ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl20f05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF332093.1|AF332093 White spot syndrome virus, complete genome Length = 305107 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||||| |||||| Sbjct: 103448 gtcttcttcttcttcctccttcttcttct 103420
>gb|AF369029.2| White spot syndrome virus, complete genome Length = 292967 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||||| |||||| Sbjct: 152392 gtcttcttcttcttcctccttcttcttct 152364
>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome Length = 307287 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||||| |||||| Sbjct: 137035 gtcttcttcttcttcctccttcttcttct 137007
>emb|AL626776.15| Mouse DNA sequence from clone RP23-73N17 on chromosome 4, complete sequence Length = 144486 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 ||||||||||||||||||||| ||||||| Sbjct: 96302 tcttcttcttcttcctccttcttcttctc 96330 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||| |||||||||||| |||||||| Sbjct: 96248 tcttcttcctcttcctccttcttcttctcc 96277
>gb|AC104554.7| Mus musculus chromosome 5, clone RP24-441E22, complete sequence Length = 176408 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| ||||||||||| Sbjct: 153835 tcttcttcttcttccttcttcgtcttct 153808 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| ||||||||||| Sbjct: 153744 tcttcttcttcttccttcttcgtcttct 153717 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 154089 tcttcttcttcttcttccttcttcttct 154062 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 154086 tcttcttcttcttccttcttcttcttct 154059 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 154013 tcttcttcttcttcttccttcttcttct 153986 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 154010 tcttcttcttcttccttcttcttcttct 153983 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153937 tcttcttcttcttcttccttcttcttct 153910 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153934 tcttcttcttcttccttcttcttcttct 153907 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153667 tcttcttcttcttcttccttcttcttct 153640 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153664 tcttcttcttcttccttcttcttcttct 153637 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153591 tcttcttcttcttcttccttcttcttct 153564 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153588 tcttcttcttcttccttcttcttcttct 153561 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153554 tcttcttcttcttcttccttcttcttct 153527 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153551 tcttcttcttcttccttcttcttcttct 153524 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153481 tcttcttcttcttcttccttcttcttct 153454 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153478 tcttcttcttcttccttcttcttcttct 153451 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153462 tcttcttcttcttccttcttcttcttct 153435 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 153404 tcttcttcttcttcttccttcttcttct 153377 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153401 tcttcttcttcttccttcttcttcttct 153374 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 153385 tcttcttcttcttccttcttcttcttct 153358
>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete sequence Length = 166185 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 83031 tcttcttcttcttcctccttcttcttct 83004
>gb|AC109294.8| Mus musculus chromosome 1, clone RP24-236C22, complete sequence Length = 151772 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 8103 tcttcttcttcttcctccttcttcttct 8130
>gb|AC109271.10| Mus musculus chromosome 1, clone RP23-353I19, complete sequence Length = 221001 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 5017 tcttcttcttcttcctccttcttcttct 4990
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence Length = 243671 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 80719 tcttcttcttcttcctccttcttcttct 80746
>gb|AC124467.3| Mus musculus BAC clone RP24-163L18 from chromosome 15, complete sequence Length = 169366 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 19747 tcttcttcttcttcctccttcttcttct 19720
>emb|CT025602.8| Mouse DNA sequence from clone RP23-458L4 on chromosome 14, complete sequence Length = 207863 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 96704 tcttcttcttcttcctccttcttcttct 96677
>gb|AC146225.2| Pan troglodytes BAC clone RP43-32E8 from 7, complete sequence Length = 171272 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 58133 tcttcttcttcttcctccttcttcttct 58106
>gb|AC132282.3| Mus musculus BAC clone RP24-348O21 from chromosome 14, complete sequence Length = 166747 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 14065 tcttcttcttcttcctccttcttcttct 14038
