ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl23g02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC087761.6| Homo sapiens chromosome 15, clone RP11-2E17, comp... 38 0.56
2gb|AC012337.8| Homo sapiens chromosome , clone RP11-119O22, comp... 38 0.56
3gb|AC087553.3| Oryza sativa (japonica cultivar-group) chromosome... 36 2.2
4gb|AC134926.3| Oryza sativa (japonica cultivar-group) chromosome... 36 2.2
5ref|XM_956431.1| Neurospora crassa OR74A hypothetical protein (N... 36 2.2
6ref|XM_326650.1| Neurospora crassa OR74A hypothetical protein (N... 36 2.2
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 36 2.2
8emb|CR848726.6| Zebrafish DNA sequence from clone CH211-244M8 in... 36 2.2
9gb|AC147499.5| Medicago truncatula clone mth2-22h5, complete seq... 36 2.2
10emb|AL157696.27| Human DNA sequence from clone RP11-454P4 on chr... 36 2.2
11gb|AC087412.14| Oryza sativa chromosome 3 BAC OSJNBb0070O09 geno... 36 2.2
12emb|AL929357.1|PFA929357 Plasmodium falciparum strain 3D7, chrom... 36 2.2
13emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cos... 36 2.2
14gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome... 36 2.2
15gb|AC149634.8| Medicago truncatula clone mth2-5i17, complete seq... 36 2.2
16gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete seq... 36 2.2
17gb|AC096920.2| Homo sapiens chromosome 3 clone RP11-804H8, compl... 36 2.2
18dbj|AK160338.1| Mus musculus 12 days embryo embryonic body betwe... 36 2.2
19ref|XM_685913.1| PREDICTED: Danio rerio similar to TPR domain, a... 36 2.2
20gb|AC010596.8| Homo sapiens chromosome 5 clone CTC-483B24, compl... 36 2.2
21emb|AL115116.1|CNS01C5W Botrytis cinerea strain T4 cDNA library 36 2.2
22dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 36 2.2
23dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 36 2.2
24dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 36 2.2
25dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 36 2.2
26gb|AC009365.9|AC009365 Homo sapiens chromosome 7 clone RP11-355K... 36 2.2
27emb|AL713904.3|CNS07YQ4 Oryza sativa chromosome 12, . BAC OJ1306... 36 2.2
28gb|AC158772.5| Mus musculus chromosome 18, clone RP23-291M14, co... 36 2.2
29gb|AC110248.22| Mus musculus chromosome 3, clone RP23-257P11, co... 36 2.2
30gb|AC115692.6| Mus musculus chromosome 18, clone RP23-463G11, co... 36 2.2
31gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 36 2.2
32gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 36 2.2
33emb|AL731743.2|CNS08C7S Oryza sativa chromosome 12, . BAC OSJNBa... 36 2.2
34emb|Z74618.1|HSLUCA1 Human DNA sequence from clone XXcos-1 on ch... 36 2.2
35gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, com... 34 8.7
36gb|AC163099.5| Mus musculus chromosome 8, clone RP23-395L6, comp... 34 8.7
37gb|AC102862.7| Mus musculus chromosome 8, clone RP24-535D22, com... 34 8.7
38gb|BT019209.1| Zea mays clone Contig882.F mRNA sequence 34 8.7
39gb|BC076645.1| Xenopus laevis B-cell receptor-associated protein... 34 8.7
40gb|AY216939.1| Plasmodium vivax strain Belem YAC1H14-like sequence 34 8.7
41gb|AY216938.1| Plasmodium vivax strain IndiaVII YAC1H14-like seq... 34 8.7
42gb|AY216937.1| Plasmodium vivax strain Salvador I YAC1H14-like s... 34 8.7
43gb|AY216936.1| Plasmodium vivax strain Thai-NYU YAC1H14-like seq... 34 8.7
44gb|AE008456.1| Streptococcus pneumoniae R6 section 72 of 184 of ... 34 8.7
45gb|AC135924.2| Oryza sativa (japonica cultivar-group) chromosome... 34 8.7
46gb|AC093440.2| Drosophila melanogaster clone BACR34H03, complete... 34 8.7
47gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 34 8.7
48gb|U39651.1| Caenorhabditis elegans cosmid ZK470, complete sequence 34 8.7
49gb|AC122401.3| Mus musculus chromosome 15 clone RP24-107E24, com... 34 8.7
50gb|AY150217.1| Ambystoma tigrinum stebbensi virus, complete genome 34 8.7
51gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, compl... 34 8.7
52gb|AC146866.6| Medicago truncatula clone mth2-19a14, complete se... 34 8.7
53emb|AL592424.13| Human DNA sequence from clone RP11-68I18 on chr... 34 8.7
54emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome;... 34 8.7
55gb|AC125362.6| Homo sapiens 3 BAC RP11-279P10 (Roswell Park Canc... 34 8.7
56gb|AC144743.4| Oryza sativa (japonica cultivar-group) chromosome... 34 8.7
57gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 34 8.7
58gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell... 34 8.7
59gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell P... 34 8.7
60gb|AY003872.1| Plasmodium vivax YAC 1H14, complete sequence 34 8.7
61gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 34 8.7
62emb|AL113490.1|CNS01AWQ Botrytis cinerea strain T4 cDNA library 34 8.7
63dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 34 8.7
64gb|AC007739.2| Homo sapiens BAC clone RP11-91L3 from 2, complete... 34 8.7
65gb|AC008056.6|AC008056 Homo sapiens chromosome 14 clone RP11-242... 34 8.7
66emb|AJ339735.1|HSA339735 Homo sapiens genomic sequence surroundi... 34 8.7
67emb|BX908394.9| Zebrafish DNA sequence from clone DKEY-106H23 in... 34 8.7
68gb|AY109228.1| Zea mays PCO111190 mRNA sequence 34 8.7
69emb|CR962125.2| Medicago truncatula chromosome 5 clone mth2-179a... 34 8.7
70gb|AE003667.3| Drosophila melanogaster chromosome 2L, section 76... 34 8.7
71gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 ... 34 8.7
72gb|AC002443.1|AC002443 Drosophila melanogaster DNA sequence (P1 ... 34 8.7
73emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4,... 34 8.7
74gb|BC110709.1| Xenopus laevis cDNA clone MGC:130706 IMAGE:798113... 34 8.7
75dbj|AP002956.1| Homo sapiens genomic DNA, chromosome 11q clone:R... 34 8.7
76emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on ch... 34 8.7
77gb|AC100778.5| Homo sapiens chromosome 18, clone RP11-110H1, com... 34 8.7 
>gb|AC087761.6| Homo sapiens chromosome 15, clone RP11-2E17, complete sequence
          Length = 153740

