ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl21b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_483481.1| Oryza sativa (japonica cultivar-group), mRNA 396 e-107
2dbj|AK120362.1| Oryza sativa (japonica cultivar-group) cDNA clon... 396 e-107
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 295 7e-77
4dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic D... 295 7e-77
5dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic D... 295 7e-77
6ref|NM_130313.2| Arabidopsis thaliana CAO (CHAOS); chromatin bin... 48 0.027
7gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma... 48 0.027
8gb|AY057532.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, co... 48 0.027
9gb|AY054584.1| Arabidopsis thaliana Unknown protein (At2g47450; ... 48 0.027
10gb|AY050442.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, co... 48 0.027
11emb|BX818913.1|CNS0A8VQ Arabidopsis thaliana Full-length cDNA Co... 48 0.027
12emb|BX820133.1|CNS0A8G0 Arabidopsis thaliana Full-length cDNA Co... 48 0.027
13emb|BX819641.1|CNS0A8FA Arabidopsis thaliana Full-length cDNA Co... 48 0.027
14gb|AF107207.2| Mycobacterium avium insertion sequence IS666 tran... 48 0.027
15gb|BT002191.1| Arabidopsis thaliana Unknown protein (At2g47450) ... 48 0.027
16ref|XM_464703.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.43
17ref|XM_755763.1| Ustilago maydis 521 hypothetical protein (UM047... 44 0.43
18gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 44 0.43
19dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.43
20gb|AE004910.1| Pseudomonas aeruginosa PAO1, section 471 of 529 o... 44 0.43
21gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 0.43
22dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.43
23dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.43
24ref|XM_362723.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.7
25gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 42 1.7
26gb|AY095952.1| Bordetella avium heme utilization locus, complete... 42 1.7
27emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.7
28emb|BX640417.1| Bordetella pertussis strain Tohama I, complete g... 42 1.7
29emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 42 1.7
30gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 1.7
31gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 6.7
32ref|XM_508630.1| PREDICTED: Pan troglodytes similar to Rho guani... 40 6.7
33gb|AF335591.1| Homo sapiens WNT4 (WNT4) gene, partial cds 40 6.7
34ref|XM_592181.2| PREDICTED: Bos taurus similar to Y37D8A.2, tran... 40 6.7
35ref|XM_872972.1| PREDICTED: Bos taurus similar to Y37D8A.2, tran... 40 6.7
36ref|XM_872890.1| PREDICTED: Bos taurus similar to Y37D8A.2, tran... 40 6.7
37gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 6.7
38gb|AY519504.1| Mus musculus extended extralong alpha s XXLb2 mRN... 40 6.7
39gb|AY519503.1| Mus musculus extended extralong alpha s XXLb1 mRN... 40 6.7
40gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 40 6.7
41emb|AJ784793.1| Agromyces luteolus partial gyrB gene for DNA gyr... 40 6.7
42gb|BC112461.1| Bos taurus similar to Y37D8A.2, mRNA (cDNA clone ... 40 6.7
43emb|AL445253.13| Human DNA sequence from clone RP4-660K3 on chro... 40 6.7
44gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 6.7
45emb|BX072159.1|CNS09RUB Single read from an extremity of a full-... 40 6.7
46emb|BX066851.1|CNS09NQV Single read from an extremity of a full-... 40 6.7
47emb|BX066850.1|CNS09NQU Single read from an extremity of a full-... 40 6.7
48emb|BX065180.1|CNS09MGG Single read from an extremity of a full-... 40 6.7
49emb|BX065179.1|CNS09MGF Single read from an extremity of a full-... 40 6.7
50emb|BX058503.1|CNS09HAZ Single read from an extremity of a full-... 40 6.7
51emb|BX053056.1|CNS09D3O Single read from an extremity of a full-... 40 6.7
52emb|BX052048.1|CNS09CBO Single read from an extremity of a full-... 40 6.7
53emb|BX052047.1|CNS09CBN Single read from an extremity of a full-... 40 6.7
54emb|BX044956.1|CNS096UO Single read from an extremity of a full-... 40 6.7
55emb|BX040084.1|CNS0933C Single read from an extremity of a full-... 40 6.7
56emb|BX040083.1|CNS0933B Single read from an extremity of a full-... 40 6.7
57emb|BX038927.1|CNS09277 Single read from an extremity of a full-... 40 6.7
58emb|BX038735.1|CNS0921V Single read from an extremity of a full-... 40 6.7
59emb|BX038734.1|CNS0921U Single read from an extremity of a full-... 40 6.7
60emb|BX038711.1|CNS09217 Single read from an extremity of a full-... 40 6.7
61emb|BX037848.1|CNS091D8 Single read from an extremity of a full-... 40 6.7
62emb|BX037728.1|CNS0919W Single read from an extremity of a full-... 40 6.7
63emb|BX037667.1|CNS09187 Single read from an extremity of a full-... 40 6.7
64emb|BX037666.1|CNS09186 Single read from an extremity of a full-... 40 6.7
