Clone Name | bastl23d01 |
---|---|
Clone Library Name | barley_pub |
>gb|AF016585.1|AF016585 Streptomyces caelestis cytochrome P-450 hydroxylase homolog (nidi) gene, partial cds; polyketide synthase modules 1 through 7 (nidA) genes, complete cds; and N-methyltransferase homolog gene, partial cds Length = 41097 Score = 50.1 bits (25), Expect = 0.003 Identities = 25/25 (100%) Strand = Plus / Plus Query: 51 cctccaccacctcaccacccacctc 75 ||||||||||||||||||||||||| Sbjct: 38476 cctccaccacctcaccacccacctc 38500 Score = 50.1 bits (25), Expect = 0.003 Identities = 25/25 (100%) Strand = Plus / Plus Query: 51 cctccaccacctcaccacccacctc 75 ||||||||||||||||||||||||| Sbjct: 33629 cctccaccacctcaccacccacctc 33653
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.013 Identities = 24/24 (100%) Strand = Plus / Plus Query: 188 ctcccggcaccggcaccggcaccg 211 |||||||||||||||||||||||| Sbjct: 14037041 ctcccggcaccggcaccggcaccg 14037064 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 33017300 ccggcaccggcaccggcacc 33017319 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 3520323 cggcaccggcaccggcaccg 3520342
>gb|AC137597.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0022F22, from chromosome 3, complete sequence Length = 144268 Score = 48.1 bits (24), Expect = 0.013 Identities = 24/24 (100%) Strand = Plus / Plus Query: 188 ctcccggcaccggcaccggcaccg 211 |||||||||||||||||||||||| Sbjct: 46720 ctcccggcaccggcaccggcaccg 46743
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.013 Identities = 24/24 (100%) Strand = Plus / Plus Query: 188 ctcccggcaccggcaccggcaccg 211 |||||||||||||||||||||||| Sbjct: 14032016 ctcccggcaccggcaccggcaccg 14032039 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 33107810 ccggcaccggcaccggcacc 33107829 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 3520434 cggcaccggcaccggcaccg 3520453
>gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, complete sequence Length = 188821 Score = 46.1 bits (23), Expect = 0.051 Identities = 26/27 (96%) Strand = Plus / Plus Query: 47 agatcctccaccacctcaccacccacc 73 ||||||||||||||||| ||||||||| Sbjct: 104982 agatcctccaccacctccccacccacc 105008
>gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, complete sequence Length = 225231 Score = 46.1 bits (23), Expect = 0.051 Identities = 26/27 (96%) Strand = Plus / Plus Query: 47 agatcctccaccacctcaccacccacc 73 ||||||||||||||||| ||||||||| Sbjct: 69652 agatcctccaccacctccccacccacc 69678
>gb|DQ215528.1| Taeniopygia guttata clone 0058P0032A06 RIKEN cDNA 2210402C18 variant 1-like mRNA, complete sequence Length = 1505 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 cccggcaccggcaccggcaccg 211 |||||||||||||||||||||| Sbjct: 117 cccggcaccggcaccggcaccg 96 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 110 ccggcaccggcaccggcacc 91
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 2260488 ccggcaccggcaccggcaccga 2260509 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2260482 ccggcaccggcaccggcaccg 2260502 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1050751 ccggcaccggcaccggcaccg 1050771
>ref|XM_540806.1| PREDICTED: Canis familiaris similar to MAS-related G-protein coupled receptor, member D (LOC483685), mRNA Length = 1050 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 1016 ccggcaccggcaccggcaccga 1037
>gb|AC091542.3| Felis catus clone RP86-141L11, complete sequence Length = 142451 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 cccggcaccggcaccggcaccg 211 |||||||||||||||||||||| Sbjct: 35057 cccggcaccggcaccggcaccg 35036
>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29 Length = 303550 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 156453 ccggcaccggcaccggcaccga 156432 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 156477 ccggcaccggcaccggcaccg 156457 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 156471 ccggcaccggcaccggcaccg 156451 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 156465 ccggcaccggcaccggcaccg 156445 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 156459 ccggcaccggcaccggcaccg 156439 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 156482 cggcaccggcaccggcaccg 156463
>emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete genome; segment 16/29 Length = 299050 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 79867 ccggcaccggcaccggcaccga 79846 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 296848 ccggcaccggcaccggcaccg 296828 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 296842 ccggcaccggcaccggcaccg 296822 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 296836 ccggcaccggcaccggcaccg 296816 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 296830 ccggcaccggcaccggcaccg 296810 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 79873 ccggcaccggcaccggcaccg 79853
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29 Length = 276800 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 190 cccggcaccggcaccggcaccg 211 |||||||||||||||||||||| Sbjct: 214608 cccggcaccggcaccggcaccg 214629 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 214615 ccggcaccggcaccggcaccg 214635 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 142009 ccggcaccggcaccggcaccg 141989 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 142003 ccggcaccggcaccggcaccg 141983
>emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete genome; segment 8/29 Length = 321250 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 103335 ccggcaccggcaccggcaccga 103356
>emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0014D23, complete sequence Length = 133759 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 187 cctcccggcaccggcaccggca 208 |||||||||||||||||||||| Sbjct: 107982 cctcccggcaccggcaccggca 107961
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 cccggcaccggcaccggcaccg 211 |||||||||||||||||||||| Sbjct: 631990 cccggcaccggcaccggcaccg 631969 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631983 ccggcaccggcaccggcaccg 631963 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631977 ccggcaccggcaccggcaccg 631957 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631971 ccggcaccggcaccggcaccg 631951 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631965 ccggcaccggcaccggcaccg 631945 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631959 ccggcaccggcaccggcaccg 631939 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631953 ccggcaccggcaccggcaccg 631933 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 631947 ccggcaccggcaccggcaccg 631927 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 631941 ccggcaccggcaccggcacc 631922
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 187 cctcccggcaccggcaccggca 208 |||||||||||||||||||||| Sbjct: 19819520 cctcccggcaccggcaccggca 19819499 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 30406084 ccggcaccggcaccggcaccg 30406064 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 29785578 ccggcaccggcaccggcaccg 29785598 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 27952451 cggcaccggcaccggcaccg 27952432 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 13824782 cggcaccggcaccggcaccg 13824801