 Score = 38.2 bits (19), Expect = 0.56
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 2    ctttttgccccctttttgc 20
            |||||||||||||||||||
Sbjct: 1661 ctttttgccccctttttgc 1643
to top
>gb|AC012337.8| Homo sapiens chromosome , clone RP11-119O22, complete sequence
          Length = 171695

 Score = 38.2 bits (19), Expect = 0.56
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     ctttttgccccctttttgc 20
             |||||||||||||||||||
Sbjct: 44979 ctttttgccccctttttgc 44961
to top
>gb|AC087553.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0685E10,
             complete sequence
          Length = 156772

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ctttttgcagcttaggct 30
             ||||||||||||||||||
Sbjct: 40804 ctttttgcagcttaggct 40821
to top
>gb|AC134926.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0056I10, complete sequence
          Length = 158833

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ctttttgcagcttaggct 30
             ||||||||||||||||||
Sbjct: 64149 ctttttgcagcttaggct 64166
to top
>ref|XM_956431.1| Neurospora crassa OR74A hypothetical protein (NCU01158.1) partial
            mRNA
          Length = 2847

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 3    tttttgccccctttttgc 20
            ||||||||||||||||||
Sbjct: 2705 tttttgccccctttttgc 2688
to top
>ref|XM_326650.1| Neurospora crassa OR74A hypothetical protein (NCU01158.1) partial
            mRNA
          Length = 2847

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 3    tttttgccccctttttgc 20
            ||||||||||||||||||
Sbjct: 2705 tttttgccccctttttgc 2688
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 3        tttttgccccctttttgc 20
                ||||||||||||||||||
Sbjct: 26905729 tttttgccccctttttgc 26905712
to top
>emb|CR848726.6| Zebrafish DNA sequence from clone CH211-244M8 in linkage group 2,
            complete sequence
          Length = 155408

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   ccctttttgcagcttagg 28
            ||||||||||||||||||
Sbjct: 1075 ccctttttgcagcttagg 1092
to top
>gb|AC147499.5| Medicago truncatula clone mth2-22h5, complete sequence
          Length = 128625

