ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl21f07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP003281.3| Oryza sativa (japonica cultivar-group) genomic D... 129 7e-27
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 129 7e-27
3dbj|AP008247.2| Oryza sativa (japonica cultivar-group) genomic D... 129 7e-27
4dbj|AP006530.3| Oryza sativa (japonica cultivar-group) genomic D... 129 7e-27
5dbj|AK101567.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 7e-27
6ref|NM_193801.1| Oryza sativa (japonica cultivar-group), predic... 125 1e-25
7gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9... 50 0.005
8gb|AC122542.3| Mus musculus BAC clone RP24-572J16 from 9, comple... 50 0.005
9gb|AC124444.4| Mus musculus BAC clone RP24-185P7 from chromosome... 42 1.2
10ref|XM_790829.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.2
11ref|XM_790808.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.2
12emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC... 42 1.2
13dbj|AK033679.1| Mus musculus adult male cecum cDNA, RIKEN full-l... 42 1.2
14dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.2
15dbj|AP003096.3| Homo sapiens genomic DNA, chromosome 11 clone:CT... 42 1.2
16gb|AC152412.2| Mus musculus BAC clone RP23-383B18 from 7, comple... 42 1.2
17gb|L27148.1|HUMGAL Homo sapiens galanin gene, 5' end 42 1.2
18dbj|AP001788.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 1.2
19gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Canc... 40 4.7
20gb|AC163349.3| Mus musculus BAC clone RP23-188F5 from chromosome... 40 4.7
21gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome... 40 4.7
22gb|AC142114.3| Mus musculus BAC clone RP23-421C24 from chromosom... 40 4.7
23gb|AC127224.3| Mus musculus BAC clone RP24-498F21 from chromosom... 40 4.7
24gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 4.7
25gb|AC091465.7| Mus musculus chromosome 1, clone RP23-221K1, comp... 40 4.7
26gb|AC114403.15| Mus musculus chromosome 1, clone RP23-197H1, com... 40 4.7
27gb|AC111035.8| Mus musculus chromosome 3, clone RP24-507N18, com... 40 4.7
28emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081 40 4.7
29gb|AC164100.2| Mus musculus BAC clone RP23-11E1 from chromosome ... 40 4.7
30gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genom... 40 4.7
31gb|AC112253.3| Homo sapiens BAC clone RP11-792D21 from 4, comple... 40 4.7
32gb|AC024093.46| Homo sapiens 12 BAC RP11-791I2 (Roswell Park Can... 40 4.7
33gb|AF064862.2| Homo sapiens chromosome 21 clone PAC 31P10 map 21... 40 4.7
34dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.7
35gb|AC098818.3| Homo sapiens BAC clone RP11-109G23 from 4, comple... 40 4.7
36emb|AL954231.3|PTB144O12 Pan troglodytes chromosome 22 BAC PTB-1... 40 4.7
37emb|AL954232.2|RP43039B12 Pan troglodytes chromosome 22 BAC RP43... 40 4.7
38emb|AL954230.2|RP43035C13 Pan troglodytes chromosome 22 BAC RP43... 40 4.7
39emb|CT573073.1| Kuenenia stuttgartiensis genome fragment KUST_C ... 40 4.7
40gb|AC142266.3| Mus musculus BAC clone RP24-380K14 from 14, compl... 40 4.7
41gb|AF064865.1|AF064865 Homo sapiens chromosome 21q22.3 PAC 58D10... 40 4.7
42gb|AC121813.3| Mus musculus BAC clone RP23-457E5 from 9, complet... 40 4.7
43gb|AC091494.9| Oryza sativa chromosome 3 BAC OSJNBa0070N04 genom... 40 4.7 
>dbj|AP003281.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0560B06
          Length = 161720

 Score =  129 bits (65), Expect = 7e-27
 Identities = 157/188 (83%), Gaps = 6/188 (3%)
 Strand = Plus / Minus

                                                                        
Query: 166  agatggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggcctt 225
            |||||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||
Sbjct: 9602 agatggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggacctt 9543

                                                                        
Query: 226  tatttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaatta 285
            ||||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | 
Sbjct: 9542 tatttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tc 9489

                                                                        
Query: 286  cacaacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaattt 345
            |||||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||
Sbjct: 9488 cacaacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaattt 9429

                    
Query: 346  catatttg 353
            ||||||||
Sbjct: 9428 catatttg 9421
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  129 bits (65), Expect = 7e-27
 Identities = 157/188 (83%), Gaps = 6/188 (3%)
 Strand = Plus / Minus

                                                                            
Query: 166      agatggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggcctt 225
                |||||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||
Sbjct: 14993550 agatggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggacctt 14993491