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 20684479 ccggcaccggcaccggcaccga 20684458
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 1186217 ccggcaccggcaccggcaccga 1186238 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 1140691 ccggcaccggcaccggcaccga 1140670 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 6915136 ccggcaccggcaccggcaccg 6915116 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 4209605 cggcaccggcaccggcaccga 4209625 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3635803 ccggcaccggcaccggcaccg 3635823 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2213565 ccggcaccggcaccggcaccg 2213545 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1432432 ccggcaccggcaccggcaccg 1432452 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1186211 ccggcaccggcaccggcaccg 1186231 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1175375 ccggcaccggcaccggcaccg 1175395 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1140697 ccggcaccggcaccggcaccg 1140677 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 419058 ccggcaccggcaccggcaccg 419078 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 419052 ccggcaccggcaccggcaccg 419072 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 216478 ccggcaccggcaccggcaccg 216498 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 6915141 cggcaccggcaccggcaccg 6915122 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 6915130 ccggcaccggcaccggcacc 6915111 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 3635809 ccggcaccggcaccggcacc 3635828 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 2759401 cggcaccggcaccggcaccg 2759382 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 1161468 ccaccacctcaccacccacc 1161487 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 1156752 ccaccacctcaccacccacc 1156771 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 1143009 ccaccacctcaccacccacc 1143028
>gb|AF275943.1|AF275943 Streptomyces avermitilis avermectin polyketide synthase gene, partial cds Length = 11096 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 2983 ccggcaccggcaccggcaccga 2962 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2989 ccggcaccggcaccggcaccg 2969 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 5310 ccaccacctcaccacccacc 5329
>dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1112_E07 Length = 132055 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 78090 ccggcaccggcaccggcaccga 78069
>dbj|AK100026.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146I06, full insert sequence Length = 1567 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 509 ccggcaccggcaccggcaccga 530
>dbj|AB032367.1| Streptomyces avermitilis polyketide synthase gene cluster (aveA1, aveA2, aveA3, aveA4) and aveC, aveE genes, complete cds Length = 64957 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 48501 ccggcaccggcaccggcaccga 48522 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccga 212 |||||||||||||||||||||| Sbjct: 2975 ccggcaccggcaccggcaccga 2954 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 48495 ccggcaccggcaccggcaccg 48515 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 37659 ccggcaccggcaccggcaccg 37679 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2981 ccggcaccggcaccggcaccg 2961 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 23752 ccaccacctcaccacccacc 23771 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 19036 ccaccacctcaccacccacc 19055 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 5293 ccaccacctcaccacccacc 5312
>ref|NM_124304.2| Arabidopsis thaliana unknown protein AT5G49270 mRNA, complete cds Length = 2147 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccgattt 215 ||||||||||||||||| ||||||| Sbjct: 140 ccggcaccggcaccggccccgattt 164
>gb|AY061964.1| Zea mays fertilization-independent endosperm protein (FIE1) mRNA, complete cds Length = 1787 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 1534 cggcaccggcaccggcaccga 1514
>gb|AC118284.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1087_C03, complete sequence Length = 101218 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 13542 ccggcaccggcaccggcaccg 13562
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 610149 ccggcaccggcaccggcaccg 610169 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 610143 ccggcaccggcaccggcaccg 610163 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 610137 ccggcaccggcaccggcaccg 610157
>gb|AC168047.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940115D9, complete sequence Length = 108001 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 26549 ccggcaccggcaccggcaccg 26529
>gb|DQ213306.1| Taeniopygia guttata clone 0061P0024G12 mitochondrial ribosomal protein S16-like mRNA, complete sequence Length = 1306 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 418 ccggcaccggcaccggcaccg 438
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3419918 ccggcaccggcaccggcaccg 3419898 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3419912 ccggcaccggcaccggcaccg 3419892 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3419906 ccggcaccggcaccggcaccg 3419886 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3419900 ccggcaccggcaccggcaccg 3419880 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3419894 ccggcaccggcaccggcaccg 3419874 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2440511 ccggcaccggcaccggcaccg 2440491
>ref|XM_473768.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2376 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 148 ccggcaccggcaccggcaccg 128
>ref|XM_473712.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 369 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 314 ccggcaccggcaccggcaccg 334
>gb|AC138341.9| Mus musculus chromosome 5, clone RP23-37N15, complete sequence Length = 176410 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 79792 ccggcaccggcaccggcaccg 79812 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 79786 ccggcaccggcaccggcaccg 79806 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 79780 ccggcaccggcaccggcaccg 79800 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 79774 ccggcaccggcaccggcaccg 79794
>ref|XM_365410.1| Magnaporthe grisea 70-15 hypothetical protein (MG02112.4) partial mRNA Length = 864 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 806 ccggcaccggcaccggcaccg 786 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 800 ccggcaccggcaccggcacc 781
>ref|XM_366062.1| Magnaporthe grisea 70-15 predicted protein (MG10282.4) partial mRNA Length = 378 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 82 ccggcaccggcaccggcaccg 102
>ref|XM_417814.1| PREDICTED: Gallus gallus similar to peroxisomal protein (PeP) (LOC419667), mRNA Length = 3173 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 252 ccggcaccggcaccggcaccg 232
