protein (g...	40	4.5
168	gb|DQ115694.1| HIV-1 isolate IR-g-141-2 from Iran nonfunctional ...	40	4.5
169	gb|DQ115693.1| HIV-1 isolate IR-g-170-2 from Iran gag protein (g...	40	4.5
170	gb|DQ115692.1| HIV-1 isolate IR-g-170-1 from Iran gag protein (g...	40	4.5
171	gb|DQ115691.1| HIV-1 isolate IR-g-170-4 from Iran gag protein (g...	40	4.5
172	gb|DQ115690.1| HIV-1 isolate IR-g-170-3 from Iran gag protein (g...	40	4.5
173	gb|DQ115689.1| HIV-1 isolate IR-g-130-7 from Iran nonfunctional ...	40	4.5
174	gb|DQ115688.1| HIV-1 isolate IR-g-130-2 from Iran gag protein (g...	40	4.5
175	gb|DQ115687.1| HIV-1 isolate IR-g-130-1 from Iran gag protein (g...	40	4.5
176	gb|DQ115686.1| HIV-1 isolate IR-g-130-5 from Iran gag protein (g...	40	4.5
177	gb|DQ115685.1| HIV-1 isolate IR-g-175-2 from Iran gag protein (g...	40	4.5
178	gb|DQ115684.1| HIV-1 isolate IR-g-175-4 from Iran gag protein (g...	40	4.5
179	gb|DQ115683.1| HIV-1 isolate IR-g-175-3 from Iran gag protein (g...	40	4.5
180	gb|DQ115682.1| HIV-1 isolate IR-g-175-1 from Iran gag protein (g...	40	4.5
181	gb|DQ115681.1| HIV-1 isolate IR-g-188-1 from Iran gag protein (g...	40	4.5
182	gb|DQ115680.1| HIV-1 isolate IR-g-188-3 from Iran gag protein (g...	40	4.5
183	gb|DQ115679.1| HIV-1 isolate IR-g-188-2 from Iran nonfunctional ...	40	4.5
184	gb|DQ115678.1| HIV-1 isolate IR-g-188-4 from Iran nonfunctional ...	40	4.5
185	gb|DQ115677.1| HIV-1 isolate IR-g-138-2 from Iran gag protein (g...	40	4.5
186	gb|DQ115676.1| HIV-1 isolate IR-g-138-6 from Iran gag protein (g...	40	4.5
187	gb|DQ115675.1| HIV-1 isolate IR-g-138-3 from Iran gag protein (g...	40	4.5
188	gb|DQ115674.1| HIV-1 isolate IR-g-128-1 from Iran gag protein (g...	40	4.5
189	gb|DQ115673.1| HIV-1 isolate IR-g-128-3 from Iran gag protein (g...	40	4.5
190	gb|DQ115672.1| HIV-1 isolate IR-g-128-2 from Iran gag protein (g...	40	4.5
191	gb|DQ115671.1| HIV-1 isolate IR-g-128-4 from Iran gag protein (g...	40	4.5
192	gb|DQ115670.1| HIV-1 isolate IR-g-158-3 from Iran gag protein (g...	40	4.5
193	gb|DQ115669.1| HIV-1 isolate IR-g-158-4 from Iran gag protein (g...	40	4.5
194	gb|DQ115668.1| HIV-1 isolate IR-g-158-1 from Iran gag protein (g...	40	4.5
195	gb|DQ115667.1| HIV-1 isolate IR-g-143-3 from Iran gag protein (g...	40	4.5
196	gb|DQ115666.1| HIV-1 isolate IR-g-143-6 from Iran gag protein (g...	40	4.5
197	gb|DQ115665.1| HIV-1 isolate IR-g-143-2 from Iran nonfunctional ...	40	4.5
198	gb|DQ115664.1| HIV-1 isolate IR-g-143-1 from Iran nonfunctional ...	40	4.5
199	gb|DQ115663.1| HIV-1 isolate IR-g-151-5 from Iran gag protein (g...	40	4.5
200	gb|DQ115662.1| HIV-1 isolate IR-g-151-2 from Iran gag protein (g...	40	4.5
201	gb|DQ115661.1| HIV-1 isolate IR-g-51-3 from Iran gag protein (ga...	40	4.5
202	gb|DQ115660.1| HIV-1 isolate IR-g-151-22c from Iran gag protein ...	40	4.5
203	gb|DQ115659.1| HIV-1 isolate IR-g-151-20c from Iran gag protein ...	40	4.5
204	gb|DQ115658.1| HIV-1 isolate IR-g-172-5 from Iran gag protein (g...	40	4.5
205	gb|DQ115657.1| HIV-1 isolate IR-g-172-4 from Iran gag protein (g...	40	4.5
206	gb|DQ115656.1| HIV-1 isolate IR-g-172-3 from Iran gag protein (g...	40	4.5
207	gb|DQ115655.1| HIV-1 isolate IR-g-172-2 from Iran gag protein (g...	40	4.5
208	gb|DQ115654.1| HIV-1 isolate IR-g-166-1 from Iran gag protein (g...	40	4.5
209	gb|DQ115653.1| HIV-1 isolate IR-g-166-6 from Iran nonfunctional ...	40	4.5
210	gb|DQ115652.1| HIV-1 isolate IR-g-166-3 from Iran nonfunctional ...	40	4.5
211	gb|DQ115651.1| HIV-1 isolate IR-g-166-2 from Iran gag protein (g...	40	4.5
212	gb|DQ115650.1| HIV-1 isolate IR-g-112-3 from Iran gag protein (g...	40	4.5
213	gb|DQ115649.1| HIV-1 isolate IR-g-112-1 from Iran gag protein (g...	40	4.5
214	gb|DQ115648.1| HIV-1 isolate IR-g-112-6 from Iran gag protein (g...	40	4.5
215	gb|DQ115647.1| HIV-1 isolate IR-g-186-7 from Iran gag protein (g...	40	4.5
216	gb|DQ115646.1| HIV-1 isolate IR-g-186-1 from Iran gag protein (g...	40	4.5
217	gb|DQ077872.1| HIV-1 isolate IR-g-150 from Iran gag protein (gag...	40	4.5
218	gb|DQ077870.1| HIV-1 isolate IR-g-150-2 from Iran gag protein (g...	40	4.5
219	gb|DQ077867.1| HIV-1 isolate IR-g-147-3 from Iran gag protein (g...	40	4.5
220	gb|DQ077866.1| HIV-1 isolate IR-g-147-2 from Iran gag protein (g...	40	4.5
221	gb|DQ077865.1| HIV-1 isolate IR-g-147-6 from Iran gag protein (g...	40	4.5
222	gb|DQ077864.1| HIV-1 isolate IR-g-147-1 from Iran gag protein (g...	40	4.5
223	gb|DQ077863.1| HIV-1 isolate IR-g-153-4 from Iran gag protein (g...	40	4.5
224	gb|DQ077862.1| HIV-1 isolate IR-g-153 from Iran gag protein (gag...	40	4.5
225	gb|DQ077861.1| HIV-1 isolate IR-g-153-2 from Iran gag protein (g...	40	4.5
226	gb|DQ077860.1| HIV-1 isolate IR-g-153-1 from Iran nonfunctional ...	40	4.5
227	gb|DQ077859.1| HIV-1 isolate IR-g-155-3 from Iran gag protein (g...	40	4.5
228	gb|DQ077858.1| HIV-1 isolate IR-g-155-4 from Iran gag protein (g...	40	4.5
229	gb|DQ077857.1| HIV-1 isolate IR-g-155-5 from Iran gag protein (g...	40	4.5
230	gb|DQ077856.1| HIV-1 isolate IR-g-155-2 from Iran gag protein (g...	40	4.5
231	gb|DQ077855.1| HIV-1 isolate IR-g-196-3 from Iran gag protein (g...	40	4.5
232	gb|DQ077851.1| HIV-1 isolate IR-g-154 from Iran gag protein (gag...	40	4.5
233	gb|DQ077850.1| HIV-1 isolate IR-g-154-4 from Iran gag protein (g...	40	4.5
234	gb|DQ077849.1| HIV-1 isolate IR-g-154-3 from Iran gag protein (g...	40	4.5
235	gb|DQ077848.1| HIV-1 isolate IR-g-144-5 from Iran gag protein (g...	40	4.5
236	gb|DQ077847.1| HIV-1 isolate IR-g-144-4 from Iran gag protein (g...	40	4.5
237	gb|DQ077846.1| HIV-1 isolate IR-g-163-1 from Iran gag protein (g...	40	4.5
238	gb|DQ077845.1| HIV-1 isolate IR-g-163-4 from Iran gag protein (g...	40	4.5
239	gb|DQ077844.1| HIV-1 isolate IR-g-163-2 from Iran gag protein (g...	40	4.5
240	gb|DQ077843.1| HIV-1 isolate IR-g-165-5 from Iran gag protein (g...	40	4.5
241	gb|DQ077842.1| HIV-1 isolate IR-g-165-2 from Iran gag protein (g...	40	4.5
242	gb|DQ077840.1| HIV-1 isolate IR-g-149-4 from Iran gag protein (g...	40	4.5
243	gb|DQ077839.1| HIV-1 isolate IR-g-149-1 from Iran gag protein (g...	40	4.5
244	gb|DQ077838.1| HIV-1 isolate IR-g-149-3 from Iran gag protein (g...	40	4.5
245	gb|DQ077837.1| HIV-1 isolate IR-g-176-1 from Iran nonfunctional ...	40	4.5
246	gb|DQ077836.1| HIV-1 isolate IR-g-176-3 from Iran gag protein (g...	40	4.5
247	gb|DQ077835.1| HIV-1 isolate IR-g-176-5 from Iran gag protein (g...	40	4.5
248	gb|DQ077834.1| HIV-1 isolate IR-g-176-2 from Iran gag protein (g...	40	4.5
249	gb|DQ077833.1| HIV-1 isolate IR-g-148 from Iran gag protein (gag...	40	4.5
250	gb|DQ077832.1| HIV-1 isolate IR-g-139-3 from Iran gag protein (g...	40	4.5