                                                                            
Query: 226      tatttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaatta 285
                ||||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | 
Sbjct: 14993490 tatttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tc 14993437

                                                                            
Query: 286      cacaacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaattt 345
                |||||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||
Sbjct: 14993436 cacaacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaattt 14993377

                        
Query: 346      catatttg 353
                ||||||||
Sbjct: 14993376 catatttg 14993369
to top
>dbj|AP008247.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0784G04
          Length = 157458

 Score =  129 bits (65), Expect = 7e-27
 Identities = 157/188 (83%), Gaps = 6/188 (3%)
 Strand = Plus / Minus

                                                                         
Query: 166   agatggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggcctt 225
             |||||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||
Sbjct: 33112 agatggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggacctt 33053

                                                                         
Query: 226   tatttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaatta 285
             ||||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | 
Sbjct: 33052 tatttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tc 32999

                                                                         
Query: 286   cacaacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaattt 345
             |||||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||
Sbjct: 32998 cacaacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaattt 32939

                     
Query: 346   catatttg 353
             ||||||||
Sbjct: 32938 catatttg 32931
to top
>dbj|AP006530.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1329D01
          Length = 141938

 Score =  129 bits (65), Expect = 7e-27
 Identities = 157/188 (83%), Gaps = 6/188 (3%)
 Strand = Plus / Minus

                                                                         
Query: 166   agatggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggcctt 225
             |||||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||
Sbjct: 19797 agatggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggacctt 19738

                                                                         
Query: 226   tatttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaatta 285
             ||||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | 
Sbjct: 19737 tatttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tc 19684

                                                                         
Query: 286   cacaacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaattt 345
             |||||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||
Sbjct: 19683 cacaacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaattt 19624

                     
Query: 346   catatttg 353
             ||||||||
Sbjct: 19623 catatttg 19616
to top
>dbj|AK101567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050F16, full
           insert sequence
          Length = 3056

 Score =  129 bits (65), Expect = 7e-27
 Identities = 157/188 (83%), Gaps = 6/188 (3%)
 Strand = Plus / Plus

                                                                       
Query: 166 agatggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggcctt 225
           |||||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||
Sbjct: 297 agatggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggacctt 356

                                                                       
Query: 226 tatttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaatta 285
           ||||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | 
Sbjct: 357 tatttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tc 410

                                                                       
Query: 286 cacaacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaattt 345
           |||||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||
Sbjct: 411 cacaacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaattt 470

                   
Query: 346 catatttg 353
           ||||||||
Sbjct: 471 catatttg 478
to top
>ref|NM_193801.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1149

 Score =  125 bits (63), Expect = 1e-25
 Identities = 155/186 (83%), Gaps = 6/186 (3%)
 Strand = Plus / Plus

                                                                       
Query: 168 atggattacatatcccctgagagaagtctggatgggacttgtggagaccctgggccttta 227
           |||||||||||||||||||| ||||||||||| ||| |||||||||| || || ||||||
Sbjct: 1   atggattacatatcccctgatagaagtctggaaggggcttgtggagatcccggaccttta 60

                                                                       
Query: 228 tttggagatcaagatggtagcttgttggagcacatggattatcatggtgaaggaattaca 287
           ||||||||||| ||||| |||||||| |||||||||| || ||| || ||      | ||
Sbjct: 61  tttggagatcatgatgggagcttgttagagcacatgggttttcacgggga------tcca 114

                                                                       
Query: 288 caacctgaatccccaccgctgaatgatggacttttagttgatgcagccgatcaaatttca 347
           |||| || ||| |||| ||| ||||| || |||||||||||| || | || |||||||||
Sbjct: 115 caacatgtatctccacagctaaatgaagggcttttagttgattcaactgaccaaatttca 174

                 
Query: 348 tatttg 353
           ||||||
Sbjct: 175 tatttg 180
to top
>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence
          Length = 185444

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 27    ccattgcttcttcttcccttctctc 51
             |||||||||||||||||||||||||
Sbjct: 37974 ccattgcttcttcttcccttctctc 37950
to top
>gb|AC122542.3| Mus musculus BAC clone RP24-572J16 from 9, complete sequence
          Length = 175952

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 27    ccattgcttcttcttcccttctctc 51
             |||||||||||||||||||||||||
Sbjct: 40741 ccattgcttcttcttcccttctctc 40765
to top
>gb|AC124444.4| Mus musculus BAC clone RP24-185P7 from chromosome 7, complete sequence
          Length = 184996

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    ttcttcttcccttctctctcc 54
             |||||||||||||||||||||
Sbjct: 44541 ttcttcttcccttctctctcc 44561
to top
>ref|XM_790829.1| PREDICTED: Strongylocentrotus purpuratus similar to golgi
           associated PDZ and coiled-coil motif containing
           (LOC591258), mRNA
          Length = 549

