ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl21f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 0.17
2dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 0.68
3gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 0.68
4gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 38 2.7
5gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 38 2.7
6gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 38 2.7
7gb|AE006470.1| Chlorobium tepidum TLS, complete genome 38 2.7

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 27      cgcccgctcgcccgccgggccgaga 51
               |||||||||||||| ||||||||||
Sbjct: 4739168 cgcccgctcgcccggcgggccgaga 4739192



 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 27      cgcccgctcgcccgccgggc 46
               ||||||||||||||||||||
Sbjct: 1661056 cgcccgctcgcccgccgggc 1661075



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     cgctcgcccgccgggccgag 50
              ||||||||||||||||||||
Sbjct: 630334 cgctcgcccgccgggccgag 630353



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     cgctcgcccgccgggccgag 50
              ||||||||||||||||||||
Sbjct: 292495 cgctcgcccgccgggccgag 292514



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 22      cggatcgcccgctcgcccg 40
               |||||||||||||||||||
Sbjct: 1489666 cggatcgcccgctcgcccg 1489648



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 27      cgcccgctcgcccgccgggccga 49
               ||||||||||| |||||||||||
Sbjct: 1083807 cgcccgctcgctcgccgggccga 1083785



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 34     tcgcccgccgggccgagatctcc 56
              |||||||||||||||||| ||||
Sbjct: 723651 tcgcccgccgggccgagaactcc 723629



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 24      gatcgcccgctcgcccgcc 42
               |||||||||||||||||||
Sbjct: 1869103 gatcgcccgctcgcccgcc 1869121



 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 11     accactccacccggatcgcccgc 33
              ||||| |||||||||||||||||
Sbjct: 852586 accacgccacccggatcgcccgc 852608


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 339,113
Number of Sequences: 3902068
Number of extensions: 339113
Number of successful extensions: 23479
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22938
Number of HSP's gapped (non-prelim): 541
length of query: 69
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 48
effective length of database: 17,151,101,840
effective search space: 823252888320
effective search space used: 823252888320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top