65emb|BX037643.1|CNS0917J Single read from an extremity of a full-... 40 6.7
66emb|BX037599.1|CNS0916B Single read from an extremity of a full-... 40 6.7
67emb|BX037598.1|CNS0916A Single read from an extremity of a full-... 40 6.7
68emb|BX037375.1|CNS09103 Single read from an extremity of a full-... 40 6.7
69emb|BX037374.1|CNS09102 Single read from an extremity of a full-... 40 6.7
70emb|BX036815.1|CNS090KJ Single read from an extremity of a full-... 40 6.7
71emb|BX036814.1|CNS090KI Single read from an extremity of a full-... 40 6.7
72emb|BX036505.1|CNS090BX Single read from an extremity of a full-... 40 6.7
73emb|BX036504.1|CNS090BW Single read from an extremity of a full-... 40 6.7
74emb|BX036255.1|CNS0904Z Single read from an extremity of a full-... 40 6.7
75emb|BX036254.1|CNS0904Y Single read from an extremity of a full-... 40 6.7
76emb|BX031615.1|CNS08WK3 Single read from an extremity of a full-... 40 6.7
77emb|BX030771.1|CNS08VWN Single read from an extremity of a full-... 40 6.7
78emb|BX028441.1|CNS08U3X Single read from an extremity of a full-... 40 6.7
79emb|BX027946.1|CNS08TQ6 Single read from an extremity of a full-... 40 6.7
80emb|BX027026.1|CNS08T0M Single read from an extremity of a full-... 40 6.7
81emb|BX024776.1|CNS08RA4 Single read from an extremity of a full-... 40 6.7
82emb|BX020960.1|CNS08OC4 Single read from an extremity of a full-... 40 6.7
83emb|BX020959.1|CNS08OC3 Single read from an extremity of a full-... 40 6.7
84emb|BX020885.1|CNS08OA1 Single read from an extremity of a full-... 40 6.7
85emb|BX020884.1|CNS08OA0 Single read from an extremity of a full-... 40 6.7
86emb|BX018600.1|CNS08MIK Single read from an extremity of a full-... 40 6.7
87emb|BX017387.1|CNS08LKV Single read from an extremity of a full-... 40 6.7
88emb|BX017224.1|CNS08LGC Single read from an extremity of a full-... 40 6.7
89emb|BX017012.1|CNS08LAG Single read from an extremity of a full-... 40 6.7
90emb|BX016613.1|CNS08KZD Single read from an extremity of a full-... 40 6.7
91emb|BX016218.1|CNS08KOE Single read from an extremity of a full-... 40 6.7
92emb|BX016217.1|CNS08KOD Single read from an extremity of a full-... 40 6.7
93emb|BX015278.1|CNS08JYA Single read from an extremity of a full-... 40 6.7
94emb|BX014963.1|CNS08JPJ Single read from an extremity of a full-... 40 6.7
95emb|BX012103.1|CNS08HI3 Single read from an extremity of a full-... 40 6.7
96emb|BX012102.1|CNS08HI2 Single read from an extremity of a full-... 40 6.7
97emb|BX009098.1|CNS08F6M Single read from an extremity of a full-... 40 6.7
98emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.7
99emb|AL583919.1|MLEPRTN3 Mycobacterium leprae strain TN complete ... 40 6.7
100emb|AJ416111.1|GGA416111 Gallus gallus mRNA for cytokine recepto... 40 6.7
101ref|NM_204575.1| Gallus gallus leukemia inhibitory factor recept... 40 6.7
102emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chr... 40 6.7
103gb|AY133540.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, co... 40 6.7
104gb|AE011625.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 6.7
105gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 6.7
106gb|AC010768.10| Homo sapiens chromosome 11, clone RP11-58K22, co... 40 6.7
107ref|XM_939639.1| PREDICTED: Homo sapiens similar to Sphingomyeli... 40 6.7
108gb|AY033057.1|AY033055S3 Homo sapiens secreted glycoprotein Wnt4... 40 6.7
109gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.7
110gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.7
111dbj|AK030489.1| Mus musculus adult male pituitary gland cDNA, RI... 40 6.7
112dbj|AK047990.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 6.7
113gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete ge... 40 6.7
114gb|AE004806.1| Pseudomonas aeruginosa PAO1, section 367 of 529 o... 40 6.7
115gb|AE004447.1| Pseudomonas aeruginosa PAO1, section 8 of 529 of ... 40 6.7
116gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 6.7
117ref|XM_578206.1| PREDICTED: Rattus norvegicus similar to extende... 40 6.7
118gb|AF427793.1| Nannocystis exedends retron-Ne144, complete sequence 40 6.7
119dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 6.7
120dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 6.7
121emb|AL929537.17| Mouse DNA sequence from clone RP23-147E9 on chr... 40 6.7
122ref|XM_321877.2| Anopheles gambiae str. PEST ENSANGP00000013957 ... 40 6.7
123gb|AF013115.1|AF013115 Arabidopsis thaliana CAO gene, nuclear ge... 40 6.7
124gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.7
125gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 6.7
126gb|U67266.1|HSKAMS01 Human metastasis suppressor (KAI1) gene, ex... 40 6.7
127gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 6.7
128emb|AJ251761.1|MMU251761 Mus musculus Nesp55 gene for neuroendoc... 40 6.7
129emb|AJ245739.1|MMU245739 Mus musculus partial Gnasxl gene for ex... 40 6.7