251	gb|DQ077831.1| HIV-1 isolate IR-g-139-4 from Iran gag protein (g...	40	4.5
252	gb|DQ077830.1| HIV-1 isolate IR-g-139-2 from Iran gag protein (g...	40	4.5
253	gb|DQ077829.1| HIV-1 isolate IR-g-139-6 from Iran gag protein (g...	40	4.5
254	gb|DQ077828.1| HIV-1 isolate IR-g-161-4 from Iran gag protein (g...	40	4.5
255	gb|DQ077827.1| HIV-1 isolate IR-g-161-6 from Iran gag protein (g...	40	4.5
256	gb|DQ077826.1| HIV-1 isolate IR-g-161-8 from Iran gag protein (g...	40	4.5
257	gb|DQ077825.1| HIV-1 isolate IR-g-161-5 from Iran gag protein (g...	40	4.5
258	gb|DQ077824.1| HIV-1 isolate IR-g-161-7 from Iran gag protein (g...	40	4.5
259	gb|AF539406.1| HIV-1 isolate ML170.1995 from Kenya 5' long termi...	40	4.5
260	gb|AF539405.1| HIV-1 isolate ML170-1986 from Kenya gag protein (...	40	4.5
261	gb|AF539404.1| HIV-1 isolate ML170.1997 from Kenya 5' long termi...	40	4.5
262	gb|AY585268.1| HIV-1 isolate C.ZA.1069MB from South Africa, comp...	40	4.5
263	gb|AY585267.1| HIV-1 isolate C.ZA.1184MB from South Africa, comp...	40	4.5
264	gb|AY585266.1| HIV-1 isolate C.ZA.1157M3M from South Africa, com...	40	4.5
265	gb|AY585265.1| HIV-1 isolate C.ZA.J112MA from South Africa, comp...	40	4.5
266	gb|AY585264.1| HIV-1 isolate C.ZA.1189MB from South Africa, comp...	40	4.5
267	gb|AY227361.1|AY227361S1 Synthetic construct HIV-1 derived gag p...	40	4.5
268	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	4.5
269	gb|AF426288.2| Synthetic construct mutated HIV-1 DNA vaccine seq...	40	4.5
270	gb|AY517431.1| Homo sapiens clone HIV1-HeLa-187 HIV-1 integratio...	40	4.5
271	gb|AY517419.1| Homo sapiens clone HIV1-HeLa-175 HIV-1 integratio...	40	4.5
272	gb|AF082395.1| HIV-1 subtype J strain SE9173 from Sweden gag pro...	40	4.5
273	gb|AF082394.1| HIV-1 subtype J strain SE9280 from Sweden gag pro...	40	4.5
274	gb|AY237167.1| HIV-1 isolate TZBFL0210-1-2 from Tanzania, comple...	40	4.5
275	gb|AY237166.1| HIV-1 isolate TZBFL0170-3-2 from Tanzania, comple...	40	4.5
276	gb|AY237165.1| HIV-1 isolate TZBFL0210-1-8 from Tanzania, comple...	40	4.5
277	gb|AY451235.1| HIV-1 isolate Z98X4/594 from USA gag protein (gag...	40	4.5
278	gb|AY451234.1| HIV-1 isolate Z98X3/594 from USA gag protein (gag...	40	4.5
279	gb|AY451233.1| HIV-1 isolate Z98X2b/594 from USA gag protein (ga...	40	4.5
280	gb|AY451231.1| HIV-1 isolate Z98X13/594 from USA gag protein (ga...	40	4.5
281	gb|AY451230.1| HIV-1 isolate Z98X12/594 from USA gag protein (ga...	40	4.5
282	gb|AY451229.1| HIV-1 isolate Z98X1/594 from USA gag protein (gag...	40	4.5
283	gb|AY451228.1| HIV-1 isolate Z92X9x7/594 from USA gag protein (g...	40	4.5
284	gb|AY451227.1| HIV-1 isolate Z92X4x8/594 from USA gag protein (g...	40	4.5
285	gb|AY451225.1| HIV-1 isolate Y99X19/583 from USA gag protein (ga...	40	4.5
286	gb|AY451224.1| HIV-1 isolate Y99X18/583 from USA gag protein (ga...	40	4.5
287	gb|AY451222.1| HIV-1 isolate Y99X16/583 from USA gag protein (ga...	40	4.5
288	gb|AY451221.1| HIV-1 isolate Y99X15/583 from USA gag protein (ga...	40	4.5
289	gb|AY451220.1| HIV-1 isolate Y99X14/583 from USA gag protein (ga...	40	4.5
290	gb|AY451219.1| HIV-1 isolate Y99X12/583 from USA gag protein (ga...	40	4.5
291	gb|AY451217.1| HIV-1 isolate Y91X3x4/583 from USA gag protein (g...	40	4.5
292	gb|AY451215.1| HIV-1 isolate V98X8/319 from USA gag protein (gag...	40	4.5
293	gb|AY451214.1| HIV-1 isolate V98X7/319 from USA gag protein (gag...	40	4.5
294	gb|AY451212.1| HIV-1 isolate V98X20/319 from USA gag protein (ga...	40	4.5
295	gb|AY451211.1| HIV-1 isolate V98X19/319 from USA gag protein (ga...	40	4.5
296	gb|AY451210.1| HIV-1 isolate V98X18/319 from USA gag protein (ga...	40	4.5
297	gb|AY451209.1| HIV-1 isolate V98X17/319 from USA gag protein (ga...	40	4.5
298	gb|AY451208.1| HIV-1 isolate V98X16/319 from USA gag protein (ga...	40	4.5
299	gb|AY451207.1| HIV-1 isolate V98X13/319 from USA gag protein (ga...	40	4.5
300	gb|AY451205.1| HIV-1 isolate V98X11/319 from USA gag protein (ga...	40	4.5
301	gb|AY451204.1| HIV-1 isolate V98X10/319 from USA gag protein (ga...	40	4.5
302	gb|AY451203.1| HIV-1 isolate V91X6x3b/319 from USA gag protein (...	40	4.5
303	gb|AY451202.1| HIV-1 isolate V91X6x3/319 from USA gag protein (g...	40	4.5
304	gb|AY451199.1| HIV-1 isolate V91X15/319 from USA gag protein (ga...	40	4.5
305	gb|AY451198.1| HIV-1 isolate V91X14/319 from USA gag protein (ga...	40	4.5
306	gb|AY451197.1| HIV-1 isolate V91X13/319 from USA gag protein (ga...	40	4.5
307	gb|AY451196.1| HIV-1 isolate V91X12/319 from USA gag protein (ga...	40	4.5
308	gb|AY451195.1| HIV-1 isolate V91X10/319 from USA gag protein (ga...	40	4.5
309	gb|AY451193.1| HIV-1 isolate U96X5/262 from USA gag protein (gag...	40	4.5
310	gb|AY451192.1| HIV-1 isolate U96X3/262 from USA gag protein (gag...	40	4.5
311	gb|AY451191.1| HIV-1 isolate U96X2/262 from USA gag protein (gag...	40	4.5
312	gb|AY451190.1| HIV-1 isolate U96X12/262 from USA gag protein (ga...	40	4.5
313	gb|AY451189.1| HIV-1 isolate U96X11/262 from USA gag protein (ga...	40	4.5
314	gb|AY451187.1| HIV-1 isolate U90X7x9/262 from USA gag protein (g...	40	4.5
315	gb|AY451186.1| HIV-1 isolate U90X11/262 from USA gag protein (ga...	40	4.5
316	gb|AY451184.1| HIV-1 isolate T99X8/102 from USA gag protein (gag...	40	4.5
317	gb|AY451182.1| HIV-1 isolate T93X9/102 from USA gag protein (gag...	40	4.5
318	gb|AY451181.1| HIV-1 isolate T93X4x9/102 from USA gag protein (g...	40	4.5
319	gb|AY451180.1| HIV-1 isolate S99X9x2/1002 from USA gag protein (...	40	4.5
320	gb|AY451179.1| HIV-1 isolate S99X2x4/1002 from USA gag protein (...	40	4.5
321	gb|AY451177.1| HIV-1 isolate S87X7x6/1002 from USA gag protein (...	40	4.5
322	gb|AY451176.1| HIV-1 isolate Q96X8/519 from USA gag protein (gag...	40	4.5
323	gb|AY451175.1| HIV-1 isolate Q96X4/519 from USA gag protein (gag...	40	4.5
324	gb|AY451173.1| HIV-1 isolate Q96X1x3/519 from USA gag protein (g...	40	4.5
325	gb|AY451172.1| HIV-1 isolate Q87X9x2/519 from USA gag protein (g...	40	4.5
326	gb|AY451171.1| HIV-1 isolate Q87X7x2/519 from USA gag protein (g...	40	4.5
327	gb|AY451170.1| HIV-1 isolate Q87X3x2/519 from USA gag protein (g...	40	4.5
328	gb|AY451169.1| HIV-1 isolate Q87X2/519 from USA gag protein (gag...	40	4.5
329	gb|AY451168.1| HIV-1 isolate Q87X12/519 from USA gag protein (ga...	40	4.5
330	gb|AY451165.1| HIV-1 isolate L96X7/72 from USA gag protein (gag)...	40	4.5
331	gb|AY451163.1| HIV-1 isolate L96X5/72 from USA gag protein (gag)...	40	4.5
332	gb|AY451162.1| HIV-1 isolate L96X3/72 from USA gag protein (gag)...	40	4.5
333	gb|AY451161.1| HIV-1 isolate L96X2/72 from USA gag protein (gag)...	40	4.5