>gb|AY380839.1| Leifsonia xyli subsp. cynodontis plasmid pCXC100 RepA, putative plasmid partition protein ParA, and putative plasmid related protein genes, complete cds; and unknown genes Length = 4992 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 187 cctcccggcaccggcaccggcaccg 211 |||||||||||||||||||| |||| Sbjct: 4470 cctcccggcaccggcaccgggaccg 4446
>ref|XM_324081.1| Neurospora crassa OR74A hypothetical protein (NCU04725.1) partial mRNA Length = 1623 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 35 ccggcaccggcaccggcaccg 55
>gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence Length = 279448 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 104993 ccggcaccggcaccggcaccg 104973 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 104987 ccggcaccggcaccggcacc 104968 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 104615 ccggcaccggcaccggcacc 104596
>ref|NM_172803.2| Mus musculus dedicator of cytokinesis 4 (Dock4), mRNA Length = 8072 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 5982 ccggcaccggcaccggcaccg 5962
>ref|XM_322357.1| Neurospora crassa OR74A hypothetical protein (NCU00272.1) partial mRNA Length = 3120 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 734 ccggcaccggcaccggcaccg 714 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 728 ccggcaccggcaccggcaccg 708 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 739 cggcaccggcaccggcaccg 720
>ref|XM_960134.1| Neurospora crassa OR74A hypothetical protein (NCU08096.1) partial mRNA Length = 2637 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 50 tcctccaccacctcaccaccc 70 ||||||||||||||||||||| Sbjct: 683 tcctccaccacctcaccaccc 703
>ref|XM_952650.1| Neurospora crassa OR74A hypothetical protein (NCU00272.1) partial mRNA Length = 3120 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 734 ccggcaccggcaccggcaccg 714 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 728 ccggcaccggcaccggcaccg 708 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 739 cggcaccggcaccggcaccg 720
>ref|XM_955267.1| Neurospora crassa OR74A hypothetical protein (NCU04725.1) partial mRNA Length = 1623 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 35 ccggcaccggcaccggcaccg 55
>ref|XM_956344.1| Neurospora crassa OR74A hypothetical protein (NCU01351.1) partial mRNA Length = 1110 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 862 ccggcaccggcaccggcaccg 842
>ref|XM_959870.1| Neurospora crassa OR74A hypothetical protein (NCU03104.1) partial mRNA Length = 3834 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3517 ccggcaccggcaccggcaccg 3537 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 3512 cggcaccggcaccggcaccg 3531
>ref|XM_326843.1| Neurospora crassa OR74A hypothetical protein (NCU01351.1) partial mRNA Length = 1110 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 862 ccggcaccggcaccggcaccg 842
>ref|XM_328801.1| Neurospora crassa OR74A hypothetical protein (NCU08096.1) partial mRNA Length = 2637 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 50 tcctccaccacctcaccaccc 70 ||||||||||||||||||||| Sbjct: 683 tcctccaccacctcaccaccc 703
>ref|XM_330539.1| Neurospora crassa OR74A hypothetical protein (NCU03104.1) partial mRNA Length = 3834 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3517 ccggcaccggcaccggcaccg 3537 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 3512 cggcaccggcaccggcaccg 3531
>gb|DQ493951.1| Magnaporthe grisea 70-15 clone 41H14 telomere region, partial sequence Length = 39091 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 414 ccggcaccggcaccggcaccg 394 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 408 ccggcaccggcaccggcacc 389
>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence Length = 214580 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 126706 ccggcaccggcaccggcaccg 126726 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 126700 ccggcaccggcaccggcaccg 126720 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 126694 ccggcaccggcaccggcaccg 126714 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 126688 ccggcaccggcaccggcaccg 126708
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 145573 ccggcaccggcaccggcaccg 145593
>gb|AF484556.1| Streptomyces atroolivaceus leinamycin biosynthetic gene cluster, complete sequence Length = 135638 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 88217 ccggcaccggcaccggcaccg 88237
>gb|AY233338.1| Leifsonia xyli subsp. cynodontis plasmid pcxc100 par locus, partial sequence Length = 773 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Plus Query: 187 cctcccggcaccggcaccggcaccg 211 |||||||||||||||||||| |||| Sbjct: 521 cctcccggcaccggcaccgggaccg 545
>gb|AY195850.1| Zea mays fertilization-independent type 2 mRNA, complete cds Length = 1780 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1513 ccggcaccggcaccggcaccg 1493 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1507 ccggcaccggcaccggcaccg 1487 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 1518 cggcaccggcaccggcaccg 1499
>ref|XM_753355.1| Ustilago maydis 521 hypothetical protein (UM02301.1) partial mRNA Length = 1944 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgcg 246 |||||| |||||||||||||||||| Sbjct: 1746 ggccgcagcggcagcagctgccgcg 1722
>ref|XM_755123.1| Ustilago maydis 521 hypothetical protein (UM04069.1) partial mRNA Length = 2823 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2591 ccggcaccggcaccggcaccg 2611
>ref|XM_755702.1| Ustilago maydis 521 hypothetical protein (UM04648.1) partial mRNA Length = 1566 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 947 ccggcaccggcaccggcaccg 927
>ref|XM_757305.1| Ustilago maydis 521 hypothetical protein (UM06251.1) partial mRNA Length = 5031 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4624 ccggcaccggcaccggcaccg 4644
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4230300 ccggcaccggcaccggcaccg 4230280
>gb|AC137820.11| Medicago truncatula clone mth2-15f9, complete sequence Length = 134674 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 193 ggcaccggcaccggcaccgat 213 ||||||||||||||||||||| Sbjct: 116938 ggcaccggcaccggcaccgat 116918
>emb|AJ833017.1| Streptomyces clavuligerus partial ORF1 and brp gene Length = 1696 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 337 ccggcaccggcaccggcaccg 317
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1993126 ccggcaccggcaccggcaccg 1993106 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1993120 ccggcaccggcaccggcacc 1993101
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2826497 ccggcaccggcaccggcaccg 2826517
>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14 Length = 348257 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 342351 cggcaccggcaccggcaccga 342371
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 cccggcaccggcaccggcacc 210 ||||||||||||||||||||| Sbjct: 1038196 cccggcaccggcaccggcacc 1038176
