Clone Name | bastl21f10 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... | 38 | 3.6 | 2 | gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... | 38 | 3.6 | 3 | gb|AE004263.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... | 38 | 3.6 | 4 | dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... | 38 | 3.6 |
---|
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 38.2 bits (19), Expect = 3.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 66 gcccgccgagccgctggtc 84 ||||||||||||||||||| Sbjct: 4094642 gcccgccgagccgctggtc 4094624
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 38.2 bits (19), Expect = 3.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 66 gcccgccgagccgctggtc 84 ||||||||||||||||||| Sbjct: 3884951 gcccgccgagccgctggtc 3884933
>gb|AE004263.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 171 of 251 of the complete chromosome Length = 17384 Score = 38.2 bits (19), Expect = 3.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 7 cccgagctcaagcagcgctttta 29 |||| |||||||||||||||||| Sbjct: 9025 cccgtgctcaagcagcgctttta 9047
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence Length = 3288558 Score = 38.2 bits (19), Expect = 3.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 tcaagcagcgcttttaaac 32 ||||||||||||||||||| Sbjct: 2331467 tcaagcagcgcttttaaac 2331485 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 334,731 Number of Sequences: 3902068 Number of extensions: 334731 Number of successful extensions: 26920 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 26837 Number of HSP's gapped (non-prelim): 83 length of query: 85 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 64 effective length of database: 17,151,101,840 effective search space: 1097670517760 effective search space used: 1097670517760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)