>ref|XM_483481.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2667

 Score =  396 bits (200), Expect = e-107
 Identities = 308/344 (89%)
 Strand = Plus / Plus

                                                                       
Query: 150 cgccggccacgcccccgaacccgacccctccgccggccacgcacccccacccctcgtcct 209
           |||||||||||||||| |||||| || |||| || ||| |||  || | | |||  ||||
Sbjct: 149 cgccggccacgccccccaacccgcccgctccccccgccgcgccgccgcccaccttctcct 208

                                                                       
Query: 210 ccacgcggccgccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 269
           || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 cctcgcggcccccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 268

                                                                       
Query: 270 atggccgccctcccaccgagcccgaggtcgacgcctacatcgacgcccaccgccccgagc 329
           | |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 269 acggccgcccgcccaccgaggccgaggtcgacgcctacatcgacgtccaccgccccgagc 328

                                                                       
Query: 330 tcccgtccctcccccgctcccagctccaccagcgcctcctcgcgcttcggggcgaccagg 389
           |||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 329 tcccctccctcccccgctcccagctccaccagcgcctcctcgccctccgcggcgaccagg 388

                                                                       
Query: 390 ttttagatccagaccaaagtgcattcccatacaggttccagcgaaccgatctctggaagc 449
           |||||||| ||||||||||||| ||||| || ||||||||||| || ||||| |||||||
Sbjct: 389 ttttagatgcagaccaaagtgctttcccgtataggttccagcggactgatctttggaagc 448

                                                       
Query: 450 ctgtgtatcagtggttggaaactcttgagatggactcgctagtt 493
           |||||||  ||||||||||| |||||||| | || |||||||||
Sbjct: 449 ctgtgtacaagtggttggaatctcttgagctagagtcgctagtt 492



 Score =  101 bits (51), Expect = 2e-18
 Identities = 57/59 (96%)
 Strand = Plus / Plus

                                                                     
Query: 8  atgccggaaccgcaggccatcctcccgctccgcgcgctgccgccggacgcgccgctccc 66
          |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 1  atgccggagccgcaggccatcctcccgctccgcgcgctcccgccggacgcgccgctccc 59



to top

>dbj|AK120362.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067O11, full
           insert sequence
          Length = 3156

 Score =  396 bits (200), Expect = e-107
 Identities = 308/344 (89%)
 Strand = Plus / Plus

                                                                       
Query: 150 cgccggccacgcccccgaacccgacccctccgccggccacgcacccccacccctcgtcct 209
           |||||||||||||||| |||||| || |||| || ||| |||  || | | |||  ||||
Sbjct: 199 cgccggccacgccccccaacccgcccgctccccccgccgcgccgccgcccaccttctcct 258

                                                                       
Query: 210 ccacgcggccgccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 269
           || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 259 cctcgcggcccccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 318

                                                                       
Query: 270 atggccgccctcccaccgagcccgaggtcgacgcctacatcgacgcccaccgccccgagc 329
           | |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 319 acggccgcccgcccaccgaggccgaggtcgacgcctacatcgacgtccaccgccccgagc 378

                                                                       
Query: 330 tcccgtccctcccccgctcccagctccaccagcgcctcctcgcgcttcggggcgaccagg 389
           |||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 379 tcccctccctcccccgctcccagctccaccagcgcctcctcgccctccgcggcgaccagg 438

                                                                       
Query: 390 ttttagatccagaccaaagtgcattcccatacaggttccagcgaaccgatctctggaagc 449
           |||||||| ||||||||||||| ||||| || ||||||||||| || ||||| |||||||
Sbjct: 439 ttttagatgcagaccaaagtgctttcccgtataggttccagcggactgatctttggaagc 498

                                                       
Query: 450 ctgtgtatcagtggttggaaactcttgagatggactcgctagtt 493
           |||||||  ||||||||||| |||||||| | || |||||||||
Sbjct: 499 ctgtgtacaagtggttggaatctcttgagctagagtcgctagtt 542



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Plus

                                                                       
Query: 7   aatgccggaaccgcaggccatcctcccgctccgcgcgctgccgccggacgcgccgctccc 66
           ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 50  aatgccggagccgcaggccatcctcccgctccgcgcgctcccgccggacgcgccgctccc 109



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  295 bits (149), Expect = 7e-77
 Identities = 218/241 (90%)
 Strand = Plus / Minus

                                                                            
Query: 150      cgccggccacgcccccgaacccgacccctccgccggccacgcacccccacccctcgtcct 209
                |||||||||||||||| |||||| || |||| || ||| |||  || | | |||  ||||
Sbjct: 26455072 cgccggccacgccccccaacccgcccgctccccccgccgcgccgccgcccaccttctcct 26455013

                                                                            
Query: 210      ccacgcggccgccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 269
                || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26455012 cctcgcggcccccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 26454953

                                                                            
Query: 270      atggccgccctcccaccgagcccgaggtcgacgcctacatcgacgcccaccgccccgagc 329
                | |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 26454952 acggccgcccgcccaccgaggccgaggtcgacgcctacatcgacgtccaccgccccgagc 26454893

                                                                            
Query: 330      tcccgtccctcccccgctcccagctccaccagcgcctcctcgcgcttcggggcgaccagg 389
                |||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 26454892 tcccctccctcccccgctcccagctccaccagcgcctcctcgccctccgcggcgaccagg 26454833

                 
Query: 390      t 390
                |
Sbjct: 26454832 t 26454832



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                            
Query: 387      aggttttagatccagaccaaagtgcattcccatacaggttccagcgaaccgatctctgga 446
                ||||||||||| ||||||||||||| ||||| || ||||||||||| || ||||| ||||
Sbjct: 26454298 aggttttagatgcagaccaaagtgctttcccgtataggttccagcggactgatctttgga 26454239

                                                               
Query: 447      agcctgtgtatcagtggttggaaactcttgagatggactcgctagtt 493
                ||||||||||  ||||||||||| |||||||| | || |||||||||
Sbjct: 26454238 agcctgtgtacaagtggttggaatctcttgagctagagtcgctagtt 26454192



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                            
Query: 7        aatgccggaaccgcaggccatcctcccgctccgcgcgctgccgccggacgcgccgctccc 66
                ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 26455221 aatgccggagccgcaggccatcctcccgctccgcgcgctcccgccggacgcgccgctccc 26455162



to top

>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1789_C07
          Length = 138944