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 268 atcatggtgaaggaattacacaacc 292
           ||||||| |||||||||||||||||
Sbjct: 259 atcatggagaaggaattacacaacc 283
to top
>ref|XM_790808.1| PREDICTED: Strongylocentrotus purpuratus similar to golgi
           associated PDZ and coiled-coil motif containing
           (LOC591235), mRNA
          Length = 408

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 268 atcatggtgaaggaattacacaacc 292
           ||||||| |||||||||||||||||
Sbjct: 85  atcatggagaaggaattacacaacc 109
to top
>emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E3 (ESSA project)
          Length = 83485

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tcaatccattgcttcttcttc 42
             |||||||||||||||||||||
Sbjct: 67401 tcaatccattgcttcttcttc 67421
to top
>dbj|AK033679.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched
          library, clone:9130219B17 product:unclassifiable, full
          insert sequence
          Length = 1928

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 34 ttcttcttcccttctctctcc 54
          |||||||||||||||||||||
Sbjct: 57 ttcttcttcccttctctctcc 37
to top
>dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUK11
          Length = 79073

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tcaatccattgcttcttcttc 42
             |||||||||||||||||||||
Sbjct: 25014 tcaatccattgcttcttcttc 25034
to top
>dbj|AP003096.3| Homo sapiens genomic DNA, chromosome 11 clone:CTD-2007L18, complete
             sequence
          Length = 174605

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    cttcttcttcccttctctctc 53
             |||||||||||||||||||||
Sbjct: 97888 cttcttcttcccttctctctc 97908
to top
>gb|AC152412.2| Mus musculus BAC clone RP23-383B18 from 7, complete sequence
          Length = 196399

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 34     ttcttcttcccttctctctcc 54
              |||||||||||||||||||||
Sbjct: 116282 ttcttcttcccttctctctcc 116302
to top
>gb|L27148.1|HUMGAL Homo sapiens galanin gene, 5' end
          Length = 3200

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 33  cttcttcttcccttctctctc 53
           |||||||||||||||||||||
Sbjct: 504 cttcttcttcccttctctctc 524
to top
>dbj|AP001788.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-259D17, complete
              sequence
          Length = 188250

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 33     cttcttcttcccttctctctc 53
              |||||||||||||||||||||
Sbjct: 162937 cttcttcttcccttctctctc 162957
to top
>gb|AC155712.8| Mus musculus 10 BAC RP24-183O8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 151709

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ttcttcttcccttctctctc 53
              ||||||||||||||||||||
Sbjct: 136213 ttcttcttcccttctctctc 136232
to top
>gb|AC163349.3| Mus musculus BAC clone RP23-188F5 from chromosome 3, complete sequence
          Length = 226848

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 31     tgcttcttcttcccttctctctcc 54
              |||||||||||||||| |||||||
Sbjct: 181012 tgcttcttcttcccttttctctcc 180989
to top
>gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome 10, complete sequence
          Length = 217745

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    tcttcttcccttctctctcc 54
             ||||||||||||||||||||
Sbjct: 15391 tcttcttcccttctctctcc 15410
to top
>gb|AC142114.3| Mus musculus BAC clone RP23-421C24 from chromosome 14, complete
             sequence
          Length = 196408

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ttcttcccttctctctccaa 56
             ||||||||||||||||||||
Sbjct: 37940 ttcttcccttctctctccaa 37921
to top
>gb|AC127224.3| Mus musculus BAC clone RP24-498F21 from chromosome 10, complete sequence
          Length = 162143

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     tcttcttcccttctctctcc 54
              ||||||||||||||||||||
Sbjct: 108059 tcttcttcccttctctctcc 108078
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 33       cttcttcttcccttctctct 52
                ||||||||||||||||||||
Sbjct: 31808042 cttcttcttcccttctctct 31808061
to top
>gb|AC091465.7| Mus musculus chromosome 1, clone RP23-221K1, complete sequence
          Length = 199109

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ttcttcttcccttctctctc 53
              ||||||||||||||||||||
Sbjct: 196805 ttcttcttcccttctctctc 196786
to top
>gb|AC114403.15| Mus musculus chromosome 1, clone RP23-197H1, complete sequence
          Length = 221305

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ttcttcttcccttctctctc 53
              ||||||||||||||||||||
Sbjct: 202426 ttcttcttcccttctctctc 202445
to top
>gb|AC111035.8| Mus musculus chromosome 3, clone RP24-507N18, complete sequence
          Length = 147759

