>emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete chromosome; segment 10/12
          Length = 340900

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    caggagcggcaggacggcca 30
             ||||||||||||||||||||
Sbjct: 50392 caggagcggcaggacggcca 50373

>gb|AY117439.1| Streptomyces carzinostaticus subsp. neocarzinostaticus neocarzinostatin
             biosynthetic locus, complete sequence
          Length = 92294

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    gagcggcaggacggccaag 32
             |||||||||||||||||||
Sbjct: 23237 gagcggcaggacggccaag 23219

>gb|AC122861.4| Mus musculus BAC clone RP23-140G16 from 19, complete sequence
          Length = 205150

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      gaacacaggagcggcagga 24
              |||||||||||||||||||
Sbjct: 132498 gaacacaggagcggcagga 132516

>gb|BC075199.1| Xenopus laevis MGC83421 protein, mRNA (cDNA clone MGC:83421
           IMAGE:7008829), complete cds
          Length = 696

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 15  agcggcaggacggccaag 32
           ||||||||||||||||||
Sbjct: 113 agcggcaggacggccaag 96

>gb|AC183595.3| Pan troglodytes BAC clone CH251-641G8 from chromosome 2, complete
              sequence
          Length = 211457

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 170282 ggccaaggggcaaggaga 170265

>gb|AY389970.1| Xenopus laevis ribosomal protein S8 mRNA, partial cds
          Length = 569

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 15 agcggcaggacggccaag 32
          ||||||||||||||||||
Sbjct: 73 agcggcaggacggccaag 56

>ref|XM_322077.1| Neurospora crassa OR74A predicted protein (NCU09974.1) partial mRNA
          Length = 2319

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 3    accgaacacaggagcggcagga 24
            ||||||| ||||||||||||||
Sbjct: 1632 accgaacccaggagcggcagga 1611

>ref|XM_952999.1| Neurospora crassa OR74A hypothetical protein (NCU09974.1) partial
            mRNA
          Length = 2319

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 3    accgaacacaggagcggcagga 24
            ||||||| ||||||||||||||
Sbjct: 1632 accgaacccaggagcggcagga 1611

>gb|AC147570.3| Homo sapiens BAC clone RP11-1176F21 from UL, complete sequence
          Length = 191237

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 97077 ggccaaggggcaaggaga 97060

>gb|AC183765.3| Pan troglodytes BAC clone CH251-521I2 from chromosome 2, complete
             sequence
          Length = 179528

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 34518 ggccaaggggcaaggaga 34535

>gb|AC105457.1| Homo sapiens chromosome 21 clone RP11-271G11 map p11-q21.1, complete
             sequence
          Length = 164841

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 94882 ggccaaggggcaaggaga 94899

>emb|CR769776.8| Human DNA sequence from clone RP11-793G16 on chromosome 9 Contains
             three novel pseudogenes, the gene for a novel protein
             similar to ankyrin repeat domain 20A (ANKRD20A), the gene
             for a  novel protein similar to Ankyrin repeat domain
             protein 18A (LOC441424), a pseudogene similar to part of
             cytochrome P450 family protein, a novel zinc finger
             pseudogene and a CpG island, complete sequence
          Length = 161157

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 34497 ggccaaggggcaaggaga 34514

>emb|BX664727.7| Human DNA sequence from clone RP11-146D12 on chromosome 9 Contains the
             3' end of a novel gene similar to ankyrin repeat domain
             20A (ANKRD20A), a novel zinc finger pseudogene, a
             pseudogene similar to part of sorting nexin associated
             golgi protein 1 (SNAG1), a melanoma antigen (LOC51152)
             pseudogene and three novel genes, complete sequence
          Length = 105929

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 63267 ggccaaggggcaaggaga 63250

>emb|CR848007.6| Human DNA sequence from clone RP11-115C9 on chromosome 9 Contains a
             calponin 2 (CNN2) pseudogene, a novel zinc finger
             pseudogene, a pseudogene similar to part of cytochrome
             P450, subfamily IVF, a chromosome 2 open reading frame 14
             (C2orf14) pseudogene, a pseudogene similar to part of
             sorting nexin associated golgi protein 1 (SNAG1), a
             melanoma antigen (LOC51152) pseudogene, four novel
             pseudogenes and an ankyrin repeat domain 20A (ANKRD20A)
             pseudogene, complete sequence
          Length = 149891

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 47971 ggccaaggggcaaggaga 47988

>emb|AL773524.13| Human DNA sequence from clone RP11-250H24 on chromosome 9 Contains a
             calponin 2 (CNN2) pseudogene and a novel pseudogene,
             complete sequence
          Length = 125622

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 11853 ggccaaggggcaaggaga 11836