 Score =  295 bits (149), Expect = 7e-77
 Identities = 218/241 (90%)
 Strand = Plus / Minus

                                                                          
Query: 150    cgccggccacgcccccgaacccgacccctccgccggccacgcacccccacccctcgtcct 209
              |||||||||||||||| |||||| || |||| || ||| |||  || | | |||  ||||
Sbjct: 104624 cgccggccacgccccccaacccgcccgctccccccgccgcgccgccgcccaccttctcct 104565

                                                                          
Query: 210    ccacgcggccgccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 269
              || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104564 cctcgcggcccccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 104505

                                                                          
Query: 270    atggccgccctcccaccgagcccgaggtcgacgcctacatcgacgcccaccgccccgagc 329
              | |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 104504 acggccgcccgcccaccgaggccgaggtcgacgcctacatcgacgtccaccgccccgagc 104445

                                                                          
Query: 330    tcccgtccctcccccgctcccagctccaccagcgcctcctcgcgcttcggggcgaccagg 389
              |||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 104444 tcccctccctcccccgctcccagctccaccagcgcctcctcgccctccgcggcgaccagg 104385

               
Query: 390    t 390
              |
Sbjct: 104384 t 104384



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 387    aggttttagatccagaccaaagtgcattcccatacaggttccagcgaaccgatctctgga 446
              ||||||||||| ||||||||||||| ||||| || ||||||||||| || ||||| ||||
Sbjct: 103850 aggttttagatgcagaccaaagtgctttcccgtataggttccagcggactgatctttgga 103791

                                                             
Query: 447    agcctgtgtatcagtggttggaaactcttgagatggactcgctagtt 493
              ||||||||||  ||||||||||| |||||||| | || |||||||||
Sbjct: 103790 agcctgtgtacaagtggttggaatctcttgagctagagtcgctagtt 103744



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                          
Query: 7      aatgccggaaccgcaggccatcctcccgctccgcgcgctgccgccggacgcgccgctccc 66
              ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 104773 aatgccggagccgcaggccatcctcccgctccgcgcgctcccgccggacgcgccgctccc 104714



to top

>dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0702E04
          Length = 190948

 Score =  295 bits (149), Expect = 7e-77
 Identities = 218/241 (90%)
 Strand = Plus / Minus

                                                                        
Query: 150  cgccggccacgcccccgaacccgacccctccgccggccacgcacccccacccctcgtcct 209
            |||||||||||||||| |||||| || |||| || ||| |||  || | | |||  ||||
Sbjct: 3939 cgccggccacgccccccaacccgcccgctccccccgccgcgccgccgcccaccttctcct 3880

                                                                        
Query: 210  ccacgcggccgccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 269
            || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3879 cctcgcggcccccgcacccatgggagatcgccgcgcgcgcctggctcgagtccttccccg 3820

                                                                        
Query: 270  atggccgccctcccaccgagcccgaggtcgacgcctacatcgacgcccaccgccccgagc 329
            | |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||
Sbjct: 3819 acggccgcccgcccaccgaggccgaggtcgacgcctacatcgacgtccaccgccccgagc 3760

                                                                        
Query: 330  tcccgtccctcccccgctcccagctccaccagcgcctcctcgcgcttcggggcgaccagg 389
            |||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct: 3759 tcccctccctcccccgctcccagctccaccagcgcctcctcgccctccgcggcgaccagg 3700

             
Query: 390  t 390
            |
Sbjct: 3699 t 3699



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                        
Query: 387  aggttttagatccagaccaaagtgcattcccatacaggttccagcgaaccgatctctgga 446
            ||||||||||| ||||||||||||| ||||| || ||||||||||| || ||||| ||||
Sbjct: 3165 aggttttagatgcagaccaaagtgctttcccgtataggttccagcggactgatctttgga 3106

                                                           
Query: 447  agcctgtgtatcagtggttggaaactcttgagatggactcgctagtt 493
            ||||||||||  ||||||||||| |||||||| | || |||||||||
Sbjct: 3105 agcctgtgtacaagtggttggaatctcttgagctagagtcgctagtt 3059



 Score =  103 bits (52), Expect = 5e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 7    aatgccggaaccgcaggccatcctcccgctccgcgcgctgccgccggacgcgccgctccc 66
            ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 4088 aatgccggagccgcaggccatcctcccgctccgcgcgctcccgccggacgcgccgctccc 4029



to top

>ref|NM_130313.2| Arabidopsis thaliana CAO (CHAOS); chromatin binding AT2G47450 (CAO)
           mRNA, complete cds
          Length = 1634

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 753 gctcccagctccaccagcgcctcc 730



to top

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 345   gctcccagctccaccagcgcctcc 368
             ||||||||||||||||||||||||
Sbjct: 75207 gctcccagctccaccagcgcctcc 75230



to top

>gb|AY057532.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, complete cds
          Length = 1537

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 656 gctcccagctccaccagcgcctcc 633



to top

>gb|AY054584.1| Arabidopsis thaliana Unknown protein (At2g47450; T30B22.25) mRNA,
           complete cds
          Length = 1263

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 753 gctcccagctccaccagcgcctcc 730



to top

>gb|AY050442.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, complete cds
          Length = 1340

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 669 gctcccagctccaccagcgcctcc 646



to top

>emb|BX818913.1|CNS0A8VQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB26ZE09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1266

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 637 gctcccagctccaccagcgcctcc 614



to top

>emb|BX820133.1|CNS0A8G0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS78ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1268