>emb|BX295540.1|NC49D12 Neurospora crassa DNA linkage group VI Cosmid contig 49D12 Length = 95032 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 64707 ccggcaccggcaccggcaccg 64727 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 64701 ccggcaccggcaccggcaccg 64721 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 64713 ccggcaccggcaccggcacc 64732
>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29 Length = 292100 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 174014 ccggcaccggcaccggcaccg 173994 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 174008 ccggcaccggcaccggcacc 173989 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 173744 ccggcaccggcaccggcacc 173725
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 44732 ccggcaccggcaccggcaccg 44752 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 44727 cggcaccggcaccggcaccg 44746
>emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete genome; segment 9/29 Length = 300800 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 198579 ccggcaccggcaccggcaccg 198599 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 198573 ccggcaccggcaccggcaccg 198593
>emb|AL606638.2|OSJN00077 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete sequence Length = 166804 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 39462 ccggcaccggcaccggcaccg 39442
>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5 Length = 72305 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 51355 ccggcaccggcaccggcaccg 51335
>gb|BT008328.1| Arabidopsis thaliana At5g49270 gene, complete cds Length = 1992 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccgattt 215 ||||||||||||||||| ||||||| Sbjct: 94 ccggcaccggcaccggccccgattt 118
>gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosome 12, complete sequence Length = 215502 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108926 ccggcaccggcaccggcaccg 108906 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108920 ccggcaccggcaccggcaccg 108900 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108914 ccggcaccggcaccggcaccg 108894 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108908 ccggcaccggcaccggcaccg 108888 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108902 ccggcaccggcaccggcaccg 108882 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108896 ccggcaccggcaccggcaccg 108876 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 108890 ccggcaccggcaccggcaccg 108870 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 108884 ccggcaccggcaccggcacc 108865
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gcaccggcaccggcaccgatt 214 ||||||||||||||||||||| Sbjct: 3617375 gcaccggcaccggcaccgatt 3617395
>gb|AC132275.4| Mus musculus BAC clone RP24-341P14 from chromosome 3, complete sequence Length = 174425 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 62427 ccggcaccggcaccggcaccg 62407 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 62421 ccggcaccggcaccggcaccg 62401 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 62415 ccggcaccggcaccggcaccg 62395 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 62409 ccggcaccggcaccggcaccg 62389 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 62432 cggcaccggcaccggcaccg 62413
>gb|AF480446.1| Ustilago maydis kinesin (kin3) gene, complete cds Length = 9455 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 6415 ccggcaccggcaccggcaccg 6435
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4536571 ccggcaccggcaccggcaccg 4536551 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4536565 ccggcaccggcaccggcaccg 4536545 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4536559 ccggcaccggcaccggcaccg 4536539 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 568099 ccggcaccggcaccggcaccg 568079
>gb|AE012045.1| Xanthomonas axonopodis pv. citri str. 306, section 423 of 469 of the complete genome Length = 11318 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1010 ccggcaccggcaccggcaccg 990 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1004 ccggcaccggcaccggcaccg 984
>gb|AE011897.1| Xanthomonas axonopodis pv. citri str. 306, section 275 of 469 of the complete genome Length = 12531 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 9118 ccggcaccggcaccggcaccg 9098
>ref|NM_168748.1| Drosophila melanogaster CG32186-RA (CG32186), mRNA Length = 4788 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4607 ccggcaccggcaccggcaccg 4627
>gb|AC007213.6| Arabidopsis thaliana chromosome 2 clone T23O15 map RNS1, complete sequence Length = 81341 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 gatcctccaccacctcaccac 68 ||||||||||||||||||||| Sbjct: 66669 gatcctccaccacctcaccac 66649
>gb|AC009375.8| Drosophila melanogaster 3L BAC RP98-44L18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 180787 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 140052 ccggcaccggcaccggcaccg 140032
>dbj|AK140704.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930099F11 product:dedicator of cytokinesis 4, full insert sequence Length = 1911 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1414 ccggcaccggcaccggcaccg 1394
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 4530736 cggcaccggcaccggcaccga 4530756 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3279683 ccggcaccggcaccggcaccg 3279663 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 3089138 ccggcaccggcaccggcaccg 3089158 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 793142 ccggcaccggcaccggcaccg 793162 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 793136 ccggcaccggcaccggcaccg 793156 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 700982 ccggcaccggcaccggcaccg 701002 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 700976 ccggcaccggcaccggcaccg 700996 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 3946830 ccggcaccggcaccggcacc 3946849 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 193 ggcaccggcaccggcaccga 212 |||||||||||||||||||| Sbjct: 3745683 ggcaccggcaccggcaccga 3745664 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 189 tcccggcaccggcaccggca 208 |||||||||||||||||||| Sbjct: 2672927 tcccggcaccggcaccggca 2672946 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 868348 ccggcaccggcaccggcacc 868367 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 793131 cggcaccggcaccggcaccg 793150
>dbj|AK163672.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930001B17 product:dedicator of cytokinesis 4, full insert sequence Length = 2223 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 449 ccggcaccggcaccggcaccg 429