>gb|AC117253.3| Mus musculus BAC clone RP24-405A12 from chromosome 19, complete sequence Length = 142903 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 89441 tcttcttcttcttcctccttcttcttct 89468 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 89293 tcttcttcttcttccttcttcttcttct 89320 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 89290 tcttcttcttcttcttccttcttcttct 89317
>gb|AC164313.3| Mus musculus BAC clone RP23-24F12 from chromosome 3, complete sequence Length = 196368 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| ||||||||||||| Sbjct: 182435 tcttcttcttcttcttccttcgtcttct 182408 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 182255 tcttcttcttcttcttccttcttcttct 182228 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 182252 tcttcttcttcttccttcttcttcttct 182225 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||| ||||||| |||||| Sbjct: 182024 tcttcttcttctttctccttcttcttct 181997
>emb|Z84476.7|HS25J6 Human DNA sequence from clone RP1-25J6 on chromosome 6p21.3 Contains the 5' end of the RFP gene for ret finger protein, a putative novel gene, a KRT18 (keratin 18) pseudogene, a novel zinc finger protein gene, olfactory receptor 2AD1 pseudogene OR2AD1P, ESTs, STSs and 3 CpG islands, complete sequence Length = 112659 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 11135 tcttcttcttcttcctccttcttcttct 11108
>emb|BX005144.14| Human DNA sequence from clone DASS-125F11 on chromosome 6, complete sequence Length = 19086 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 8753 tcttcttcttcttcctccttcttcttct 8726
>emb|AL662871.9| Human DNA sequence from clone XXbac-322C17 on chromosome 6 contains the RFP gene for ret finger protein gene, a zinc finger protein pseudogene, a novel protein and three CpG islands, complete sequence Length = 103158 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 66023 tcttcttcttcttcctccttcttcttct 65996
>emb|AL662859.5| Human DNA sequence from clone XXbac-196D17 on chromosome 6 contains a zinc finger protein pseudogene, the RFP gene for ret finger protein and three CpG islands, complete sequence Length = 61233 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 59922 tcttcttcttcttcctccttcttcttct 59895
>emb|AL662865.4| Human DNA sequence from clone XXbac-216M5 on chromosome 6 contains a keratin 18 (KRT18) pseudogene (KRT18P1), a novel zinc finger protein, two putative novel transcripts, the OR2AD1P gene for aolfactory receptor, family 2, subfamily AD, member 1 (pseudogene), the OR2W1 gene for olfactory receptor, family 2, subfamily W, member 1 and two CpG islands, complete sequence Length = 133757 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 689 tcttcttcttcttcctccttcttcttct 662
>emb|AL021407.1|HS13D10 Human DNA sequence from clone RP1-13D10 on chromosome 6p22.3-23 Contains the MIR gene for myosin regulatory light chain interacting protein, a mitochondrial 28S ribosomal protein S32 (MRP-S32) pseudogene, a pseudogene similar to part of eukaryotic translation initiation factor 2 subunit 2 (EIF2S2), a P53-induced protein PIGPC1 pseudogene, a malate dehydrogenase pseudogene and a CpG island, complete sequence Length = 153147 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 110841 tcttcttcttcttcctccttcttcttct 110868 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 |||||||||||||| |||||| ||||||| Sbjct: 110877 tcttcttcttcttcttccttcttcttctc 110905 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 110958 tcttcttcttcttccttcttcttcttct 110985 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 110955 tcttcttcttcttcttccttcttcttct 110982
>emb|CR936965.7| Human DNA sequence from clone DAMA-219M18 on chromosome 6, complete sequence Length = 26598 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 17069 tcttcttcttcttcctccttcttcttct 17042
>emb|CR759942.12| Human DNA sequence from clone DAAP-182E11 on chromosome 6, complete sequence Length = 69422 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 62927 tcttcttcttcttcctccttcttcttct 62900
>gb|AC163901.2| Mus musculus BAC clone RP23-269N21 from chromosome 17, complete sequence Length = 202092 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 182583 tcttcttcttcttcctccttcttcttct 182610
>gb|AC141561.5| Mus musculus BAC clone RP23-457C15 from chromosome 3, complete sequence Length = 169547 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| ||||||||||||| Sbjct: 138041 tcttcttcttcttcttccttcgtcttct 138014 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 137861 tcttcttcttcttcttccttcttcttct 137834 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 137858 tcttcttcttcttccttcttcttcttct 137831 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||| ||||||| |||||| Sbjct: 137630 tcttcttcttctttctccttcttcttct 137603