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 2     ctttttgccccctttttg 19
             ||||||||||||||||||
Sbjct: 30340 ctttttgccccctttttg 30357
to top
>emb|AL157696.27| Human DNA sequence from clone RP11-454P4 on chromosome 13, complete
             sequence
          Length = 84231

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     cctttttgcccccttttt 18
             ||||||||||||||||||
Sbjct: 53567 cctttttgcccccttttt 53550
to top
>gb|AC087412.14| Oryza sativa chromosome 3 BAC OSJNBb0070O09 genomic sequence, complete
             sequence
          Length = 149303

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     tttttgccccctttttgc 20
             ||||||||||||||||||
Sbjct: 84729 tttttgccccctttttgc 84712
to top
>emb|AL929357.1|PFA929357 Plasmodium falciparum strain 3D7, chromosome 9; segment 3/5
          Length = 341050

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     cctttttgcccccttttt 18
             ||||||||||||||||||
Sbjct: 71690 cctttttgcccccttttt 71673
to top
>emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cosmid contig 123A4
          Length = 153794

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     tttttgccccctttttgc 20
             ||||||||||||||||||
Sbjct: 67034 tttttgccccctttttgc 67017
to top
>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04,
              complete sequence
          Length = 136713

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     ctttttgcagcttaggct 30
              ||||||||||||||||||
Sbjct: 129019 ctttttgcagcttaggct 129036
to top
>gb|AC149634.8| Medicago truncatula clone mth2-5i17, complete sequence
          Length = 116601

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 2     ctttttgccccctttttg 19
             ||||||||||||||||||
Sbjct: 98282 ctttttgccccctttttg 98299
to top
>gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete sequence
          Length = 129121

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      ctttttgccccctttttg 19
              ||||||||||||||||||
Sbjct: 108255 ctttttgccccctttttg 108272
to top
>gb|AC096920.2| Homo sapiens chromosome 3 clone RP11-804H8, complete sequence
          Length = 192324

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     tgccccctttttgcagct 24
             ||||||||||||||||||
Sbjct: 96920 tgccccctttttgcagct 96937
to top
>dbj|AK160338.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430068N19 product:nicastrin, full insert sequence
          Length = 1551

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1    cctttttgcccccttttt 18
            ||||||||||||||||||
Sbjct: 1040 cctttttgcccccttttt 1057
to top
>ref|XM_685913.1| PREDICTED: Danio rerio similar to TPR domain, ankyrin-repeat and
           coiled-coil-containing (LOC562534), mRNA
          Length = 2200

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 5   tttgccccctttttgcag 22
           ||||||||||||||||||
Sbjct: 494 tttgccccctttttgcag 477
to top
>gb|AC010596.8| Homo sapiens chromosome 5 clone CTC-483B24, complete sequence
          Length = 165193

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 4     ttttgccccctttttgcagctt 25
             ||||||||| ||||||||||||
Sbjct: 85899 ttttgccccttttttgcagctt 85920
to top
>emb|AL115116.1|CNS01C5W Botrytis cinerea strain T4 cDNA library
          Length = 816

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 2   ctttttgccccctttttg 19
           ||||||||||||||||||
Sbjct: 794 ctttttgccccctttttg 811
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 1        cctttttgcccccttttt 18
                ||||||||||||||||||
Sbjct: 25117144 cctttttgcccccttttt 25117127
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 13       ctttttgcagcttaggct 30
                ||||||||||||||||||
Sbjct: 18328784 ctttttgcagcttaggct 18328801
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 13      ctttttgcagcttaggct 30
               ||||||||||||||||||
Sbjct: 4154325 ctttttgcagcttaggct 4154342



 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                 
Query: 3        tttttgccccctttttg 19
                |||||||||||||||||
Sbjct: 23178593 tttttgccccctttttg 23178577
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 3        tttttgccccctttttgc 20
                ||||||||||||||||||
Sbjct: 26997052 tttttgccccctttttgc 26997035
to top
>gb|AC009365.9|AC009365 Homo sapiens chromosome 7 clone RP11-355K3, complete sequence
          Length = 222794

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      tttgccccctttttgcag 22
              ||||||||||||||||||
Sbjct: 147251 tttgccccctttttgcag 147268
to top
>emb|AL713904.3|CNS07YQ4 Oryza sativa chromosome 12, . BAC OJ1306_H03 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 121563