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 640 gctcccagctccaccagcgcctcc 617



to top

>emb|BX819641.1|CNS0A8FA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS10ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 622 gctcccagctccaccagcgcctcc 599



to top

>gb|AF107207.2| Mycobacterium avium insertion sequence IS666 transposase gene,
           complete cds
          Length = 1472

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 291 ccgaggtcgacgcctacatcgacgccca 318
           ||||||||| ||||||||||||||||||
Sbjct: 253 ccgaggtcgccgcctacatcgacgccca 280



to top

>gb|BT002191.1| Arabidopsis thaliana Unknown protein (At2g47450) mRNA, complete cds
          Length = 1161

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           ||||||||||||||||||||||||
Sbjct: 653 gctcccagctccaccagcgcctcc 630



to top

>ref|XM_464703.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1179

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 119 agcgccagcgccagcgtcaccccgac 144
           ||||||||||||||||||||| ||||
Sbjct: 71  agcgccagcgccagcgtcaccgcgac 46



to top

>ref|XM_755763.1| Ustilago maydis 521 hypothetical protein (UM04709.1) partial mRNA
          Length = 5223

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 41   gcgctgccgccggacgcgccgctccc 66
            ||||| ||||||||||||||||||||
Sbjct: 2387 gcgcttccgccggacgcgccgctccc 2412



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 113    acggccagcgccagcgccagcg 134
              ||||||||||||||||||||||
Sbjct: 620445 acggccagcgccagcgccagcg 620424



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 119     agcgccagcgccagcgtcaccccgac 144
               ||||||||||||||||||||| ||||
Sbjct: 6797900 agcgccagcgccagcgtcaccgcgac 6797875



to top

>gb|AE004910.1| Pseudomonas aeruginosa PAO1, section 471 of 529 of the complete
            genome
          Length = 14999

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 43   gctgccgccggacgcgccgctc 64
            ||||||||||||||||||||||
Sbjct: 9866 gctgccgccggacgcgccgctc 9845



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 20   caggccatcctcccgctccgcg 41
            ||||||||||||||||||||||
Sbjct: 5563 caggccatcctcccgctccgcg 5584



to top

>dbj|AP005826.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0758B01
          Length = 159206

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 119   agcgccagcgccagcgtcaccccgac 144
             ||||||||||||||||||||| ||||
Sbjct: 15626 agcgccagcgccagcgtcaccgcgac 15601



to top

>dbj|AP005797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:B1131G07
          Length = 133992

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 119    agcgccagcgccagcgtcaccccgac 144
              ||||||||||||||||||||| ||||
Sbjct: 118953 agcgccagcgccagcgtcaccgcgac 118928



to top

>ref|XM_362723.1| Magnaporthe grisea 70-15 hypothetical protein (MG08325.4) partial
           mRNA
          Length = 825

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                        
Query: 343 ccgctcccagctccaccagcgcctcctcg 371
           |||||||| ||||||||||||||||||||
Sbjct: 750 ccgctccc-gctccaccagcgcctcctcg 723



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 116     gccagcgccagcgccagcgtc 136
               |||||||||||||||||||||
Sbjct: 2803327 gccagcgccagcgccagcgtc 2803347



to top

>gb|AY095952.1| Bordetella avium heme utilization locus, complete sequence
          Length = 8877

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 114  cggccagcgccagcgccagcg 134
            |||||||||||||||||||||
Sbjct: 7453 cggccagcgccagcgccagcg 7433



to top

>emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete genome; segment 8/16
          Length = 349008

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 113    acggccagcgccagcgccagc 133
              |||||||||||||||||||||
Sbjct: 127597 acggccagcgccagcgccagc 127617



to top

>emb|BX640417.1| Bordetella pertussis strain Tohama I, complete genome; segment 7/12
          Length = 348934

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 113    acggccagcgccagcgccagc 133
              |||||||||||||||||||||
Sbjct: 178785 acggccagcgccagcgccagc 178765



to top

>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 114    cggccagcgccagcgccagcg 134
              |||||||||||||||||||||
Sbjct: 250185 cggccagcgccagcgccagcg 250205



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 115     ggccagcgccagcgccagcgt 135
               |||||||||||||||||||||
Sbjct: 1239847 ggccagcgccagcgccagcgt 1239827



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 115     ggccagcgccagcgccagcg 134
               ||||||||||||||||||||
Sbjct: 3191002 ggccagcgccagcgccagcg 3190983



to top

>ref|XM_508630.1| PREDICTED: Pan troglodytes similar to Rho guanine nucleotide exchange
            factor (GEF) 17; Rho-specific guanine-nucleotide exchange
            factor 164 kDa (LOC451411), mRNA
          Length = 8316

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 238  cgccgcgcgcgcctggctcg 257
            ||||||||||||||||||||
Sbjct: 3417 cgccgcgcgcgcctggctcg 3436



to top

>gb|AF335591.1| Homo sapiens WNT4 (WNT4) gene, partial cds
          Length = 6876

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 114  cggccagcgccagcgccagc 133
            ||||||||||||||||||||
Sbjct: 6281 cggccagcgccagcgccagc 6262



to top

>ref|XM_592181.2| PREDICTED: Bos taurus similar to Y37D8A.2, transcript variant 1
           (LOC514347), mRNA
          Length = 3263

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 115 ggccagcgccagcgccagcgtcac 138
           |||||||||||||||| |||||||
Sbjct: 60  ggccagcgccagcgcccgcgtcac 37



to top

>ref|XM_872972.1| PREDICTED: Bos taurus similar to Y37D8A.2, transcript variant 3
           (LOC514347), mRNA
          Length = 3361