334	gb|AY451160.1| HIV-1 isolate L96X13/72 from USA gag protein (gag...	40	4.5
335	gb|AY451159.1| HIV-1 isolate L96X12/72 from USA gag protein (gag...	40	4.5
336	gb|AY451157.1| HIV-1 isolate L96X10/72 from USA gag protein (gag...	40	4.5
337	gb|AY451156.1| HIV-1 isolate L96X1/72 from USA gag protein (gag)...	40	4.5
338	gb|AY451155.1| HIV-1 isolate L88X9x5/72 from USA gag protein (ga...	40	4.5
339	gb|AY451154.1| HIV-1 isolate JJ99X9/4756 from USA gag protein (g...	40	4.5
340	gb|AY451153.1| HIV-1 isolate JJ99X8/4756 from USA gag protein (g...	40	4.5
341	gb|AY451152.1| HIV-1 isolate JJ99X5/4756 from USA gag protein (g...	40	4.5
342	gb|AY451151.1| HIV-1 isolate JJ99X4/4756 from USA gag protein (g...	40	4.5
343	gb|AY451150.1| HIV-1 isolate JJ99X3/4756 from USA gag protein (g...	40	4.5
344	gb|AY451149.1| HIV-1 isolate JJ99X2/4756 from USA gag protein (g...	40	4.5
345	gb|AY451147.1| HIV-1 isolate JJ99X11/4756 from USA gag protein (...	40	4.5
346	gb|AY451146.1| HIV-1 isolate JJ99X10/4756 from USA gag protein (...	40	4.5
347	gb|AY451145.1| HIV-1 isolate JJ99X1/4756 from USA gag protein (g...	40	4.5
348	gb|AY451144.1| HIV-1 isolate JJ93X6x12/4756 from USA gag protein...	40	4.5
349	gb|AY451143.1| HIV-1 isolate JJ93X3/4756 from USA gag protein (g...	40	4.5
350	gb|AY451142.1| HIV-1 isolate I97X8/699 from USA gag protein (gag...	40	4.5
351	gb|AY451141.1| HIV-1 isolate I97X7/699 from USA gag protein (gag...	40	4.5
352	gb|AY451140.1| HIV-1 isolate I97X5/699 from USA gag protein (gag...	40	4.5
353	gb|AY451139.1| HIV-1 isolate I97X3/699 from USA gag protein (gag...	40	4.5
354	gb|AY451138.1| HIV-1 isolate I88X7/699 from USA gag protein (gag...	40	4.5
355	gb|AY451137.1| HIV-1 isolate I88X3/699 from USA gag protein (gag...	40	4.5
356	gb|AY451136.1| HIV-1 isolate F99X8/228 from USA gag protein (gag...	40	4.5
357	gb|AY451135.1| HIV-1 isolate F99X7/228 from USA gag protein (gag...	40	4.5
358	gb|AY451134.1| HIV-1 isolate F99X6/228 from USA gag protein (gag...	40	4.5
359	gb|AY451133.1| HIV-1 isolate F99X5/228 from USA gag protein (gag...	40	4.5
360	gb|AY451132.1| HIV-1 isolate F99X4/228 from USA gag protein (gag...	40	4.5
361	gb|AY451131.1| HIV-1 isolate F99X3/228 from USA gag protein (gag...	40	4.5
362	gb|AY451130.1| HIV-1 isolate F99X2/228 from USA gag protein (gag...	40	4.5
363	gb|AY451129.1| HIV-1 isolate F99X1/228 from USA gag protein (gag...	40	4.5
364	gb|AY451128.1| HIV-1 isolate F90X9x6/228 from USA gag protein (g...	40	4.5
365	gb|AY451127.1| HIV-1 isolate F90X7/228 from USA gag protein (gag...	40	4.5
366	gb|AY451126.1| HIV-1 isolate F90X6/228 from USA gag protein (gag...	40	4.5
367	gb|AY451125.1| HIV-1 isolate F90X5/228 from USA gag protein (gag...	40	4.5
368	gb|AY451124.1| HIV-1 isolate F90X1x6/228 from USA gag protein (g...	40	4.5
369	gb|AY451123.1| HIV-1 isolate E99X8/79 from USA gag protein (gag)...	40	4.5
370	gb|AY451122.1| HIV-1 isolate E99X7/79 from USA gag protein (gag)...	40	4.5
371	gb|AY451121.1| HIV-1 isolate E99X6/79 from USA gag protein (gag)...	40	4.5
372	gb|AY451120.1| HIV-1 isolate E99X5/79 from USA gag protein (gag)...	40	4.5
373	gb|AY451119.1| HIV-1 isolate E99X4/79 from USA gag protein (gag)...	40	4.5
374	gb|AY451116.1| HIV-1 isolate E92X9/79 from USA gag protein (gag)...	40	4.5
375	gb|AY451115.1| HIV-1 isolate E92X8/79 from USA gag protein (gag)...	40	4.5
376	gb|AY451114.1| HIV-1 isolate E92X6/79 from USA gag protein (gag)...	40	4.5
377	gb|AY451113.1| HIV-1 isolate E92X5/79 from USA gag protein (gag)...	40	4.5
378	gb|AY451112.1| HIV-1 isolate E92X4/79 from USA gag protein (gag)...	40	4.5
379	gb|AY451111.1| HIV-1 isolate E92X3/79 from USA gag protein (gag)...	40	4.5
380	gb|AY451108.1| HIV-1 isolate E92X1/79 from USA gag protein (gag)...	40	4.5
381	gb|AY451106.1| HIV-1 isolate CC95X7/1215 from USA gag protein (g...	40	4.5
382	gb|AY451105.1| HIV-1 isolate CC95X4/1215 from USA gag protein (g...	40	4.5
383	gb|AY451104.1| HIV-1 isolate CC95X3/1215 from USA gag protein (g...	40	4.5
384	gb|AY451103.1| HIV-1 isolate CC89X4x6/1215 from USA gag protein ...	40	4.5
385	gb|AY451102.1| HIV-1 isolate BB98X20/1020 from USA gag protein (...	40	4.5
386	gb|AY451101.1| HIV-1 isolate BB98X19/1020 from USA gag protein (...	40	4.5
387	gb|AY451100.1| HIV-1 isolate BB98X16/1020 from USA gag protein (...	40	4.5
388	gb|AY451099.1| HIV-1 isolate BB91X4x5/1020 from USA gag protein ...	40	4.5
389	gb|AY451096.1| HIV-1 isolate B97X8/30 from USA gag protein (gag)...	40	4.5
390	gb|AY451095.1| HIV-1 isolate B97X5/30 from USA gag protein (gag)...	40	4.5
391	gb|AY451094.1| HIV-1 isolate B97X4/30 from USA gag protein (gag)...	40	4.5
392	gb|AY451093.1| HIV-1 isolate B97X13/30 from USA gag protein (gag...	40	4.5
393	gb|AY451092.1| HIV-1 isolate B97X12/30 from USA gag protein (gag...	40	4.5
394	gb|AY451091.1| HIV-1 isolate B97X11/30 from USA gag protein (gag...	40	4.5
395	gb|AY451090.1| HIV-1 isolate B97X10/30 from USA gag protein (gag...	40	4.5
396	gb|AY451089.1| HIV-1 isolate B90X4x12/30 from USA gag protein (g...	40	4.5
397	gb|AY451085.1| HIV-1 isolate AA94X20/647 from USA gag protein (g...	40	4.5
398	gb|AY451083.1| HIV-1 isolate AA94X18/647 from USA gag protein (g...	40	4.5
399	gb|AY451082.1| HIV-1 isolate AA94X17/647 from USA gag protein (g...	40	4.5
400	gb|AY451081.1| HIV-1 isolate AA94X16/647 from USA gag protein (g...	40	4.5
401	gb|AY451080.1| HIV-1 isolate AA88X9x14/647 from USA gag protein ...	40	4.5
402	emb|Z11530.1|HIVF12CG Human Immunodeficiency virus I (HIV-1) RNA	40	4.5
403	gb|AY423387.1| HIV-1 isolate 671-00T36 from Netherlands, complet...	40	4.5
404	gb|AY423386.1| HIV-1 isolate 671-00T103 from Netherlands, comple...	40	4.5
405	gb|AY423385.1| HIV-1 isolate 671-00T169 from Netherlands, comple...	40	4.5
406	gb|AY423384.1| HIV-1 isolate 671-00T167 from Netherlands, comple...	40	4.5
407	gb|AY423383.1| HIV-1 isolate 671-00T162 from Netherlands, comple...	40	4.5
408	gb|AY423382.1| HIV-1 isolate 671-00T93 from Netherlands, complet...	40	4.5
409	gb|AY423381.1| HIV-1 isolate 671-99T12 from Netherlands, complet...	40	4.5
410	gb|AY352655.1| HIV-1 isolate SE9010 from Sweden, complete genome	40	4.5
411	gb|AY352654.1| HIV-1 isolate SE8646 from Sweden, complete genome	40	4.5
412	gb|AY228557.1| HIV-1 isolate 01ZATM45 from South Africa, complet...	40	4.5
413	gb|AY228556.1| HIV-1 isolate 99ZATM10 from South Africa, complet...	40	4.5
414	gb|AY468486.1| Lentiviral transfer vector pHsCXW, complete sequence	40	4.5
415	gb|K03455.1|HIVHXB2CG Human immunodeficiency virus type 1 (HXB2)...	40	4.5