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     cctttttgcccccttttt 18
             ||||||||||||||||||
Sbjct: 14335 cctttttgcccccttttt 14352
to top
>gb|AC158772.5| Mus musculus chromosome 18, clone RP23-291M14, complete sequence
          Length = 198851

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     ccctttttgcagcttagg 28
              ||||||||||||||||||
Sbjct: 105356 ccctttttgcagcttagg 105339
to top
>gb|AC110248.22| Mus musculus chromosome 3, clone RP23-257P11, complete sequence
          Length = 206915

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     ccctttttgcagcttagg 28
              ||||||||||||||||||
Sbjct: 136064 ccctttttgcagcttagg 136047
to top
>gb|AC115692.6| Mus musculus chromosome 18, clone RP23-463G11, complete sequence
          Length = 227631

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     ccctttttgcagcttagg 28
              ||||||||||||||||||
Sbjct: 191813 ccctttttgcagcttagg 191830
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 13       ctttttgcagcttaggct 30
                ||||||||||||||||||
Sbjct: 18488185 ctttttgcagcttaggct 18488202
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 1        cctttttgcccccttttt 18
                ||||||||||||||||||
Sbjct: 25045320 cctttttgcccccttttt 25045303
to top
>emb|AL731743.2|CNS08C7S Oryza sativa chromosome 12, . BAC OSJNBa0001B02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 93872

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     cctttttgcccccttttt 18
             ||||||||||||||||||
Sbjct: 83919 cctttttgcccccttttt 83936
to top
>emb|Z74618.1|HSLUCA1 Human DNA sequence from clone XXcos-1 on chromosome 3, complete
             sequence
          Length = 30377

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     tgccccctttttgcagct 24
             ||||||||||||||||||
Sbjct: 24675 tgccccctttttgcagct 24692
to top
>gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, complete sequence
          Length = 185846

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2    ctttttgcccccttttt 18
            |||||||||||||||||
Sbjct: 7863 ctttttgcccccttttt 7879
to top
>gb|AC163099.5| Mus musculus chromosome 8, clone RP23-395L6, complete sequence
          Length = 188439

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 8     gccccctttttgcagct 24
             |||||||||||||||||
Sbjct: 39874 gccccctttttgcagct 39890
to top
>gb|AC102862.7| Mus musculus chromosome 8, clone RP24-535D22, complete sequence
          Length = 140264

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 8     gccccctttttgcagct 24
             |||||||||||||||||
Sbjct: 48536 gccccctttttgcagct 48520
to top
>gb|BT019209.1| Zea mays clone Contig882.F mRNA sequence
          Length = 1838

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2    ctttttgcccccttttt 18
            |||||||||||||||||
Sbjct: 1396 ctttttgcccccttttt 1412
to top
>gb|BC076645.1| Xenopus laevis B-cell receptor-associated protein 31, mRNA (cDNA
            clone MGC:78871 IMAGE:4057286), complete cds
          Length = 1911

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3    tttttgccccctttttgcagc 23
            ||||| |||||||||||||||
Sbjct: 1324 ttttttccccctttttgcagc 1344
to top
>gb|AY216939.1| Plasmodium vivax strain Belem YAC1H14-like sequence
          Length = 101016

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 4     ttttgccccctttttgc 20
             |||||||||||||||||
Sbjct: 67152 ttttgccccctttttgc 67136
to top
>gb|AY216938.1| Plasmodium vivax strain IndiaVII YAC1H14-like sequence
          Length = 101158

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 4     ttttgccccctttttgc 20
             |||||||||||||||||
Sbjct: 67200 ttttgccccctttttgc 67184
to top
>gb|AY216937.1| Plasmodium vivax strain Salvador I YAC1H14-like sequence
          Length = 101095

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 4     ttttgccccctttttgc 20
             |||||||||||||||||
Sbjct: 67097 ttttgccccctttttgc 67081
to top
>gb|AY216936.1| Plasmodium vivax strain Thai-NYU YAC1H14-like sequence
          Length = 101002

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 4     ttttgccccctttttgc 20
             |||||||||||||||||
Sbjct: 67139 ttttgccccctttttgc 67123
to top
>gb|AE008456.1| Streptococcus pneumoniae R6 section 72 of 184 of the complete genome
          Length = 10615

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 4    ttttgccccctttttgc 20
            |||||||||||||||||
Sbjct: 2728 ttttgccccctttttgc 2712
to top
>gb|AC135924.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0486C01,
              complete sequence
          Length = 146432