>gb|AC040927.18| Mus musculus chromosome 5, clone RP23-186A21, complete sequence Length = 206156 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| ||||||||||| Sbjct: 114628 tcttcttcttcttccttcttcgtcttct 114601 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| ||||||||||| Sbjct: 114537 tcttcttcttcttccttcttcgtcttct 114510 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114917 tcttcttcttcttcttccttcttcttct 114890 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114914 tcttcttcttcttccttcttcttcttct 114887 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114880 tcttcttcttcttcttccttcttcttct 114853 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114877 tcttcttcttcttccttcttcttcttct 114850 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114807 tcttcttcttcttcttccttcttcttct 114780 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114804 tcttcttcttcttccttcttcttcttct 114777 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114788 tcttcttcttcttccttcttcttcttct 114761 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114730 tcttcttcttcttcttccttcttcttct 114703 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114727 tcttcttcttcttccttcttcttcttct 114700 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114460 tcttcttcttcttcttccttcttcttct 114433 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114457 tcttcttcttcttccttcttcttcttct 114430 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114384 tcttcttcttcttcttccttcttcttct 114357 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114381 tcttcttcttcttccttcttcttcttct 114354 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114347 tcttcttcttcttcttccttcttcttct 114320 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114344 tcttcttcttcttccttcttcttcttct 114317 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114274 tcttcttcttcttcttccttcttcttct 114247 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114271 tcttcttcttcttccttcttcttcttct 114244 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114255 tcttcttcttcttccttcttcttcttct 114228 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114197 tcttcttcttcttcttccttcttcttct 114170 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114194 tcttcttcttcttccttcttcttcttct 114167 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114178 tcttcttcttcttccttcttcttcttct 114151
>gb|AC020599.4|AC020599 Homo sapiens BAC clone RP11-440L13 from 4, complete sequence Length = 173821 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttctc 152 ||||||||||||||||||| |||||||| Sbjct: 79973 cttcttcttcttcctcctttgtcttctc 80000
>gb|AC095380.1| Homo sapiens PCR product GAP1622 from Y, complete sequence Length = 45429 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 19237 tcttcttcttcttcctccttcttcttct 19264
>gb|AC154337.2| Mus musculus BAC clone RP23-254P20 from chromosome 17, complete sequence Length = 182101 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 155612 tcttcttcttcttcctccttcttcttct 155639
>gb|AC154296.2| Mus musculus BAC clone RP23-424C4 from chromosome 9, complete sequence Length = 194303 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 137292 tcttcttcttcttcctccttcttcttct 137265
>gb|AC009976.4|AC009976 Homo sapiens BAC clone RP11-509B6 from Y, complete sequence Length = 179060 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 1827 tcttcttcttcttcctccttcttcttct 1800
>dbj|AP001306.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MKA23 Length = 70100 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 115 cgcgtgctgtcttcttcttcttcctcct 142 |||||| ||||||||||||||||||||| Sbjct: 34443 cgcgtgttgtcttcttcttcttcctcct 34416
>ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5 (P4-P5@) on chromosome Y Length = 1351786 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 535141 tcttcttcttcttcctccttcttcttct 535168 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 338677 tcttcttcttcttcctccttcttcttct 338650
>emb|AL954865.13| Human DNA sequence from clone DAQB-314F7 on chromosome 6 Contains the C6orf100 gene for chromosome 6 open reading frame 100 and 0 CpG islands, complete sequence Length = 41127 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 6180 tcttcttcttcttcctccttcttcttct 6153
>gb|AC102211.23| Mus musculus chromosome 3, clone RP24-369F14, complete sequence Length = 142790 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| ||||||||||||| Sbjct: 114786 tcttcttcttcttcttccttcgtcttct 114813 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 114969 tcttcttcttcttccttcttcttcttct 114996 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 114966 tcttcttcttcttcttccttcttcttct 114993