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 115 ggccagcgccagcgccagcgtcac 138
           |||||||||||||||| |||||||
Sbjct: 29  ggccagcgccagcgcccgcgtcac 6



to top

>ref|XM_872890.1| PREDICTED: Bos taurus similar to Y37D8A.2, transcript variant 2
           (LOC514347), mRNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 115 ggccagcgccagcgccagcgtcac 138
           |||||||||||||||| |||||||
Sbjct: 29  ggccagcgccagcgcccgcgtcac 6



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 32      ccgctccgcgcgctgccgccggacgcgc 59
               |||||| |||||||||||||| ||||||
Sbjct: 3438044 ccgctcggcgcgctgccgccgcacgcgc 3438071



to top

>gb|AY519504.1| Mus musculus extended extralong alpha s XXLb2 mRNA, complete cds,
            alternatively spliced
          Length = 3637

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 2406 ggccagcgccagcgccagcg 2425



to top

>gb|AY519503.1| Mus musculus extended extralong alpha s XXLb1 mRNA, complete cds,
            alternatively spliced
          Length = 2734

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 2406 ggccagcgccagcgccagcg 2425



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 117     ccagcgccagcgccagcgtc 136
               ||||||||||||||||||||
Sbjct: 3416086 ccagcgccagcgccagcgtc 3416105



to top

>emb|AJ784793.1| Agromyces luteolus partial gyrB gene for DNA gyrase subunit B
          Length = 933

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 18  cgcaggccatcctcccgctccgcg 41
           ||||||||||||||||||| ||||
Sbjct: 823 cgcaggccatcctcccgctgcgcg 846



to top

>gb|BC112461.1| Bos taurus similar to Y37D8A.2, mRNA (cDNA clone MGC:134065
           IMAGE:8047337), complete cds
          Length = 2633

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 115 ggccagcgccagcgccagcgtcac 138
           |||||||||||||||| |||||||
Sbjct: 117 ggccagcgccagcgcccgcgtcac 94



to top

>emb|AL445253.13| Human DNA sequence from clone RP4-660K3 on chromosome 1 Contains the
            5' end of the WNT4 gene for wingless-type MMTV
            integration site family (member 4) and a CpG island,
            complete sequence
          Length = 17429

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 114  cggccagcgccagcgccagc 133
            ||||||||||||||||||||
Sbjct: 2373 cggccagcgccagcgccagc 2392



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 106     agccgctacggccagcgccagcgccagc 133
               |||||| ||||||||| |||||||||||
Sbjct: 1350808 agccgccacggccagcaccagcgccagc 1350781



to top

>emb|BX072159.1|CNS09RUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 632

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 243 cagctccaccagcgcctcct 224



to top

>emb|BX066851.1|CNS09NQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 398 cagctccaccagcgcctcct 417



to top

>emb|BX066850.1|CNS09NQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 683 cagctccaccagcgcctcct 664



to top

>emb|BX065180.1|CNS09MGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 611

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 400 cagctccaccagcgcctcct 419



to top

>emb|BX065179.1|CNS09MGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 706

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 244 cagctccaccagcgcctcct 225



to top

>emb|BX058503.1|CNS09HAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 234 cagctccaccagcgcctcct 215



to top

>emb|BX053056.1|CNS09D3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 22  cagctccaccagcgcctcct 41



to top

>emb|BX052048.1|CNS09CBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 273

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 27  cagctccaccagcgcctcct 46



to top

>emb|BX052047.1|CNS09CBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 423 cagctccaccagcgcctcct 404



to top

>emb|BX044956.1|CNS096UO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 242 cagctccaccagcgcctcct 223



to top

>emb|BX040084.1|CNS0933C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 709

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 398 cagctccaccagcgcctcct 417



to top

>emb|BX040083.1|CNS0933B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 232 cagctccaccagcgcctcct 213



to top

>emb|BX038927.1|CNS09277 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 435 cagctccaccagcgcctcct 454



to top

>emb|BX038735.1|CNS0921V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 439 cagctccaccagcgcctcct 458



to top

>emb|BX038734.1|CNS0921U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 247 cagctccaccagcgcctcct 228



to top

>emb|BX038711.1|CNS09217 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 430 cagctccaccagcgcctcct 449



to top

>emb|BX037848.1|CNS091D8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 435 cagctccaccagcgcctcct 454



to top

>emb|BX037728.1|CNS0919W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 646

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 247 cagctccaccagcgcctcct 228



to top

>emb|BX037667.1|CNS09187 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 441 cagctccaccagcgcctcct 460



to top

>emb|BX037666.1|CNS09186 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 246 cagctccaccagcgcctcct 227



to top

>emb|BX037643.1|CNS0917J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 255 cagctccaccagcgcctcct 236



to top

>emb|BX037599.1|CNS0916B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 429 cagctccaccagcgcctcct 448



to top

>emb|BX037598.1|CNS0916A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 246 cagctccaccagcgcctcct 227



to top

>emb|BX037375.1|CNS09103 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 401 cagctccaccagcgcctcct 420



to top

>emb|BX037374.1|CNS09102 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 229 cagctccaccagcgcctcct 210



to top

>emb|BX036815.1|CNS090KJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 400 cagctccaccagcgcctcct 419



to top

>emb|BX036814.1|CNS090KI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 238 cagctccaccagcgcctcct 219



to top

>emb|BX036505.1|CNS090BX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 399 cagctccaccagcgcctcct 418



to top

>emb|BX036504.1|CNS090BW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 222 cagctccaccagcgcctcct 203