416	gb|AF411964.1| HIV-1 isolate 99ZACM4 from South Africa, complete...	40	4.5
417	gb|AF411967.1| HIV-1 isolate 99ZACM9 from South Africa, complete...	40	4.5
418	gb|AF411966.1| HIV-1 isolate 99ZASW7 from South Africa, complete...	40	4.5
419	gb|AF411965.1| HIV-1 isolate 98ZADu178 from South Africa, comple...	40	4.5
420	emb|AJ245481.2|HIM245481 Human immunodeficiency virus type 1 pro...	40	4.5
421	emb|AJ866558.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
422	emb|AJ866557.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
423	emb|AJ866556.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
424	emb|AJ866555.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
425	emb|AJ866554.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
426	emb|AJ866553.1| Human immunodeficiency virus 1 complete genome, ...	40	4.5
427	gb|AY049711.1| HIV-1 isolate 01IN565.14 from India, complete genome	40	4.5
428	gb|AY049710.1| HIV-1 isolate 01IN565.13 from India, complete genome	40	4.5
429	gb|AY049709.1| HIV-1 isolate 01IN565.11 from India, complete genome	40	4.5
430	gb|AY049708.1| HIV-1 isolate 01IN565.10 from India, complete genome	40	4.5
431	ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosom...	40	4.5
432	gb|AY957481.1| HIV-1 isolate INF5 clone 6 from Tanzania LTR, com...	40	4.5
433	gb|AY957480.1| HIV-1 isolate INF5 clone 7 from Tanzania LTR, com...	40	4.5
434	gb|AY957478.1| HIV-1 isolate INF5 clone 2 from Tanzania LTR, com...	40	4.5
435	gb|AY957477.1| HIV-1 isolate INF5 clone 1 from Tanzania LTR, com...	40	4.5
436	gb|AY932741.1| HIV-1 isolate TZLM718 from Tanzania 5' LTR, compl...	40	4.5
437	gb|AY167123.1| HIV-1 isolate CM237 from Thailand, complete genome	40	4.5
438	gb|AY227107.1| HIV-1 genotype CRF05_DF isolate X492 from Spain, ...	40	4.5
439	gb|AY271690.1| HIV-1 clone pBD6.15 from Cameroon, complete genome	40	4.5
440	gb|AY118166.1| HIV-1 isolate 97ZA009 from South Africa, complete...	40	4.5
441	gb|AY118165.1| HIV-1 isolate 97ZA003 from South Africa, complete...	40	4.5
442	gb|AF530576.1| HIV-1 isolate 99TH.R2399 subtype CRF15_01B from T...	40	4.5
443	gb|AF197341.1| HIV-1 isolate 90CF4071 from Central African Repub...	40	4.5
444	gb|AF197340.1| HIV-1 isolate 90CF11697 from Central African Repu...	40	4.5
445	gb|AF197339.1| HIV-1 isolate 93TH065 from Thailand, complete genome	40	4.5
446	gb|AY352275.1| HIV-1 isolate SF33 from USA, complete genome	40	4.5
447	gb|AF224507.1| HIV-1 strain HIV-1wk from Korea, complete genome	40	4.5
448	emb|AL121894.26|HSA218C14 Human DNA sequence from clone RP11-218...	40	4.5
449	gb|AY161894.1| HIV-1 isolate 00PTHGO21 from Portugal gag protein...	40	4.5
450	gb|AY161892.1| HIV-1 isolate 00PTHSM18 from Portugal gag protein...	40	4.5
451	gb|AY161891.1| HIV-1 isolate 00PTHSM17 from Portugal gag protein...	40	4.5
452	gb|AY161890.1| HIV-1 isolate 00PTHDE15 from Portugal gag protein...	40	4.5
453	gb|AY161889.1| HIV-1 isolate 00PTHDE14 from Portugal gag protein...	40	4.5
454	gb|AY161887.1| HIV-1 isolate 00PTHDE10 from Portugal gag protein...	40	4.5
455	gb|AY161886.1| HIV-1 isolate 00PTHDE9 from Portugal gag protein ...	40	4.5
456	gb|AY161885.1| HIV-1 isolate 00PTHGO7 from Portugal gag protein ...	40	4.5
457	gb|AY161884.1| HIV-1 isolate 00PTHSM6 from Portugal gag protein ...	40	4.5
458	gb|AY161883.1| HIV-1 isolate 00PTHSM5 from Portugal gag protein ...	40	4.5
459	gb|AY161882.1| HIV-1 isolate 00PTHSM4 from Portugal gag protein ...	40	4.5
460	gb|AY161880.1| HIV-1 isolate 00PTHDE1 from Portugal gag protein ...	40	4.5
461	gb|AF003888.1| HIV-1 chimeric molecular clone, complete sequence	40	4.5
462	gb|AF003887.1| HIV-1 chimeric molecular clone, complete sequence	40	4.5
463	ref|XM_783411.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	4.5
464	emb|X70519.1|HIVT1RNA Human Immunodeficiency virus type 1 RNA, 5...	40	4.5
465	emb|X04415.1|HIVMALCG Human lymphadenopathy virus (MAL isolate),...	40	4.5
466	emb|X01762.1|REHTLV3 Human T-cell leukaemia type III (HTLV-III) ...	40	4.5
467	gb|AY882421.1| HIV-1 isolate 9196/01 from Germany, complete genome	40	4.5
468	gb|AF423755.1| HIV-1 isolate X254 from Spain, complete genome	40	4.5
469	gb|AF423760.1| HIV-1 isolate X558 from Spain, complete genome	40	4.5
470	gb|AF423759.1| HIV-1 isolate X477 from Spain, complete genome	40	4.5
471	gb|AF423758.1| HIV-1 isolate X475 from Spain, complete genome	40	4.5
472	gb|AF423757.1| HIV-1 isolate X421 from Spain, complete genome	40	4.5
473	gb|AF423756.1| HIV-1 isolate X397 from Spain, complete genome	40	4.5
474	gb|AF450098.1| HIV-1 isolate X138 from Spain, complete genome	40	4.5
475	gb|AF450097.1| HIV-1 isolate X623 from Spain, complete genome	40	4.5
476	gb|AF450096.1| HIV-1 isolate X605 from Spain, complete genome	40	4.5
477	gb|AF442570.1| HIV-1 clone TZBFL0088 from Tanzania, partial genome	40	4.5
478	gb|AF442568.1| HIV-1 clone TZBFL0169 from Tanzania, partial genome	40	4.5
479	gb|AF442567.1| HIV-1 clone TZBFL0170 from Tanzania, partial genome	40	4.5
480	gb|AF442566.1| HIV-1 clone TZBFL0086 from Tanzania, partial genome	40	4.5
481	gb|DQ007903.1| HIV-1 isolate 02HNsc11 from China, complete genome	40	4.5
482	gb|DQ007902.1| HIV-1 isolate 02HNsq4 from China, complete genome	40	4.5
483	gb|DQ007901.1| HIV-1 isolate 02HNsmx2 from China, complete genome	40	4.5
484	gb|DQ445637.1| HIV-1 isolate 04ZAPS198MB1 from South Africa, com...	40	4.5
485	gb|DQ445636.1| HIV-1 isolate 04ZAPS178MB1 from South Africa, com...	40	4.5
486	gb|DQ445634.1| HIV-1 isolate 03ZAPS059MB2 from South Africa, com...	40	4.5
487	gb|DQ445633.1| HIV-1 isolate 03ZAPS032MB1 from South Africa, com...	40	4.5
488	gb|DQ445632.1| HIV-1 isolate 03ZAPS105MB2 from South Africa, com...	40	4.5
489	gb|DQ445631.1| HIV-1 isolate 04ZASK152MB1 from South Africa, com...	40	4.5
490	emb|AJ006287.1|HIV6287 Human immnunodeficiency virus type 1 comp...	40	4.5
491	emb|AJ508597.1|HIM508597 Human immunodeficiency virus type 1 com...	40	4.5
492	emb|AJ320484.1|HIM320484 Human immunodeficiency virus type 1 com...	40	4.5
493	emb|AJ294941.1|HIM294941 Human immunodeficiency virus type 1 pro...	40	4.5
494	emb|AJ294940.1|HIM294940 Human immunodeficiency virus type 1 pro...	40	4.5
495	emb|AJ293865.1|HIM293865 Human immunodeficiency virus type 1 gen...	40	4.5
496	emb|AJ291720.1|HIM291720 Human immunodeficiency virus type 1 com...	40	4.5
497	emb|AJ288981.1|HIM288981 Human immunodeficiency virus type 1 com...	40	4.5
498	emb|AJ276596.1|HIM276596 HIV-1 proviral gag gene, pol gene, vif ...	40	4.5
499	emb|AJ276595.1|HIM276595 HIV-1 proviral gag gene, pol gene, vif ...	40	4.5
500	emb|AJ271445.1|HIM271445 Human immunodeficiency virus type 1 pro...	40	4.5