>gb|AC166165.3| Mus musculus BAC clone RP23-381I17 from chromosome 10, complete sequence Length = 217425 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 163888 tcttcttcttcttcctccttcttcttct 163915
>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence Length = 211064 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 169384 tcttcttcttcttcctccttcttcttct 169411
>emb|CR936883.15| Human DNA sequence from clone DAMC-4K22 on chromosome 6, complete sequence Length = 42376 Score = 48.1 bits (24), Expect = 0.011 Identities = 27/28 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||||| |||||| Sbjct: 14715 tcttcttcttcttcctccttcttcttct 14688
>ref|NM_123944.2| Arabidopsis thaliana protein binding AT5G45770 mRNA, complete cds Length = 1354 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttc 150 |||||||||||||| |||||||||||| Sbjct: 1169 tcttcttcttcttcttccttcgtcttc 1143
>gb|AC125027.12| Mus musculus chromosome 8, clone RP24-68F20, complete sequence Length = 194850 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 13996 cttcttcttcttcctccttcttcttct 14022 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 14014 tcttcttcttcttcctccttctccttctcc 14043
>gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, complete sequence Length = 190200 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||||| ||||| Sbjct: 175682 tcttcttcttcttcctccttcctcttc 175656
>gb|AC120364.7| Mus musculus chromosome 8, clone RP24-291F20, complete sequence Length = 193257 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 17691 cttcttcttcttcctccttcttcttct 17665 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 17673 tcttcttcttcttcctccttctccttctcc 17644
>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence Length = 245390 Score = 46.1 bits (23), Expect = 0.043 Identities = 29/31 (93%) Strand = Plus / Plus Query: 121 ctgtcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||| |||||| |||||| Sbjct: 95779 ctgtcttcttcttcttcttccttcttcttct 95809 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 95785 tcttcttcttcttccttcttcttcttct 95812 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 32753 tcttcttcttcttcttccttcttcttct 32726 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 32750 tcttcttcttcttccttcttcttcttct 32723
>gb|AC112701.6| Mus musculus BAC clone RP23-171A11 from 13, complete sequence Length = 184506 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 46134 cttcttcttcttcctccttcttcttct 46108 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 cttcttcttcctccttcgtcttct 151 ||||||||||||||||| |||||| Sbjct: 46262 cttcttcttcctccttcctcttct 46239
>emb|AL691457.14| Mouse DNA sequence from clone RP23-17M4 on chromosome 11 Contains the 3' end of a novel gene, complete sequence Length = 162777 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||||| ||||| Sbjct: 46647 tcttcttcttcttcctccttcttcttc 46621
>emb|AL731792.12| Mouse DNA sequence from clone RP23-189P1 on chromosome 11 Contains the 5' end of a novel gene, the 3' end of the Spnb2 gene for spectrin beta 2 and a CpG island, complete sequence Length = 143722 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 81950 cttcttcttcttcctccttcttcttct 81976
>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 Length = 1282697 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||||| ||||| Sbjct: 156038 tcttcttcttcttcctccttcctcttc 156012
>gb|AC104462.1| Homo sapiens chromosome 1 clone RP11-522M21, complete sequence Length = 183271 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 12057 cttcttcttcttcctccttcttcttct 12083 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 11923 tcttcttcttcttcctccttc 11943 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttc 144 |||||||||||||||||||| Sbjct: 12008 cttcttcttcttcctccttc 12027
>gb|AC093153.2| Homo sapiens chromosome 1 clone RP11-477C23, complete sequence Length = 194427 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttct 151 |||||||||||||||||||| |||||| Sbjct: 182924 cttcttcttcttcctccttcttcttct 182950 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 182773 tcttcttcttcttcctccttc 182793 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttc 144 |||||||||||||||||||| Sbjct: 182858 cttcttcttcttcctccttc 182877
>dbj|AB012245.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19 Length = 86722 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttc 150 |||||||||||||| |||||||||||| Sbjct: 68782 tcttcttcttcttcttccttcgtcttc 68756
>dbj|AP006403.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT16P18, TM0289, complete sequence Length = 94172 Score = 46.1 bits (23), Expect = 0.043 Identities = 23/23 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgt 146 ||||||||||||||||||||||| Sbjct: 35767 tcttcttcttcttcctccttcgt 35789
>gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosome 1, complete sequence Length = 210757 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttct 151 ||||||||||||||| ||||||||||| Sbjct: 90747 cttcttcttcttccttcttcgtcttct 90773 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 91038 tcttcttcttcttccttcttcttcttct 91065 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 91035 tcttcttcttcttcttccttcttcttct 91062 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 91007 tcttcttcttcttccttcttcttcttct 91034 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 90486 tcttcttcttcttcttccttcttcttct 90513
>emb|AL390798.3|CNS06C7P Human chromosome 14 DNA sequence BAC R-21O19 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 154140 Score = 46.1 bits (23), Expect = 0.043 Identities = 26/27 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||||| ||||| Sbjct: 42982 tcttcttcttcttcctccttcatcttc 43008
>gb|AC102398.12| Mus musculus chromosome 8, clone RP24-213P1, complete sequence Length = 172457 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 119374 tcttcttcttcttcctccttctccttctcc 119403
>ref|NM_113114.3| Arabidopsis thaliana FHY3 AT3G22170 (FHY3) mRNA, complete cds Length = 2973 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 117 cgtgctgtcttcttcttcttcctcct 142 |||| ||||||||||||||||||||| Sbjct: 1 cgtgttgtcttcttcttcttcctcct 26
>gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, complete sequence Length = 211052 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 146358 tcttcttcttcttccttcttcttcttctcc 146329 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 146361 tcttcttcttcttcttccttcttcttct 146334 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 146273 tcttcttcttcttcttccttcttcttct 146246 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 146270 tcttcttcttcttccttcttcttcttct 146243 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 146239 tcttcttcttcttcttccttcttcttct 146212 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 146236 tcttcttcttcttccttcttcttcttct 146209
>gb|AC122774.11| Mus musculus chromosome 15, clone RP24-189C9, complete sequence Length = 154384 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||| |||||||| ||||||| Sbjct: 2613 tcttcttcttctttctccttcgccttctcc 2642
>gb|AC122469.4| Mus musculus chromosome 6 clone RP24-318I5, complete sequence Length = 181769 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 181695 tcttcttcttcttcctccttctccttctcc 181666
>gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, complete sequence Length = 192019 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Minus Query: 130 tcttcttcctccttcgtcttctccag 155 |||||||||||| ||||||||||||| Sbjct: 168845 tcttcttcctccctcgtcttctccag 168820
>gb|AC132483.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0014C03, complete sequence Length = 143739 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 42 gtggagtggagtggagggagga 63 |||||||||||||||||||||| Sbjct: 26153 gtggagtggagtggagggagga 26174
>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome 19 Length = 413528 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 336383 tcttcttcttcttcttccttcttcttctcc 336354
>gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, complete sequence Length = 280763 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 233818 tcttcttcttcttcttccttcttcttctcc 233847
>gb|DQ483603.1| Gymnogyps californianus clone 26F microsatellite sequence Length = 571 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Minus Query: 128 cttcttcttcctccttcgtcttctcc 153 |||||||||||||||||| ||||||| Sbjct: 118 cttcttcttcctccttcgacttctcc 93
>gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, complete sequence Length = 200663 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttcgtcttc 150 |||||||||||||||||||| ||||| Sbjct: 171147 cttcttcttcttcctccttcttcttc 171172 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 171130 tcttcttcttcttcttccttcttcttct 171157 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 171069 tcttcttcttcttccttcttcttcttct 171096 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 171066 tcttcttcttcttcttccttcttcttct 171093
>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete sequence Length = 233365 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||| ||| |||||||| Sbjct: 78091 tcttcttcttcttcctctttcttcttctcc 78120
>gb|AC129014.4| Mus musculus BAC clone RP24-317F20 from chromosome 19, complete sequence Length = 175855 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtctt 149 ||||||||||||||||||||| |||| Sbjct: 104712 tcttcttcttcttcctccttcttctt 104737 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttc 144 |||||||||||||||||||| Sbjct: 104748 cttcttcttcttcctccttc 104767