>emb|AL591441.11| Human DNA sequence from clone RP11-459O16 on chromosome 9 Contains a
              novel pseudogene (LOC283464), a calponin 2 (CNN2)
              pseudogene, a novel zinc finger protein pseudogene, a
              pseudogene similar to part of cytochrome P450 family
              protein, a novel pseudogene, a pseudogene similar to part
              of sorting nexin associated golgi protein 1 (SNAG1) and a
              melanoma antigen (LOC51152) pseudogene, complete sequence
          Length = 162441

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 149762 ggccaaggggcaaggaga 149779

>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a
             pseudogene similar to part of sorting nexin associated
             golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin
             repeat domain 20A, five novel genes, a pseudogene similar
             to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A)
             and a CpG island, complete sequence
          Length = 180498

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 27280 ggccaaggggcaaggaga 27297

>emb|AL445587.10| Human DNA sequence from clone RP11-429D3 on chromosome 9 Contains part of
              a novel gene (LOC158135) and a CpG island, complete
              sequence
          Length = 173062

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 147024 ggccaaggggcaaggaga 147041

>emb|AL391382.10| Human DNA sequence from clone RP11-38M15 on chromosome 13 Contains a
              chromosome 21 open reading frame 70 (C21orf70) pseudogene,
              two novel genes, a calponin 3 acidic (CNN3) pseudogene, a
              zinc finger protein 267 (ZNF267) pseudogene, two novel
              pseudogenes, a novel gene similar to chromosome 21 open
              reading frame 15 (C21orf15), a pseudogene similar to
              cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) (CPF8,
              CYPIVF8), a pseudogene similar to sorting nexin 18 (SNX18),
              a melanoma antigen pseudogene and a CpG island, complete
              sequence
          Length = 186458

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 108480 ggccaaggggcaaggaga 108497

>gb|AC010184.18| Homo sapiens 3 BAC RP11-438D8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 190580

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 27    gccaaggggcaaggagaa 44
             ||||||||||||||||||
Sbjct: 10299 gccaaggggcaaggagaa 10282

>emb|X89442.1|MAPEPSYNT Metarhizium anisopliae pesA gene
          Length = 23733

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 18331 ggccaaggggcaaggaga 18348

>gb|AC113266.24| Papio anubis clone rp41-106a4, complete sequence
          Length = 193032

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 164159 ggccaaggggcaaggaga 164142

>gb|AC073464.5| Homo sapiens BAC clone RP11-134N21 from 2, complete sequence
          Length = 168862

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 123558 ggccaaggggcaaggaga 123575

>gb|BC041553.1| Xenopus laevis MGC83421 protein, mRNA (cDNA clone IMAGE:5543100)
          Length = 703

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 15  agcggcaggacggccaag 32
           ||||||||||||||||||
Sbjct: 125 agcggcaggacggccaag 108

>dbj|BS000004.1| Pan troglodytes chromosome 22 clone:PTB-080D12, map 22, complete
            sequences
          Length = 86840

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 26   ggccaaggggcaaggaga 43
            ||||||||||||||||||
Sbjct: 1156 ggccaaggggcaaggaga 1173

>dbj|BS000003.1| Pan troglodytes chromosome 22 clone:PTB-084L06, map 22, complete
              sequences
          Length = 183187

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 179926 ggccaaggggcaaggaga 179943

>emb|AL163204.2|HS21C004 Homo sapiens chromosome 21 segment HS21C004
          Length = 340000

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 26     ggccaaggggcaaggaga 43
              ||||||||||||||||||
Sbjct: 261828 ggccaaggggcaaggaga 261845

>dbj|AP005212.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-757O6, complete
             sequence
          Length = 174439

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 13500 ggccaaggggcaaggaga 13483

>emb|AL078614.2|HS82L10 Homo sapiens chromosome 21 PAC RPCIP704L1082Q2, complete sequence
          Length = 112597

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 79057 ggccaaggggcaaggaga 79074

>dbj|AP001466.1| Homo sapiens genomic DNA, chromosome 21q11.1, clone:R111H17,
             D21S290-LL56 region, complete sequence
          Length = 115693

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 26    ggccaaggggcaaggaga 43
             ||||||||||||||||||
Sbjct: 53103 ggccaaggggcaaggaga 53120

>emb|AL845329.5| Human DNA sequence from clone RP11-391H1 on chromosome 9, complete
            sequence
          Length = 40742

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 26   ggccaaggggcaaggaga 43
            ||||||||||||||||||
Sbjct: 7421 ggccaaggggcaaggaga 7404


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 200,211
Number of Sequences: 3902068
Number of extensions: 200211
Number of successful extensions: 52552
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52487
Number of HSP's gapped (non-prelim): 65
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)