---

>gb|AY314060.1| HIV-1 isolate WC10C-9 from USA, complete genome
          Length = 8964

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 78  tccccttctagcctccgctagtc 100
           |||||||||||||||||||||||
Sbjct: 231 tccccttctagcctccgctagtc 209

---

>gb|AY314057.1| HIV-1 isolate WC10C-5 from USA, complete genome
          Length = 8964

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 78  tccccttctagcctccgctagtc 100
           |||||||||||||||||||||||
Sbjct: 231 tccccttctagcctccgctagtc 209

---

>gb|AF061642.1|AF061642 HIV-1 isolate SE6165 from Sweden, complete genome
          Length = 9074

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 78  tccccttctagcctccgctagtc 100
           |||||||||||||||||||||||
Sbjct: 189 tccccttctagcctccgctagtc 167

---

>gb|AY451097.1| HIV-1 isolate B97X9/30 from USA gag protein (gag) gene, partial
           sequence
          Length = 516

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 81  ccttctagcctccgctagtcta 102
           ||||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtcta 56

---

>gb|AY161881.1| HIV-1 isolate 00PTHDF2 from Portugal gag protein (gag) gene,
           partial cds
          Length = 580

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 80  cccttctagcctccgctagtc 100
           |||||||||||||||||||||
Sbjct: 102 cccttctagcctccgctagtc 82

---

>gb|AY456324.1| HIV-1 isolate 01AOHDC232 from Angola gag protein (gag) gene,
           partial cds
          Length = 563

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 80  cccttctagcctccgctagtc 100
           |||||||||||||||||||||
Sbjct: 100 cccttctagcctccgctagtc 80

---

>gb|AY528646.1| Synthetic construct HIV-1 derived gag protein (gag) gene, complete
           cds; pol protein (pol) gene, partial cds; and tat
           protein (tat), rev protein (rev), vpu protein (vpu), and
           envelope protein (env) genes, complete cds
          Length = 6640

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 99  ccttctagcctccgctagtc 80

---

>gb|AY817688.1| HIV-1 isolate 2102 from Sweden 5' LTR and gag protein (gag) gene,
           partial cds
          Length = 404

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 320 ccttctagcctccgctagtc 301

---

>gb|AY314063.1| HIV-1 isolate WC10C-12 from USA, complete genome
          Length = 8973

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314062.1| HIV-1 isolate WC10C-11 from USA, complete genome
          Length = 8997

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314061.1| HIV-1 isolate WC10C-10 from USA, complete genome
          Length = 8964

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314059.1| HIV-1 isolate WC10C-8 from USA, complete genome
          Length = 8970

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314058.1| HIV-1 isolate WC10C-6 from USA, complete genome
          Length = 8970

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314056.1| HIV-1 isolate WC10C-4 from USA, complete genome
          Length = 9003