>gb|AC097674.6| Rattus norvegicus 2 CH230-75D18 (Children's Hospital Oakland Research Institute) complete sequence Length = 227596 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188636 ccggcaccggcaccggcaccg 188656 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188630 ccggcaccggcaccggcaccg 188650 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188624 ccggcaccggcaccggcaccg 188644 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188618 ccggcaccggcaccggcaccg 188638 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188612 ccggcaccggcaccggcaccg 188632 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188606 ccggcaccggcaccggcaccg 188626 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188600 ccggcaccggcaccggcaccg 188620 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188594 ccggcaccggcaccggcaccg 188614 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188588 ccggcaccggcaccggcaccg 188608 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 188582 ccggcaccggcaccggcaccg 188602 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 188642 ccggcaccggcaccggcacc 188661
>dbj|AK015465.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930455H04 product:unclassifiable, full insert sequence Length = 1342 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 179 ccggcaccggcaccggcaccg 159 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 173 ccggcaccggcaccggcaccg 153 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 167 ccggcaccggcaccggcaccg 147 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 161 ccggcaccggcaccggcaccg 141 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 184 cggcaccggcaccggcaccg 165
>dbj|AK043695.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830021E16 product:unclassifiable, full insert sequence Length = 2781 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 319 ccggcaccggcaccggcaccg 339 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 313 ccggcaccggcaccggcaccg 333 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 307 ccggcaccggcaccggcaccg 327 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 301 ccggcaccggcaccggcaccg 321 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 296 cggcaccggcaccggcaccg 315
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 24481765 ccggcaccggcaccggcaccg 24481785 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 251818 atggccgccgcggcagcagc 251837
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 25742248 ccggcaccggcaccggcaccg 25742268 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 17520495 cggcaccggcaccggcaccg 17520514
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 9732976 ccggcaccggcaccggcaccg 9732956
>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome Length = 335593 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 227042 ccggcaccggcaccggcaccg 227022 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 227036 ccggcaccggcaccggcacc 227017
>gb|AF154645.1| Nicotiana tabacum clone PR26 mRNA sequence Length = 1141 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 92 ccggcaccggcaccggcaccg 112
>dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0038F12 Length = 190014 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 170979 ccggcaccggcaccggcaccg 170959
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 876240 ccggcaccggcaccggcaccg 876260
>dbj|AP004230.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ2013_G04 Length = 73667 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 31575 ccggcaccggcaccggcaccg 31595
>dbj|AB016872.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21P3 Length = 86001 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccgattt 215 ||||||||||||||||| ||||||| Sbjct: 52414 ccggcaccggcaccggccccgattt 52390
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2007 ccggcaccggcaccggcaccg 2027 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2001 ccggcaccggcaccggcaccg 2021 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 1996 cggcaccggcaccggcaccg 2015
>emb|X97916.1|HVBLT141 H.vulgare blt14.1 gene Length = 963 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 542 ccggcaccggcaccggcaccg 522
>dbj|AK110478.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-A02, full insert sequence Length = 2973 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 531 ccggcaccggcaccggcaccg 511
>dbj|AK110501.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-D08, full insert sequence Length = 2551 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 836 ccggcaccggcaccggcaccg 816 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 830 ccggcaccggcaccggcaccg 810 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 824 ccggcaccggcaccggcaccg 804
>dbj|AK110285.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-E12, full insert sequence Length = 2833 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2675 ccggcaccggcaccggcaccg 2655 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 2680 cggcaccggcaccggcaccg 2661 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 2669 ccggcaccggcaccggcacc 2650
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 416 ccggcaccggcaccggcaccg 436 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 410 ccggcaccggcaccggcaccg 430 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 405 cggcaccggcaccggcaccg 424
>emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right terminal inverted repeat Length = 243019 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 124412 ccggcaccggcaccggcaccg 124432
>gb|BT024091.1| Zea mays clone EL01N0552F10 mRNA sequence Length = 1772 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 1508 cggcaccggcaccggcaccga 1488
>dbj|AK066984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091E10, full insert sequence Length = 2257 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 170 ccggcaccggcaccggcaccg 150
>dbj|AK066030.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013044E12, full insert sequence Length = 2098 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 113 ccggcaccggcaccggcaccg 133
>dbj|AK063682.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E08, full insert sequence Length = 715 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 434 ccggcaccggcaccggcaccg 454
>gb|AY112526.1| Zea mays CL600_7 mRNA sequence Length = 1744 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccga 212 ||||||||||||||||||||| Sbjct: 1496 cggcaccggcaccggcaccga 1476
>gb|AY111406.1| Zea mays CL14620_1 mRNA sequence Length = 697 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 524 ccggcaccggcaccggcaccg 504
>gb|AF109296.1|AF109296 Leishmania donovani proton motive P-type ATPase gene locus, complete sequence Length = 15413 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 143 ccggcaccggcaccggcaccg 163
>emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left terminal inverted repeat Length = 273746 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 124412 ccggcaccggcaccggcaccg 124432
>gb|AE003522.3| Drosophila melanogaster chromosome 3L, section 63 of 83 of the complete sequence Length = 302050 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 13709 ccggcaccggcaccggcaccg 13689