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 31    tgcttcttcttcccttctctctcc 54
             |||||||||||||||| |||||||
Sbjct: 70181 tgcttcttcttcccttttctctcc 70158
to top
>emb|AL163281.2|HS21C081 Homo sapiens chromosome 21 segment HS21C081
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     aatccattgcttcttcttcc 43
              ||||||||||||||||||||
Sbjct: 297914 aatccattgcttcttcttcc 297895
to top
>gb|AC164100.2| Mus musculus BAC clone RP23-11E1 from chromosome 14, complete sequence
          Length = 214128

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 31     tgcttcttcttcccttctctctcc 54
              ||||| ||||||||||||||||||
Sbjct: 197774 tgcttattcttcccttctctctcc 197797
to top
>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete
              sequence
          Length = 134496

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     cttcttcttcccttctctct 52
              ||||||||||||||||||||
Sbjct: 133268 cttcttcttcccttctctct 133287
to top
>gb|AC112253.3| Homo sapiens BAC clone RP11-792D21 from 4, complete sequence
          Length = 113656

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 32    gcttcttcttcccttctctctcca 55
             |||||||||||||||| |||||||
Sbjct: 98636 gcttcttcttcccttccctctcca 98659
to top
>gb|AC024093.46| Homo sapiens 12 BAC RP11-791I2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 148869

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 264   gattatcatggtgaaggaat 283
             ||||||||||||||||||||
Sbjct: 45455 gattatcatggtgaaggaat 45436
to top
>gb|AF064862.2| Homo sapiens chromosome 21 clone PAC 31P10 map 21q22.3, complete sequence
          Length = 145861

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     aatccattgcttcttcttcc 43
              ||||||||||||||||||||
Sbjct: 143716 aatccattgcttcttcttcc 143697
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 33       cttcttcttcccttctctct 52
                ||||||||||||||||||||
Sbjct: 31898558 cttcttcttcccttctctct 31898577
to top
>gb|AC098818.3| Homo sapiens BAC clone RP11-109G23 from 4, complete sequence
          Length = 216451

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 32    gcttcttcttcccttctctctcca 55
             |||||||||||||||| |||||||
Sbjct: 33951 gcttcttcttcccttccctctcca 33974
to top
>emb|AL954231.3|PTB144O12 Pan troglodytes chromosome 22 BAC PTB-144O12, complete sequence
          Length = 180638

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    aatccattgcttcttcttcc 43
             ||||||||||||||||||||
Sbjct: 28150 aatccattgcttcttcttcc 28131
to top
>emb|AL954232.2|RP43039B12 Pan troglodytes chromosome 22 BAC RP43-039B12, complete sequence
          Length = 201761

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    aatccattgcttcttcttcc 43
             ||||||||||||||||||||
Sbjct: 36359 aatccattgcttcttcttcc 36340
to top
>emb|AL954230.2|RP43035C13 Pan troglodytes chromosome 22 BAC RP43-035C13, complete sequence
          Length = 157305

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    aatccattgcttcttcttcc 43
             ||||||||||||||||||||
Sbjct: 69921 aatccattgcttcttcttcc 69902
to top
>emb|CT573073.1| Kuenenia stuttgartiensis genome fragment KUST_C (3 of 5)
          Length = 893329

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      cctcccaaaaatctcaatcc 28
              ||||||||||||||||||||
Sbjct: 527304 cctcccaaaaatctcaatcc 527323
to top
>gb|AC142266.3| Mus musculus BAC clone RP24-380K14 from 14, complete sequence
          Length = 185704

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    ttcttcccttctctctccaa 56
             ||||||||||||||||||||
Sbjct: 15207 ttcttcccttctctctccaa 15226
to top
>gb|AF064865.1|AF064865 Homo sapiens chromosome 21q22.3 PAC 58D10, complete sequence
          Length = 159424

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    aatccattgcttcttcttcc 43
             ||||||||||||||||||||
Sbjct: 62547 aatccattgcttcttcttcc 62528
to top
>gb|AC121813.3| Mus musculus BAC clone RP23-457E5 from 9, complete sequence
          Length = 178176

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    gcttcttcttcccttctctc 51
             ||||||||||||||||||||
Sbjct: 97744 gcttcttcttcccttctctc 97763
to top
>gb|AC091494.9| Oryza sativa chromosome 3 BAC OSJNBa0070N04 genomic sequence,
            complete sequence
          Length = 150663

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 33   cttcttcttcccttctctct 52
            ||||||||||||||||||||
Sbjct: 9295 cttcttcttcccttctctct 9314


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,752,998
Number of Sequences: 3902068
Number of extensions: 3752998
Number of successful extensions: 63055
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62938
Number of HSP's gapped (non-prelim): 117
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top