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314055.1| HIV-1 isolate WC10C-3 from USA, complete genome
          Length = 8997

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314054.1| HIV-1 isolate WC10C-1 from USA, complete genome
          Length = 8967

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314053.1| HIV-1 isolate WC10P-11 from USA, complete genome
          Length = 8985

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314052.1| HIV-1 isolate WC10P-10 from USA, complete genome
          Length = 8988

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314051.1| HIV-1 isolate WC10P-9 from USA, complete genome
          Length = 8982

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314050.1| HIV-1 isolate WC10P-8 from USA, complete genome
          Length = 8982

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314049.1| HIV-1 isolate WC10P-7 from USA, complete genome
          Length = 8982

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314048.1| HIV-1 isolate WC10P-6 from USA, complete genome
          Length = 8988

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314047.1| HIV-1 isolate WC10P-4 from USA, complete genome
          Length = 8985

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314046.1| HIV-1 isolate WC10P-3 from USA, complete genome
          Length = 8988

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314045.1| HIV-1 isolate WC10P-2 from USA, complete genome
          Length = 8985

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY314044.1| HIV-1 isolate WC10P-1 from USA, complete genome
          Length = 8982

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 228 ccttctagcctccgctagtc 209

---

>gb|AY819715.1| HIV-1 isolate 04RU139095 from Russia, complete genome
          Length = 8960

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 150 ccttctagcctccgctagtc 131

---

>gb|AY772986.1| HIV-1 clone M428gag from Kenya gag protein (gag) gene, complete cds
          Length = 1619

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 72  ccttctagcctccgctagtc 53

---

>gb|AY772984.1| HIV-1 clone M389_clone11 from Kenya nonfunctional gag protein (gag)
           gene, complete sequence
          Length = 1586

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 60  ccttctagcctccgctagtc 41

---

>gb|AY772983.1| HIV-1 clone M389_clone5 from Kenya gag protein (gag) gene, complete
           cds
          Length = 1562

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 66  ccttctagcctccgctagtc 47

---

>gb|AY772982.1| HIV-1 clone M389_clone9 from Kenya gag protein (gag) gene, complete
           cds
          Length = 1602

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 71  ccttctagcctccgctagtc 52

---

>gb|AY772981.1| HIV-1 clone M389_clone23 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1599

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 67  ccttctagcctccgctagtc 48

---

>gb|AY772980.1| HIV-1 clone M389_16 from Kenya nonfunctional gag protein (gag)
           gene, complete sequence
          Length = 1603

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 72  ccttctagcctccgctagtc 53

---

>gb|AY772979.1| HIV-1 clone M389_clone10 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1593

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 71  ccttctagcctccgctagtc 52

---

>gb|AY772976.1| HIV-1 clone M389_clone35 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1579

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 64  ccttctagcctccgctagtc 45

---

>gb|AY772975.1| HIV-1 clone M389_clone22 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1587

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 71  ccttctagcctccgctagtc 52

---

>gb|AY772974.1| HIV-1 clone M389_clone20 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1587

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 71  ccttctagcctccgctagtc 52

---

>gb|AY772973.1| HIV-1 clone M389_clone17 from Kenya gag protein (gag) gene,
           complete cds
          Length = 1588

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 72  ccttctagcctccgctagtc 53

---

>gb|AY772971.1| HIV-1 clone M369gag from Kenya gag protein (gag) gene, partial cds
          Length = 1644

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 82  ccttctagcctccgctagtc 63

---

>gb|AY772970.1| HIV-1 clone M264_gag from Kenya gag protein (gag) gene, complete
           cds
          Length = 1634

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|AY772955.1| HIV-1 clone M141gag from Kenya gag protein (gag) gene, complete cds
          Length = 1648

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ234790.1| HIV-1 isolate HK001 from Hong Kong, complete genome
          Length = 9056

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 160 ccttctagcctccgctagtc 141

---

>gb|AY818644.1| HIV-1 isolate Phcsffull04 from Australia, complete genome
          Length = 8967

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 222 ccttctagcctccgctagtc 203



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY818643.1| HIV-1 isolate Ph01full from Australia, complete genome
          Length = 8820

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY818642.1| HIV-1 isolate Ph99full from Australia, complete genome
          Length = 8820

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY818641.1| HIV-1 isolate Ph00full from Australia, complete genome
          Length = 8820

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY968312.1| HIV-1 isolate ARE195FL from Argentina, complete genome
          Length = 8834

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 92  ccttctagcctccgctagtc 73

---

>gb|DQ149132.1| HIV-1 isolate IR-176-2 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ149131.1| HIV-1 isolate IR-176-1-r from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ149130.1| HIV-1 isolate IR-176-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ149129.1| HIV-1 isolate IR-176-5-n-r from Iran nonfunctional gag protein
           (gag) gene, partial sequence
          Length = 530

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ149128.1| HIV-1 isolate IR-176-5-n from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 530

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|AY751407.1| HIV-1 isolate 04RU139089 from Russia, complete genome
          Length = 8960

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 156 ccttctagcctccgctagtc 137

---

>gb|AY751406.1| HIV-1 isolate 04RU129005 from Russia, complete genome
          Length = 9160

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 269 ccttctagcctccgctagtc 250

---

>gb|AY779564.1| HIV-1 isolate CANA1FULL from Canada, complete genome
          Length = 8720

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779563.1| HIV-1 isolate CANC8FULL from Canada, complete genome
          Length = 8714

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779562.1| HIV-1 isolate CANC6FULL from Canada, complete genome
          Length = 8711

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779561.1| HIV-1 isolate CANC5FULL from Canada, complete genome
          Length = 8708

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779560.1| HIV-1 isolate CANC3FULL from Canada, complete genome
          Length = 8717

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779557.1| HIV-1 isolate CANC10FULL from Canada, complete genome
          Length = 8711

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779555.1| HIV-1 isolate CANB5FULL from Canada, complete genome
          Length = 8693

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779553.1| HIV-1 isolate CANB3FULL from Canada, complete genome
          Length = 8687

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779552.1| HIV-1 isolate CANA6FULL from Canada, complete genome
          Length = 8780

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779551.1| HIV-1 isolate CANA5FULL from Canada, complete genome
          Length = 8765

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY779550.1| HIV-1 isolate CANA3FULL from Canada, complete genome
          Length = 8765

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 63  ccttctagcctccgctagtc 44

---

>gb|AY118161.1| HIV-1 isolate 93CB76 from the Caribbean, 5'UTR
          Length = 346

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 340 ccttctagcctccgctagtc 321

---

>gb|AY118160.1| HIV-1 isolate 94BR77 from Brazil, 5'UTR
          Length = 332

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 326 ccttctagcctccgctagtc 307

---

>gb|AY118158.1| HIV-1 isolate 93ZM45 from Zambia gag protein (gag) gene, partial
           cds
          Length = 618

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 328 ccttctagcctccgctagtc 309

---

>gb|AY118156.1| HIV-1 isolate 94LB12 from Liberia, 5'UTR
          Length = 346

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 340 ccttctagcctccgctagtc 321

---

>gb|AY118155.1| HIV-1 isolate 97TH87 from Thailand, 5'UTR
          Length = 352

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 346 ccttctagcctccgctagtc 327

---

>gb|AY118154.1| HIV-1 isolate 93UG66 from Uganda gag protein (gag) gene, partial
           cds
          Length = 709

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 330 ccttctagcctccgctagtc 311

---

>gb|AY703911.1| HIV-1 isolate 04ZASK144B1 from South Africa, complete genome
          Length = 9049

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|AY703910.1| HIV-1 isolate 04ZASK143B1 from South Africa, complete genome
          Length = 9065

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|AY703909.1| HIV-1 isolate 04ZASK134B1 from South Africa, complete genome
          Length = 9028