>gb|AY899910.1| Arthrobacter sp. SU plasmid pASU1 putative flavin reductase/monooxygenase, putative dicarboxylate transporter, putative maleate-cis,trans-isomerase, and putative IclR family transcriptional regulator genes, complete cds; and putative excisionase gene, partial cds Length = 6131 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 880 ccggcaccggcaccggcaccg 860
>gb|AC123621.10| Mus musculus chromosome 19, clone RP23-74D13, complete sequence Length = 197720 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 69768 ccggcaccggcaccggcaccg 69788
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 4541697 ccggcaccggcaccggcaccg 4541677 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 580222 ccggcaccggcaccggcaccg 580202
>dbj|AK122353.1| Mus musculus mRNA for mKIAA0716 protein Length = 6394 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 5964 ccggcaccggcaccggcaccg 5944
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029900 ccggcaccggcaccggcaccg 2029880 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029894 ccggcaccggcaccggcaccg 2029874 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029888 ccggcaccggcaccggcaccg 2029868 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029882 ccggcaccggcaccggcaccg 2029862 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029876 ccggcaccggcaccggcaccg 2029856 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029870 ccggcaccggcaccggcaccg 2029850 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2029864 ccggcaccggcaccggcaccg 2029844
>gb|AC158383.3| Mus musculus BAC clone RP23-135O16 from chromosome 12, complete sequence Length = 196552 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8324 ccggcaccggcaccggcaccg 8344 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8318 ccggcaccggcaccggcaccg 8338 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8312 ccggcaccggcaccggcaccg 8332 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8306 ccggcaccggcaccggcaccg 8326 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8300 ccggcaccggcaccggcaccg 8320 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8294 ccggcaccggcaccggcaccg 8314 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 8288 ccggcaccggcaccggcaccg 8308 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 8330 ccggcaccggcaccggcacc 8349
>gb|AC159315.4| Mus musculus BAC clone RP23-86H21 from chromosome 12, complete sequence Length = 233568 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 73604 ccggcaccggcaccggcaccg 73584
>gb|AY609404.1| Sus scrofa clone Clu_10503.scr.msk.p1.Contig5, mRNA sequence Length = 1921 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 325 ccggcaccggcaccggcaccg 345 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 319 ccggcaccggcaccggcaccg 339 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 331 ccggcaccggcaccggcacc 350
>gb|AC170869.2| Mus musculus BAC clone RP24-370B22 from chromosome 3, complete sequence Length = 143247 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 17713 ccggcaccggcaccggcaccg 17733 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 17707 ccggcaccggcaccggcaccg 17727 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 17701 ccggcaccggcaccggcaccg 17721 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 17695 ccggcaccggcaccggcaccg 17715 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 17690 cggcaccggcaccggcaccg 17709
>emb|AL662981.3|OSJN00182 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086O06, complete sequence Length = 178552 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 66504 ccggcaccggcaccggcaccg 66524
>emb|AL606683.3|OSJN00089 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083N12, complete sequence Length = 160989 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 155980 ccggcaccggcaccggcaccg 155960
>gb|AC148879.2| Chlamydomonas reinhardtii clone cr-36D8, complete sequence Length = 53591 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 24419 ccggcaccggcaccggcaccg 24399
>gb|L28092.1|BLYTRAA Hordeum vulgare transmembrane protein mRNA fragment Length = 642 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 233 ccggcaccggcaccggcaccg 213
>gb|U78289.1|SFU78289 Streptomyces fradiae tylactone synthase, starter module and modules 1-7, (tylG) gene, complete cds Length = 43280 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 15825 ccggcaccggcaccggcaccg 15845
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome Length = 4369232 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 1505987 ccggcaccggcaccggcaccg 1506007 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1505993 ccggcaccggcaccggcacc 1506012
>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster Length = 104326 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcaccg 211 ||||||||||||||||||||| Sbjct: 2002 ccggcaccggcaccggcaccg 1982 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1996 ccggcaccggcaccggcacc 1977
>gb|AY745809.1| Aedes aegypti GATA transcription factor GATAd mRNA, complete cds Length = 2492 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 460 ggccgccgccgcagcagctgccgc 483
>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence Length = 227070 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 103122 cggcaccggcaccggcaccg 103141
>ref|NM_185045.1| Oryza sativa (japonica cultivar-group), mRNA Length = 246 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 143 ccggcaccggcaccggcacc 162
>ref|XM_525966.1| PREDICTED: Pan troglodytes similar to Homeobox even-skipped homolog protein 2 (EVX-2) (LOC470585), mRNA Length = 2250 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 2020 gccgcggcagcagctgccgc 2039
>ref|XM_479047.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1053 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 500 cggcaccggcaccggcaccg 481
>ref|XM_476366.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1050 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 1 atggccgccgcggcagcagc 20
>ref|XM_471729.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1485 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 777 cggcaccggcaccggcaccg 796
>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence Length = 256158 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 131481 ccggcaccggcaccggcacc 131500
>ref|XM_359896.1| Magnaporthe grisea 70-15 hypothetical protein (MG04881.4) partial mRNA Length = 1134 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 28 cggcaccggcaccggcaccg 9
>ref|XM_364918.1| Magnaporthe grisea 70-15 predicted protein (MG09763.4) partial mRNA Length = 1536 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 1147 cggcaccggcaccggcaccg 1128 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1142 ccggcaccggcaccggcacc 1123
>ref|XM_367062.1| Magnaporthe grisea 70-15 chromosome V predicted protein (MG10692.4) partial mRNA Length = 1344 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 222 ggccgccgcggcagcagctgccgc 245 |||||||||||| ||||||||||| Sbjct: 954 ggccgccgcggccgcagctgccgc 977