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 3      tttttgccccctttttg 19
              |||||||||||||||||
Sbjct: 110368 tttttgccccctttttg 110352
to top
>gb|AC093440.2| Drosophila melanogaster clone BACR34H03, complete sequence
          Length = 192132

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 3      tttttgccccctttttg 19
              |||||||||||||||||
Sbjct: 149936 tttttgccccctttttg 149920
to top
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 5       tttgccccctttttgca 21
               |||||||||||||||||
Sbjct: 1902407 tttgccccctttttgca 1902423
to top
>gb|U39651.1| Caenorhabditis elegans cosmid ZK470, complete sequence
          Length = 43695

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 9     ccccctttttgcagctt 25
             |||||||||||||||||
Sbjct: 30182 ccccctttttgcagctt 30198
to top
>gb|AC122401.3| Mus musculus chromosome 15 clone RP24-107E24, complete sequence
          Length = 188544

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 3      tttttgccccctttttg 19
              |||||||||||||||||
Sbjct: 123271 tttttgccccctttttg 123255
to top
>gb|AY150217.1| Ambystoma tigrinum stebbensi virus, complete genome
          Length = 106332

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 14    tttttgcagcttaggct 30
             |||||||||||||||||
Sbjct: 49497 tttttgcagcttaggct 49481
to top
>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence
          Length = 166644

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 3      tttttgccccctttttg 19
              |||||||||||||||||
Sbjct: 144520 tttttgccccctttttg 144536
to top
>gb|AC146866.6| Medicago truncatula clone mth2-19a14, complete sequence
          Length = 145002

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 6   ttgccccctttttgcag 22
           |||||||||||||||||
Sbjct: 743 ttgccccctttttgcag 759
to top
>emb|AL592424.13| Human DNA sequence from clone RP11-68I18 on chromosome 1 Contains the
             3' end of a novel gene (MGC29891), a ribosomal protein S29
             (RPS29) pseudogene, the SEMA6C gene for sema domain
             transmembrane domain (TM) and cytoplasmic domain
             (semaphorin) 6C, gene FLJ23467, a novel gene, the SCNM1
             gene for sodium channel modifier 1, the TMOD4 gene for
             tropomodulin 4 (muscle), the TCFL1 gene for transcription
             factor-like 1, the PIP5K1A gene for
             phosphatidylinositol-4-phosphate 5-kinase type I alpha,
             the 5' end of the PSMD4 gene for proteasome (prosome,
             macropain) 26S subunit non-ATPase 4 and four CpG islands,
             complete sequence
          Length = 159148

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     ctttttgcccccttttt 18
             |||||||||||||||||
Sbjct: 95989 ctttttgcccccttttt 95973
to top
>emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome; segment 5/7
          Length = 349746

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 9     ccccctttttgcagctt 25
             |||||||||||||||||
Sbjct: 89644 ccccctttttgcagctt 89660
to top
>gb|AC125362.6| Homo sapiens 3 BAC RP11-279P10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 91987

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 3     tttttgccccctttttg 19
             |||||||||||||||||
Sbjct: 88583 tttttgccccctttttg 88567
to top
>gb|AC144743.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0009H09,
            complete sequence
          Length = 148740

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3    tttttgccccctttttg 19
            |||||||||||||||||
Sbjct: 3999 tttttgccccctttttg 3983
to top
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 2       ctttttgcccccttttt 18
               |||||||||||||||||
Sbjct: 2016289 ctttttgcccccttttt 2016305
to top
>gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 161360

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 8      gccccctttttgcagct 24
              |||||||||||||||||
Sbjct: 148826 gccccctttttgcagct 148842
to top
>gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell Park Cancer Institute
            Drosophila BAC Library) complete sequence
          Length = 103196

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 8    gccccctttttgcagct 24
            |||||||||||||||||
Sbjct: 5003 gccccctttttgcagct 5019
to top
>gb|AY003872.1| Plasmodium vivax YAC 1H14, complete sequence
          Length = 199866

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 4      ttttgccccctttttgc 20
              |||||||||||||||||
Sbjct: 113327 ttttgccccctttttgc 113311
to top
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 9       ccccctttttgcagctt 25
               |||||||||||||||||
Sbjct: 4510617 ccccctttttgcagctt 4510633
to top
>emb|AL113490.1|CNS01AWQ Botrytis cinerea strain T4 cDNA library
          Length = 840