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|AY508158.1| HIV-1 isolate 8-H11 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508157.1| HIV-1 isolate 8-G7 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508156.1| HIV-1 isolate 8-G12 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508155.1| HIV-1 isolate 8-G11 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508154.1| HIV-1 isolate 8-F9 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508153.1| HIV-1 isolate 8-F5 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508152.1| HIV-1 isolate 8-E7 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508151.1| HIV-1 isolate 8-E3 from USA gag protein (gag) gene, partial cds
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508150.1| HIV-1 isolate 8-D11 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508149.1| HIV-1 isolate 8-C7 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508148.1| HIV-1 isolate 8-C1 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508147.1| HIV-1 isolate 8-B9 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508146.1| HIV-1 isolate 8-B8 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508144.1| HIV-1 isolate 8-B12 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508143.1| HIV-1 isolate 8-A10 from USA gag protein (gag) gene, partial cds
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508142.1| HIV-1 isolate 7-H9 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508141.1| HIV-1 isolate 7-H5 from USA gag protein (gag) gene, partial cds
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508140.1| HIV-1 isolate 7-H10 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508139.1| HIV-1 isolate 7-G8 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508137.1| HIV-1 isolate 7-F10 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508136.1| HIV-1 isolate 7-E6 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508135.1| HIV-1 isolate 7-E5 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508134.1| HIV-1 isolate 7-D12 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508133.1| HIV-1 isolate 7-C4 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508132.1| HIV-1 isolate 7-B8 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508130.1| HIV-1 isolate 7-B2 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY508129.1| HIV-1 isolate 7-B10 from USA nonfunctional gag protein (gag) gene,
           partial sequence
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508128.1| HIV-1 isolate 7-A7 from USA gag protein (gag) gene, partial cds
          Length = 459

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 117 ccttctagcctccgctagtc 98

---

>gb|AY508126.1| HIV-1 isolate 7-A5 from USA gag protein (gag) gene, partial cds
          Length = 458

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 116 ccttctagcctccgctagtc 97

---

>gb|AY531116.1| HIV-1 isolate LTG0218 clone 30 from China, complete genome
          Length = 9682

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 781 ccttctagcctccgctagtc 762

---

>gb|AY560110.1| HIV-1 isolate 98USHVTN941c1 from USA, complete genome
          Length = 8908

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 202 ccttctagcctccgctagtc 183

---

>gb|AY560109.1| HIV-1 isolate 98USHVTN8229c6 from USA, complete genome
          Length = 8892

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 208 ccttctagcctccgctagtc 189

---

>gb|AY560108.1| HIV-1 isolate 98USHVTN3605c9 from USA, complete genome
          Length = 8886

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 201 ccttctagcctccgctagtc 182

---

>gb|AY560107.1| HIV-1 isolate 98USHVTN1925c1 from USA, complete genome
          Length = 8934

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 202 ccttctagcctccgctagtc 183

---

>gb|AY322193.1| HIV-1 isolate ML752-3-1997 from Kenya, complete genome
          Length = 9082

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 241 ccttctagcctccgctagtc 222

---

>gb|AY322189.1| HIV-1 isolate ML415-2-1997 from Kenya, complete genome
          Length = 9087

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 249 ccttctagcctccgctagtc 230

---

>gb|AY322185.1| HIV-1 isolate ML013-2-1997 from Kenya, complete genome
          Length = 9082

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 242 ccttctagcctccgctagtc 223

---

>gb|AY322184.1| HIV-1 isolate ML013-10-1986 from Kenya, complete genome
          Length = 8996

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 170 ccttctagcctccgctagtc 151

---

>gb|AY682547.1| HIV-1 isolate 04RU128005 from Russia, complete genome
          Length = 9089

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 274 ccttctagcctccgctagtc 255

---

>gb|AY536238.1| HIV-1 isolate X1241 from Argentina, complete genome
          Length = 8760

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 31  ccttctagcctccgctagtc 12

---

>gb|AY536237.1| HIV-1 isolate R140 from Argentina, complete genome
          Length = 8767

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 31  ccttctagcctccgctagtc 12

---

>gb|AY536234.1| HIV-1 isolate CH6 from Chile, complete genome
          Length = 8927

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 212 ccttctagcctccgctagtc 193

---

>gb|U51188.1|HIVU51188 HIV-1 clone 90cf402 from the Central African Republic, complete
           genome
          Length = 9843

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 825 ccttctagcctccgctagtc 806

---

>gb|U51189.1|HIVU51189 HIV-1 clone 93th253 from Thailand, complete genome
          Length = 9720

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 800 ccttctagcctccgctagtc 781

---

>gb|DQ487191.1| HIV-1 isolate WCM32P0896 from USA, complete genome
          Length = 9271

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 325 ccttctagcctccgctagtc 306

---

>gb|DQ487190.1| HIV-1 isolate WCM32P0793 from USA, complete genome
          Length = 9291

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 325 ccttctagcctccgctagtc 306

---

>gb|DQ487189.1| HIV-1 isolate WCD32P1195 from USA, complete genome
          Length = 9340

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 328 ccttctagcctccgctagtc 309

---

>gb|DQ487188.1| HIV-1 isolate WCD32P0793 from USA, complete genome
          Length = 9344

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 327 ccttctagcctccgctagtc 308

---

>gb|DQ057032.1| HIV-1 isolate LT66 from Cameroon gag protein (gag) gene, partial
          cds
          Length = 451

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 78 tccccttctagcctccgcta 97
          ||||||||||||||||||||
Sbjct: 20 tccccttctagcctccgcta 1

---

>gb|DQ396400.1| HIV-1 isolate 04ZASK162B1 from South Africa, complete genome
          Length = 9109

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 215 ccttctagcctccgctagtc 196

---

>gb|DQ396399.1| HIV-1 isolate 03ZAPS152MB1 from South Africa, complete genome
          Length = 9101

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396398.1| HIV-1 isolate 03ZAPS045MB2 from South Africa, complete genome
          Length = 9031

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 215 ccttctagcctccgctagtc 196

---

>gb|DQ396397.1| HIV-1 isolate 04ZASK201B1 from South Africa, complete genome
          Length = 9050

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396396.1| HIV-1 isolate 04ZASK193B1 from South Africa, complete genome
          Length = 9083

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 216 ccttctagcctccgctagtc 197

---

>gb|DQ396395.1| HIV-1 isolate 03ZASK104B1 from South Africa, complete genome
          Length = 9047

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396394.1| HIV-1 isolate 04ZAPS177MB1 from South Africa, complete genome
          Length = 9055

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396393.1| HIV-1 isolate 04ZAPS169MB1 from South Africa, complete genome
          Length = 9044

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396392.1| HIV-1 isolate 03ZAPS151MB1 from South Africa, complete genome
          Length = 9063

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 219 ccttctagcctccgctagtc 200

---

>gb|DQ396391.1| HIV-1 isolate 03ZAPS143MB1 from South Africa, complete genome
          Length = 9075

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396390.1| HIV-1 isolate 03ZAPS125MB1 from South Africa, complete genome
          Length = 9047

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 219 ccttctagcctccgctagtc 200

---

>gb|DQ396389.1| HIV-1 isolate 03ZAPS067MB2 from South Africa, complete genome
          Length = 9057

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396387.1| HIV-1 isolate 04ZASK165B1 from South Africa, complete genome
          Length = 9086

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396386.1| HIV-1 isolate 03ZAPS112MB2 from South Africa, complete genome
          Length = 9100

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396385.1| HIV-1 isolate 03ZAPS051MB1 from South Africa, complete genome
          Length = 9012

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 219 ccttctagcctccgctagtc 200

---

>gb|DQ396384.1| HIV-1 isolate 03ZAPS044MB1 from South Africa, complete genome
          Length = 9007

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396383.1| HIV-1 isolate 04ZASK200B1 from South Africa, complete genome
          Length = 9006

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396381.1| HIV-1 isolate 04ZASK169B1 from South Africa, complete genome
          Length = 9070

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396380.1| HIV-1 isolate 03ZAPS131MB1 from South Africa, complete genome
          Length = 9041

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396379.1| HIV-1 isolate 03ZAPS11MB2 from South Africa, complete genome
          Length = 6859

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396378.1| HIV-1 isolate 03ZAPS108MB1 from South Africa, complete genome
          Length = 9031

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396376.1| HIV-1 isolate 03ZAPS071MB1 from South Africa, complete genome
          Length = 8991

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396375.1| HIV-1 isolate 03ZAPS066MB2 from South Africa, complete genome
          Length = 9105

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396374.1| HIV-1 isolate 03ZAPS056MB1 from South Africa, complete genome
          Length = 9053