>ref|XM_960448.1| Neurospora crassa OR74A hypothetical protein (NCU01910.1) partial mRNA Length = 5430 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 4954 ccggcaccggcaccggcacc 4973
>ref|XM_324207.1| Neurospora crassa OR74A predicted protein (NCU04851.1) partial mRNA Length = 3279 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 46 ccggcaccggcaccggcacc 65
>ref|XM_952819.1| Neurospora crassa OR74A hypothetical protein (NCU04851.1) partial mRNA Length = 3279 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 46 ccggcaccggcaccggcacc 65
>ref|XM_957721.1| Neurospora crassa OR74A hypothetical protein (NCU07881.1) partial mRNA Length = 909 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 305 ccggcaccggcaccggcacc 324
>ref|XM_328586.1| Neurospora crassa OR74A hypothetical protein (NCU07881.1) partial mRNA Length = 909 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 305 ccggcaccggcaccggcacc 324
>ref|XM_329099.1| Neurospora crassa OR74A hypothetical protein (NCU01910.1) partial mRNA Length = 5430 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 4954 ccggcaccggcaccggcacc 4973
>gb|DQ493944.1| Magnaporthe grisea 70-15 clone 01G11 telomere region, partial sequence Length = 40546 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 |||||||||||| ||||||||||| Sbjct: 8961 ggccgccgcggccgcagctgccgc 8938
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 50300 cggcaccggcaccggcaccg 50319
>ref|XM_705790.1| Candida albicans SC5314 putative transcription factor (CaO19.9381), mRNA Length = 2523 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 905 ccggcaccggcaccggcacc 886
>ref|XM_705781.1| Candida albicans SC5314 putative transcription factor (CaO19.1822), mRNA Length = 2532 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 905 ccggcaccggcaccggcacc 886
>ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5931.2), mRNA Length = 1692 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 227 ccggcaccggcaccggcacc 208
>gb|AY588948.1| Streptomyces griseus putative oxidoreductase, trypsin (sprT), putative protein, putative transcription regulator, putative peptidoglycan bound protein, and putative membrane protein genes, complete cds; and putative lipoprotein gene, partial cds Length = 6748 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 205 ccggcaccggcaccggcacc 224
>gb|AC103605.8| Mus musculus chromosome 3, clone RP23-335H1, complete sequence Length = 222210 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 81293 cggcaccggcaccggcaccg 81312
>gb|AC153007.4| Mus musculus BAC clone RP24-266E2 from chromosome 8, complete sequence Length = 174101 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 agatcctccaccacctcaccaccc 70 |||||| ||||||||||||||||| Sbjct: 124678 agatccaccaccacctcaccaccc 124701
>ref|XM_754211.1| Ustilago maydis 521 hypothetical protein (UM03157.1) partial mRNA Length = 6747 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1106 ccggcaccggcaccggcacc 1087
>ref|XM_744617.1| Aspergillus fumigatus Af293 dienelactone hydrolase (Afu2g05810) partial mRNA Length = 1374 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 51 cctccaccacctcaccacccacctcctc 78 |||||||||||||| || |||||||||| Sbjct: 485 cctccaccacctcaacatccacctcctc 512
>gb|AC124485.3| Mus musculus BAC clone RP23-450J12 from chromosome 8, complete sequence Length = 198254 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 agatcctccaccacctcaccaccc 70 |||||| ||||||||||||||||| Sbjct: 106646 agatccaccaccacctcaccaccc 106669
>emb|CR697755.2|CNS0G1C7 Tetraodon nigroviridis full-length cDNA Length = 718 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 125 ccggcaccggcaccggcacc 144
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 1484552 ccggcaccggcaccggcacc 1484571
>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29 Length = 296500 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 242033 cggcaccggcaccggcaccg 242014
>emb|AL731597.3|OSJN00237 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0023J03, complete sequence Length = 175555 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 38441 cggcaccggcaccggcaccg 38460
>emb|AL606682.3|OSJN00085 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065O17, complete sequence Length = 167269 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 115304 cggcaccggcaccggcaccg 115285
>emb|AL590464.1|SCO590464 Streptomyces coelicolor plasmid SCP1; segment 2/2 Length = 178073 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 62 tcaccacccacctcctctaccagc 85 ||||||||| |||||||||||||| Sbjct: 129408 tcaccacccccctcctctaccagc 129385 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 12034 ccggcaccggcaccggcacc 12015
>emb|AL590463.1|SCO590463 Streptomyces coelicolor plasmid SCP1; segment 1/2 Length = 178000 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 62 tcaccacccacctcctctaccagc 85 ||||||||| |||||||||||||| Sbjct: 48666 tcaccacccccctcctctaccagc 48689
>gb|AC087301.8| Homo sapiens chromosome 17, clone RP11-661C3, complete sequence Length = 229153 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 51 cctccaccacctcaccacccacctcctc 78 ||||| ||||||||||||||||| |||| Sbjct: 88286 cctcccccacctcaccacccaccccctc 88313
>emb|AJ867400.1| Sorghum bicolor mRNA for glycosyltransferase (a3 gene) Length = 2019 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 1783 cggcaccggcaccggcaccg 1802
>gb|AC023740.4| Drosophila melanogaster X BAC RP98-27J18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 163764 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 131060 ccggcaccggcaccggcacc 131079
>gb|AC116665.1| Papio hamadryas chromosome , clone RP41-119J13, complete sequence Length = 176602 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 21073 gccgcggcagcagctgccgc 21054
>ref|NM_135964.2| Drosophila melanogaster CG17912-RA (CG17912), mRNA Length = 1613 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 681 ggccgccgccgcagcagctgccgc 658
>ref|NM_132016.1| Drosophila melanogaster CG15778-RA (CG15778), mRNA Length = 933 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 397 ccggcaccggcaccggcacc 416
>gb|AC116660.1| Drosophila melanogaster X BAC RP98-27C7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 151605 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 121829 ccggcaccggcaccggcacc 121810
>ref|XM_939705.1| PREDICTED: Homo sapiens similar to Homeobox even-skipped homolog protein 2 (EVX-2) (LOC650617), mRNA Length = 1611 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 1381 gccgcggcagcagctgccgc 1400
>ref|XM_292968.5| PREDICTED: Homo sapiens similar to Homeobox even-skipped homolog protein 2 (EVX-2) (LOC344191), mRNA Length = 1611 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 1381 gccgcggcagcagctgccgc 1400
>emb|AJ575660.1|YLI575660 Yarrowia lipolytica iah1, mts1, stl1, sip3, coq6, cdc37, aep2, tRNA-Gly, tRNA-Thr and 5S rRNA genes and ORF1, ORF2, ORFX, ORF6, ORF7, ORF12, ORF13, ORF15, ORFY, ORF18 and retrotransposon Ylt1 Length = 78189 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 53372 ccggcaccggcaccggcacc 53391
>gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosome 12, complete sequence Length = 196540 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 50 tcctccaccacctcaccacccacctcct 77 ||||| ||||||||||||||| |||||| Sbjct: 88650 tcctcaaccacctcaccacccccctcct 88677
>gb|AY051534.1| Drosophila melanogaster GH18623 full length cDNA Length = 1316 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 681 ggccgccgccgcagcagctgccgc 658
>gb|AC093097.1| Drosophila melanogaster, chromosome 2L, region 36A-36B, BAC clone BACR26O03, complete sequence Length = 175413 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 117419 ggccgccgccgcagcagctgccgc 117396
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 21155382 atggccgccgcggcagcagc 21155401
>gb|AC009336.13|AC009336 Homo sapiens chromosome 2, clone RP11-387A1, complete sequence Length = 175667 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 64326 gccgcggcagcagctgccgc 64307
>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence Length = 139823 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 106008 ccggcaccggcaccggcacc 105989
>gb|AY177892.1| Sorghum bicolor clone BAC 4681 ABA-induced gene, partial sequence Length = 2002 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 cccggcaccggcaccggcac 209 |||||||||||||||||||| Sbjct: 905 cccggcaccggcaccggcac 886
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 ccgccgcgtgggtggcctcg 126 |||||||||||||||||||| Sbjct: 993981 ccgccgcgtgggtggcctcg 993962
>gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0026H19, complete sequence Length = 150620 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 37976 cggcaccggcaccggcaccg 37995
>dbj|AP005187.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0446F04 Length = 175390 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 86682 atggccgccgcggcagcagc 86701
>dbj|AP004673.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0617C02 Length = 135605 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 3817 atggccgccgcggcagcagc 3836
>dbj|AP005757.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0413H11 Length = 147655 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 126592 atggccgccgcggcagcagc 126611
>gb|AF195093.2|AF195093 Streptomyces coelicolor A3(2) plasmid SCP1 putative DNA-primase/helicase gene, complete cds; and unknown gene Length = 5440 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 244 ccggcaccggcaccggcacc 263
>dbj|AK109930.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-A07, full insert sequence Length = 2719 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 663 ccggcaccggcaccggcacc 644
>dbj|AK108023.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-136-A05, full insert sequence Length = 671 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 288 ccggcaccggcaccggcacc 307
>dbj|AK105689.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-C02, full insert sequence Length = 1704 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 941 cggcaccggcaccggcaccg 960
>emb|AJ329487.1|HSA329487 Homo sapiens genomic sequence surrounding NotI site, clone NR5-GC22C Length = 656 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gccgcggcagcagctgccgc 245 |||||||||||||||||||| Sbjct: 136 gccgcggcagcagctgccgc 155
>gb|AC154424.2| Mus musculus BAC clone RP23-172A18 from 13, complete sequence Length = 179691 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 ccaccacctcaccacccacc 73 |||||||||||||||||||| Sbjct: 146242 ccaccacctcaccacccacc 146223
>dbj|AK068128.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013130C23, full insert sequence Length = 1708 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 846 cggcaccggcaccggcaccg 865
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 193 ggcaccggcaccggcaccgattttaaga 220 ||||||||||||||| ||||||| |||| Sbjct: 693489 ggcaccggcaccggcgccgatttcaaga 693462
>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence Length = 240821 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 148972 ccggcaccggcaccggcacc 148991
>gb|AY107571.1| Zea mays PCO144739 mRNA sequence Length = 840 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 591 cggcaccggcaccggcaccg 572
>tpe|BN000623.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx94 gene for class III peroxidase 94 precursor, exon 1 Length = 1050 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 atggccgccgcggcagcagc 239 |||||||||||||||||||| Sbjct: 1 atggccgccgcggcagcagc 20
>gb|AC005119.9|AC005119 Drosophila melanogaster, chromosome 2L, region 36B1-36B2, P1 clone DS06436, complete sequence Length = 68379 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 19856 ggccgccgccgcagcagctgccgc 19833
>gb|AE003652.2| Drosophila melanogaster chromosome 2L, section 61 of 83 of the complete sequence Length = 262525 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 ggccgccgcggcagcagctgccgc 245 ||||||||| |||||||||||||| Sbjct: 128453 ggccgccgccgcagcagctgccgc 128430
>gb|AE003435.3| Drosophila melanogaster chromosome X, section 19 of 74 of the complete sequence Length = 290042 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 56564 ccggcaccggcaccggcacc 56583
>gb|AC104327.6| Mus musculus strain C57BL/6J clone rp23-295a4 map 3, complete sequence Length = 193174 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cggcaccggcaccggcaccg 211 |||||||||||||||||||| Sbjct: 93443 cggcaccggcaccggcaccg 93462
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 40.1 bits (20), Expect = 3.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 184 gggcctcccggcaccggcaccggcaccg 211 |||||||||||||||||| ||| ||||| Sbjct: 3415738 gggcctcccggcaccggccccgacaccg 3415765
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccggcaccggcaccggcacc 210 |||||||||||||||||||| Sbjct: 894338 ccggcaccggcaccggcacc 894357
>gb|AC138587.11| Mus musculus chromosome 9, clone RP24-160H16, complete sequence Length = 185915 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 caccacccacctcctctacc 82 |||||||||||||||||||| Sbjct: 139140 caccacccacctcctctacc 139159
>dbj|AP004896.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT16I07, TM0040, complete sequence Length = 92281 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 50 tcctccaccacctcaccacccacc 73 ||||||||||||||| |||||||| Sbjct: 69378 tcctccaccacctcatcacccacc 69355 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,012,981 Number of Sequences: 3902068 Number of extensions: 2012981 Number of successful extensions: 51449 Number of sequences better than 10.0: 206 Number of HSP's better than 10.0 without gapping: 216 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 48260 Number of HSP's gapped (non-prelim): 3033 length of query: 246 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 224 effective length of database: 17,147,199,772 effective search space: 3840972748928 effective search space used: 3840972748928 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)