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 9   ccccctttttgcagctt 25
           |||||||||||||||||
Sbjct: 787 ccccctttttgcagctt 771
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                     
Query: 3        tttttgccccctttttgcagc 23
                ||||| |||||||||||||||
Sbjct: 24752130 ttttttccccctttttgcagc 24752110
to top
>gb|AC007739.2| Homo sapiens BAC clone RP11-91L3 from 2, complete sequence
          Length = 159123

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 5      tttgccccctttttgca 21
              |||||||||||||||||
Sbjct: 130218 tttgccccctttttgca 130234
to top
>gb|AC008056.6|AC008056 Homo sapiens chromosome 14 clone RP11-242P2 containing gene for
             neurexin III gene, partial cds, complete sequence
          Length = 163584

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 6     ttgccccctttttgcag 22
             |||||||||||||||||
Sbjct: 19618 ttgccccctttttgcag 19634
to top
>emb|AJ339735.1|HSA339735 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-SD2RS
          Length = 737

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 1   cctttttgccccctttt 17
           |||||||||||||||||
Sbjct: 455 cctttttgccccctttt 471
to top
>emb|BX908394.9| Zebrafish DNA sequence from clone DKEY-106H23 in linkage group 18,
             complete sequence
          Length = 102817

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 12    cctttttgcagcttagg 28
             |||||||||||||||||
Sbjct: 71326 cctttttgcagcttagg 71310
to top
>gb|AY109228.1| Zea mays PCO111190 mRNA sequence
          Length = 844

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 2   ctttttgcccccttttt 18
           |||||||||||||||||
Sbjct: 528 ctttttgcccccttttt 544
to top
>emb|CR962125.2| Medicago truncatula chromosome 5 clone mth2-179a9, COMPLETE SEQUENCE
          Length = 113972

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 6     ttgccccctttttgcag 22
             |||||||||||||||||
Sbjct: 98596 ttgccccctttttgcag 98612
to top
>gb|AE003667.3| Drosophila melanogaster chromosome 2L, section 76 of 83 of the complete
              sequence
          Length = 257666

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 3      tttttgccccctttttg 19
              |||||||||||||||||
Sbjct: 112928 tttttgccccctttttg 112912
to top
>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
              sequence
          Length = 288721

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 8      gccccctttttgcagct 24
              |||||||||||||||||
Sbjct: 119729 gccccctttttgcagct 119713
to top
>gb|AC002443.1|AC002443 Drosophila melanogaster DNA sequence (P1 DS02109 (D53)), complete
            sequence
          Length = 79826

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3    tttttgccccctttttg 19
            |||||||||||||||||
Sbjct: 6470 tttttgccccctttttg 6454
to top
>emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0067K08,
             complete sequence
          Length = 170765

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 3     tttttgccccctttttgcagc 23
             ||||| |||||||||||||||
Sbjct: 13846 ttttttccccctttttgcagc 13826
to top
>gb|BC110709.1| Xenopus laevis cDNA clone MGC:130706 IMAGE:7981130, complete cds
          Length = 1930

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3    tttttgccccctttttgcagc 23
            ||||| |||||||||||||||
Sbjct: 1312 ttttttccccctttttgcagc 1332
to top
>dbj|AP002956.1| Homo sapiens genomic DNA, chromosome 11q clone:R1105h09, complete
             sequence
          Length = 219574

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 3     tttttgccccctttttg 19
             |||||||||||||||||
Sbjct: 27294 tttttgccccctttttg 27310
to top
>emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on chromosome 15, complete
              sequence
          Length = 202342

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 2      ctttttgcccccttttt 18
              |||||||||||||||||
Sbjct: 192307 ctttttgcccccttttt 192323
to top
>gb|AC100778.5| Homo sapiens chromosome 18, clone RP11-110H1, complete sequence
          Length = 173671

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 1     cctttttgccccctttt 17
             |||||||||||||||||
Sbjct: 98771 cctttttgccccctttt 98787


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 219,965
Number of Sequences: 3902068
Number of extensions: 219965
Number of successful extensions: 48484
Number of sequences better than 10.0: 77
Number of HSP's better than 10.0 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48150
Number of HSP's gapped (non-prelim): 334
length of query: 30
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 10
effective length of database: 17,155,003,908
effective search space: 171550039080
effective search space used: 171550039080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)
to top