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396373.1| HIV-1 isolate 03ZAPS055MB1 from South Africa, complete genome
          Length = 9064

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396372.1| HIV-1 isolate 05ZASK243B1 from South Africa, complete genome
          Length = 9077

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396371.1| HIV-1 isolate 03ZAPS155MB1 from South Africa, complete genome
          Length = 9008

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396369.1| HIV-1 isolate 03ZAPS123MB1 from South Africa, complete genome
          Length = 9027

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396368.1| HIV-1 isolate 03ZAPS118MB1 from South Africa, complete genome
          Length = 9071

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396367.1| HIV-1 isolate 03ZAPS024MB1 from South Africa, complete genome
          Length = 9050

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ396366.1| HIV-1 isolate 04ZASK052MB2 from South Africa, complete genome
          Length = 9039

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 218 ccttctagcctccgctagtc 199

---

>gb|DQ396365.1| HIV-1 isolate 03ZAPS113MB2 from South Africa, complete genome
          Length = 9081

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 219 ccttctagcctccgctagtc 200

---

>gb|DQ396364.1| HIV-1 isolate 03ZAPS048MB1 from South Africa, complete genome
          Length = 9068

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 217 ccttctagcctccgctagtc 198

---

>gb|DQ115707.1| HIV-1 isolate IR-g-146-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 526

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115706.1| HIV-1 isolate IR-g-146-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 526

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115705.1| HIV-1 isolate IR-g-169-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115704.1| HIV-1 isolate IR-g-169-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115703.1| HIV-1 isolate IR-g-169-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115702.1| HIV-1 isolate IR-g-169-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115701.1| HIV-1 isolate IR-g-174-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115700.1| HIV-1 isolate IR-g-174-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115699.1| HIV-1 isolate IR-g-174-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115698.1| HIV-1 isolate IR-g-174-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115695.1| HIV-1 isolate IR-g-141-6 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115694.1| HIV-1 isolate IR-g-141-2 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115693.1| HIV-1 isolate IR-g-170-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115692.1| HIV-1 isolate IR-g-170-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 522

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 75  ccttctagcctccgctagtc 56

---

>gb|DQ115691.1| HIV-1 isolate IR-g-170-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115690.1| HIV-1 isolate IR-g-170-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115689.1| HIV-1 isolate IR-g-130-7 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115688.1| HIV-1 isolate IR-g-130-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 522

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 75  ccttctagcctccgctagtc 56

---

>gb|DQ115687.1| HIV-1 isolate IR-g-130-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115686.1| HIV-1 isolate IR-g-130-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115685.1| HIV-1 isolate IR-g-175-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115684.1| HIV-1 isolate IR-g-175-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115683.1| HIV-1 isolate IR-g-175-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115682.1| HIV-1 isolate IR-g-175-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115681.1| HIV-1 isolate IR-g-188-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115680.1| HIV-1 isolate IR-g-188-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115679.1| HIV-1 isolate IR-g-188-2 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 521

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 75  ccttctagcctccgctagtc 56

---

>gb|DQ115678.1| HIV-1 isolate IR-g-188-4 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 522

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115677.1| HIV-1 isolate IR-g-138-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115676.1| HIV-1 isolate IR-g-138-6 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115675.1| HIV-1 isolate IR-g-138-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 522

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 75  ccttctagcctccgctagtc 56

---

>gb|DQ115674.1| HIV-1 isolate IR-g-128-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115673.1| HIV-1 isolate IR-g-128-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 522

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 75  ccttctagcctccgctagtc 56

---

>gb|DQ115672.1| HIV-1 isolate IR-g-128-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115671.1| HIV-1 isolate IR-g-128-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115670.1| HIV-1 isolate IR-g-158-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115669.1| HIV-1 isolate IR-g-158-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115668.1| HIV-1 isolate IR-g-158-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115667.1| HIV-1 isolate IR-g-143-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115666.1| HIV-1 isolate IR-g-143-6 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115665.1| HIV-1 isolate IR-g-143-2 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115664.1| HIV-1 isolate IR-g-143-1 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115663.1| HIV-1 isolate IR-g-151-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ115662.1| HIV-1 isolate IR-g-151-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ115661.1| HIV-1 isolate IR-g-51-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ115660.1| HIV-1 isolate IR-g-151-22c from Iran gag protein (gag) gene,
           partial cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ115659.1| HIV-1 isolate IR-g-151-20c from Iran gag protein (gag) gene,
           partial cds
          Length = 525

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ115658.1| HIV-1 isolate IR-g-172-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115657.1| HIV-1 isolate IR-g-172-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115656.1| HIV-1 isolate IR-g-172-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115655.1| HIV-1 isolate IR-g-172-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115654.1| HIV-1 isolate IR-g-166-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115653.1| HIV-1 isolate IR-g-166-6 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115652.1| HIV-1 isolate IR-g-166-3 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115651.1| HIV-1 isolate IR-g-166-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ115650.1| HIV-1 isolate IR-g-112-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 512

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115649.1| HIV-1 isolate IR-g-112-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 512

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115648.1| HIV-1 isolate IR-g-112-6 from Iran gag protein (gag) gene, partial
           cds
          Length = 512

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ115647.1| HIV-1 isolate IR-g-186-7 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ115646.1| HIV-1 isolate IR-g-186-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ077872.1| HIV-1 isolate IR-g-150 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077870.1| HIV-1 isolate IR-g-150-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077867.1| HIV-1 isolate IR-g-147-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077866.1| HIV-1 isolate IR-g-147-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077865.1| HIV-1 isolate IR-g-147-6 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077864.1| HIV-1 isolate IR-g-147-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077863.1| HIV-1 isolate IR-g-153-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077862.1| HIV-1 isolate IR-g-153 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077861.1| HIV-1 isolate IR-g-153-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077860.1| HIV-1 isolate IR-g-153-1 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077859.1| HIV-1 isolate IR-g-155-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077858.1| HIV-1 isolate IR-g-155-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077857.1| HIV-1 isolate IR-g-155-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077856.1| HIV-1 isolate IR-g-155-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077855.1| HIV-1 isolate IR-g-196-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077851.1| HIV-1 isolate IR-g-154 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077850.1| HIV-1 isolate IR-g-154-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077849.1| HIV-1 isolate IR-g-154-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077848.1| HIV-1 isolate IR-g-144-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077847.1| HIV-1 isolate IR-g-144-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077846.1| HIV-1 isolate IR-g-163-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 520

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077845.1| HIV-1 isolate IR-g-163-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 521

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077844.1| HIV-1 isolate IR-g-163-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 521

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 77  ccttctagcctccgctagtc 58

---

>gb|DQ077843.1| HIV-1 isolate IR-g-165-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077842.1| HIV-1 isolate IR-g-165-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077840.1| HIV-1 isolate IR-g-149-4 from Iran gag protein (gag) gene, partial
           cds
          Length = 543

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ077839.1| HIV-1 isolate IR-g-149-1 from Iran gag protein (gag) gene, partial
           cds
          Length = 543

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ077838.1| HIV-1 isolate IR-g-149-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 543

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 78  ccttctagcctccgctagtc 59

---

>gb|DQ077837.1| HIV-1 isolate IR-g-176-1 from Iran nonfunctional gag protein (gag)
           gene, partial sequence
          Length = 530

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ077836.1| HIV-1 isolate IR-g-176-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ077835.1| HIV-1 isolate IR-g-176-5 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ077834.1| HIV-1 isolate IR-g-176-2 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60

---

>gb|DQ077833.1| HIV-1 isolate IR-g-148 from Iran gag protein (gag) gene, partial
           cds
          Length = 523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 76  ccttctagcctccgctagtc 57

---

>gb|DQ077832.1| HIV-1 isolate IR-g-139-3 from Iran gag protein (gag) gene, partial
           cds
          Length = 529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 81  ccttctagcctccgctagtc 100
           ||||||||||||||||||||
Sbjct: 79  ccttctagcctccgctagtc 60


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,492,373
Number of Sequences: 3902068
Number of extensions: 2492373
Number of successful extensions: 47674
Number of sequences better than 10.0: 1371
Number of HSP's better than 10.0 without gapping: 1371
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46234
Number of HSP's gapped (non-prelim): 1440
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---