to top

>emb|BX036255.1|CNS0904Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 401 cagctccaccagcgcctcct 420



to top

>emb|BX036254.1|CNS0904Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 222 cagctccaccagcgcctcct 203



to top

>emb|BX031615.1|CNS08WK3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 223 cagctccaccagcgcctcct 204



to top

>emb|BX030771.1|CNS08VWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 399 cagctccaccagcgcctcct 418



to top

>emb|BX028441.1|CNS08U3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 228 cagctccaccagcgcctcct 209



to top

>emb|BX027946.1|CNS08TQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 223 cagctccaccagcgcctcct 204



to top

>emb|BX027026.1|CNS08T0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 234 cagctccaccagcgcctcct 215



to top

>emb|BX024776.1|CNS08RA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 235 cagctccaccagcgcctcct 216



to top

>emb|BX020960.1|CNS08OC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 568

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 352 cagctccaccagcgcctcct 371



to top

>emb|BX020959.1|CNS08OC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 230 cagctccaccagcgcctcct 211



to top

>emb|BX020885.1|CNS08OA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 385 cagctccaccagcgcctcct 404



to top

>emb|BX020884.1|CNS08OA0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 239 cagctccaccagcgcctcct 220



to top

>emb|BX018600.1|CNS08MIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 229 cagctccaccagcgcctcct 210



to top

>emb|BX017387.1|CNS08LKV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 198 cagctccaccagcgcctcct 179



to top

>emb|BX017224.1|CNS08LGC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 664

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 221 cagctccaccagcgcctcct 202



to top

>emb|BX017012.1|CNS08LAG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 687

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 232 cagctccaccagcgcctcct 213



to top

>emb|BX016613.1|CNS08KZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 415 cagctccaccagcgcctcct 434



to top

>emb|BX016218.1|CNS08KOE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 393 cagctccaccagcgcctcct 412



to top

>emb|BX016217.1|CNS08KOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 219 cagctccaccagcgcctcct 200



to top

>emb|BX015278.1|CNS08JYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 251

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 176 cagctccaccagcgcctcct 157



to top

>emb|BX014963.1|CNS08JPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 231 cagctccaccagcgcctcct 212



to top

>emb|BX012103.1|CNS08HI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 677

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 392 cagctccaccagcgcctcct 411



to top

>emb|BX012102.1|CNS08HI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 232 cagctccaccagcgcctcct 213



to top

>emb|BX009098.1|CNS08F6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 237 cagctccaccagcgcctcct 218



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 32      ccgctccgcgcgctgccgccggacgcgc 59
               |||||| |||||||||||||| ||||||
Sbjct: 3179141 ccgctcggcgcgctgccgccgcacgcgc 3179168



to top

>emb|AL583919.1|MLEPRTN3 Mycobacterium leprae strain TN complete genome; segment 3/10
          Length = 312050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 102    ccccagccgctacggccagcgcca 125
              |||||||||||| |||||||||||
Sbjct: 253771 ccccagccgctatggccagcgcca 253794



to top

>emb|AJ416111.1|GGA416111 Gallus gallus mRNA for cytokine receptor-beta (LIFR gene)
          Length = 4114

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 461  tggttggaaactcttgagat 480
            ||||||||||||||||||||
Sbjct: 3844 tggttggaaactcttgagat 3863



to top

>ref|NM_204575.1| Gallus gallus leukemia inhibitory factor receptor (LIFR), mRNA
          Length = 4114

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 461  tggttggaaactcttgagat 480
            ||||||||||||||||||||
Sbjct: 3844 tggttggaaactcttgagat 3863



to top

>emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chromosome 2, complete
              sequence
          Length = 206452

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 115    ggccagcgccagcgccagcg 134
              ||||||||||||||||||||
Sbjct: 156636 ggccagcgccagcgccagcg 156655



to top

>gb|AY133540.1| Arabidopsis thaliana At2g47450/T30B22.25 mRNA, complete cds
          Length = 1122

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 345 gctcccagctccaccagcgcctcc 368
           |||||||| |||||||||||||||
Sbjct: 653 gctcccagttccaccagcgcctcc 630



to top

>gb|AE011625.1| Xanthomonas axonopodis pv. citri str. 306,  section 3 of 469 of the
            complete genome
          Length = 10597

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 39   gcgcgctgccgccggacgcgccgc 62
            ||||||||||||| ||||||||||
Sbjct: 4554 gcgcgctgccgccagacgcgccgc 4531



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 114     cggccagcgccagcgccagc 133
               ||||||||||||||||||||
Sbjct: 4345730 cggccagcgccagcgccagc 4345749



to top

>gb|AC010768.10| Homo sapiens chromosome 11, clone RP11-58K22, complete sequence
          Length = 192391

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 144   cccctccgccggccacgcccccga 167
             |||||||||||||| |||||||||
Sbjct: 70369 cccctccgccggccccgcccccga 70392



to top

>ref|XM_939639.1| PREDICTED: Homo sapiens similar to Sphingomyelin phosphodiesterase
           precursor (Acid sphingomyelinase) (aSMase) (LOC654116),
           mRNA
          Length = 156

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 ggccagcgccagcgccagcg 134
           ||||||||||||||||||||
Sbjct: 132 ggccagcgccagcgccagcg 113



to top

>gb|AY033057.1|AY033055S3 Homo sapiens secreted glycoprotein Wnt4 (WNT4) gene, exon 1 and
            partial cds
          Length = 5334

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 114  cggccagcgccagcgccagc 133
            ||||||||||||||||||||
Sbjct: 3326 cggccagcgccagcgccagc 3307



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 36      tccgcgcgctgccgccggacgcgccgct 63
               ||||||||||||  ||||||||||||||
Sbjct: 3498059 tccgcgcgctgcacccggacgcgccgct 3498086



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 117     ccagcgccagcgccagcgtc 136
               ||||||||||||||||||||
Sbjct: 3568767 ccagcgccagcgccagcgtc 3568786



to top

>dbj|AK030489.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
            enriched library, clone:5330418M12 product:XLALPHAS
            PROTEIN (FRAGMENT) homolog [Mus musculus], full insert
            sequence
          Length = 2880

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 1337 ggccagcgccagcgccagcg 1356



to top

>dbj|AK047990.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130027O20 product:XLALPHAS PROTEIN
            (FRAGMENT) homolog [Mus musculus], full insert sequence
          Length = 2962

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 1557 ggccagcgccagcgccagcg 1576



to top

>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome
          Length = 335593

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 116    gccagcgccagcgccagcgtcacc 139
              ||||||||||||||||||| ||||
Sbjct: 224394 gccagcgccagcgccagcgccacc 224371



to top

>gb|AE004806.1| Pseudomonas aeruginosa PAO1, section 367 of 529 of the complete
            genome
          Length = 10506

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 36   tccgcgcgctgccgccggacgcgccgct 63
            ||||||||||| || |||||||||||||
Sbjct: 4700 tccgcgcgctggcggcggacgcgccgct 4727



to top

>gb|AE004447.1| Pseudomonas aeruginosa PAO1, section 8 of 529 of the complete
           genome
          Length = 18088

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 116 gccagcgccagcgccagcgt 135
           ||||||||||||||||||||
Sbjct: 471 gccagcgccagcgccagcgt 452



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 117     ccagcgccagcgccagcgtc 136
               ||||||||||||||||||||
Sbjct: 2487032 ccagcgccagcgccagcgtc 2487013



to top

>ref|XM_578206.1| PREDICTED: Rattus norvegicus similar to extended extralong alpha s
            XXLb1 (LOC502706), mRNA
          Length = 1425

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 1197 ggccagcgccagcgccagcg 1216



to top

>gb|AF427793.1| Nannocystis exedends retron-Ne144, complete sequence
          Length = 3243

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  caccgagcccgaggtcgacg 302
            ||||||||||||||||||||
Sbjct: 2172 caccgagcccgaggtcgacg 2191



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 183     cggccacgcacccccacccctcgtcctccacg 214
               |||||||||||||| || |||| |||||||||
Sbjct: 1088574 cggccacgcaccccaacgcctcctcctccacg 1088605



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     acggccagcgccagcgccag 132
               ||||||||||||||||||||
Sbjct: 2127581 acggccagcgccagcgccag 2127600



to top

>emb|AL929537.17| Mouse DNA sequence from clone RP23-147E9 on chromosome 2, complete
             sequence
          Length = 93822

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   ggccagcgccagcgccagcg 134
             ||||||||||||||||||||
Sbjct: 57328 ggccagcgccagcgccagcg 57309



to top

>ref|XM_321877.2| Anopheles gambiae str. PEST ENSANGP00000013957
           (ENSANGG00000011468), mRNA
          Length = 648

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cagctccaccagcgcctcct 369
           ||||||||||||||||||||
Sbjct: 242 cagctccaccagcgcctcct 223



to top

>gb|AF013115.1|AF013115 Arabidopsis thaliana CAO gene, nuclear gene encoding chloroplast
            protein, complete cds
          Length = 3683

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 345  gctcccagctccaccagcgc 364
            ||||||||||||||||||||
Sbjct: 1208 gctcccagctccaccagcgc 1189



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 113     acggccagcgccagcgccag 132
               ||||||||||||||||||||
Sbjct: 3279290 acggccagcgccagcgccag 3279271



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 309     tcgacgcccaccgccccgag 328
               ||||||||||||||||||||
Sbjct: 1364064 tcgacgcccaccgccccgag 1364083



to top

>gb|U67266.1|HSKAMS01 Human metastasis suppressor (KAI1) gene, exon 1
          Length = 1086

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 144 cccctccgccggccacgcccccga 167
           |||||||||||||| |||||||||
Sbjct: 649 cccctccgccggccccgcccccga 626



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 183    cggccacgcacccccacccctcgtcctccacg 214
              |||||||||||||| || |||| |||||||||
Sbjct: 761553 cggccacgcaccccaacgcctcctcctccacg 761584



to top

>emb|AJ251761.1|MMU251761 Mus musculus Nesp55 gene for neuroendocrine secretory protein 55 and
             partial Xlalphas gene for Xlalphas protein
          Length = 21927

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   ggccagcgccagcgccagcg 134
             ||||||||||||||||||||
Sbjct: 18153 ggccagcgccagcgccagcg 18172



to top

>emb|AJ245739.1|MMU245739 Mus musculus partial Gnasxl gene for extra large alpha stimulating
            guanine-nucleotide binding protein
          Length = 6703

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 115  ggccagcgccagcgccagcg 134
            ||||||||||||||||||||
Sbjct: 5528 ggccagcgccagcgccagcg 5547


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,422,886
Number of Sequences: 3902068
Number of extensions: 3422886
Number of successful extensions: 86654
Number of sequences better than 10.0: 129
Number of HSP's better than 10.0 without gapping: 129
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82521
Number of HSP's gapped (non-prelim): 4121
length of query: 493
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 471
effective length of database: 17,147,199,772
effective search space: 8076331092612
effective search space used: 8076331092612
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top