>gb|AC127574.3| Mus musculus BAC clone RP24-240K8 from chromosome 7, complete sequence Length = 176711 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 4851 tcttcttcttcttcttccttcttcttctcc 4880
>gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome 12, complete sequence Length = 196285 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 85184 tcttcttcttcttcctccttctccttctcc 85213
>emb|AL590136.7| Human DNA sequence from clone RP11-640K13 on chromosome 10, complete sequence Length = 60869 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 17653 tcttcttcttcttcttccttcttcttctcc 17682
>emb|AL157834.12| Human DNA sequence from clone RP11-310E22 on chromosome 10 Contains two novel genes, a pseudogene similar to part of PRKC apoptosis WT1 regulator (PAWR), the gene for a novel AMP-binding enzyme, the 3' end of the PDLIM1 gene for PDZ and LIM domain 1 (elfin) and a CpG island, complete sequence Length = 190394 Score = 44.1 bits (22), Expect = 0.17 Identities = 31/34 (91%) Strand = Plus / Minus Query: 125 cttcttcttcttcctccttcgtcttctccagccc 158 |||||| ||||||||||| | ||||||||||||| Sbjct: 98774 cttctttttcttcctcctccttcttctccagccc 98741
>emb|AL662909.9| Mouse DNA sequence from clone RP23-189I13 on chromosome 11 Contains the 5' end of the Odz2 gene for odd Oz/ten-m homolog 2 (Drosophila) and a CpG island, complete sequence Length = 201564 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 23318 tcttcttcttcttcttccttcttcttctcc 23289
>emb|AL663060.6| Mouse DNA sequence from clone RP23-239H6 on chromosome 11, complete sequence Length = 218635 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 64234 tcttcttcttcttccttcttcttcttctcc 64205 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 64237 tcttcttcttcttcttccttcttcttct 64210
>gb|AC009771.22| Homo sapiens 12 BAC RP11-321E21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 64545 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 26803 tcttcttcttcttcctccttctccttctcc 26774
>gb|AC027319.5| Homo sapiens chromosome 19 clone CTC-518P12, complete sequence Length = 152033 Score = 44.1 bits (22), Expect = 0.17 Identities = 31/34 (91%) Strand = Plus / Plus Query: 120 gctgtcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||||| | |||| |||||||| Sbjct: 59079 gctgtcttcttcttcttctttcttcttcttctcc 59112
>gb|AC182040.3| Mus musculus BAC clone RP24-26M10 from chromosome y, complete sequence Length = 242066 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 80451 tcttcttcttcttcctccttctccttctcc 80480
>gb|AC023772.22| Homo sapiens chromosome 4, clone RP11-634F16, complete sequence Length = 191312 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 94368 tcttcttcttcttccttcttcttcttctcc 94339
>gb|AC114981.2| Homo sapiens chromosome 5 clone RP11-81B23, complete sequence Length = 125914 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||| ||| |||||||| Sbjct: 109359 tcttcttcttcttcctctttcttcttctcc 109330
>dbj|AK132313.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:4022406G08 product:mannose-6-phosphate receptor binding protein 1, full insert sequence Length = 3647 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1181 ggctgcgggcctgctgtgcctg 1160
>gb|AC099642.4| Mus musculus chromosome 15, clone RP24-346F18, complete sequence Length = 138009 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 116912 tcttcttcttcttccttcttcttcttctcc 116883 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 116915 tcttcttcttcttcttccttcttcttct 116888
>dbj|AK167214.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0041C19 product:mannose-6-phosphate receptor binding protein 1, full insert sequence Length = 2159 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1179 ggctgcgggcctgctgtgcctg 1158
>dbj|AK009148.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310004K22 product:similar to CARGO SELECTION PROTEIN TIP47 (47 KDA MANNOSE 6-PHOSPHATE RECEPTOR- BINDING PROTEIN) (47 KDA MPR-BINDING PROTEIN) (PLACENTAL PROTEIN 17) [Homo sapiens], full insert sequence Length = 1136 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 726 ggctgcgggcctgctgtgcctg 705
>gb|AC008962.9| Homo sapiens chromosome 19 clone CTD-2356P16, complete sequence Length = 154169 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 112639 tcttcttcttcttcttccttcttcttctcc 112610
>dbj|AK049537.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430020K03 product:similar to CARGO SELECTION PROTEIN TIP47 (47 KDA MANNOSE 6-PHOSPHATE RECEPTOR-BINDING PROTEIN) (47 KDA MPR-BINDING PROTEIN) (PLACENTAL PROTEIN 17) [Homo sapiens], full insert sequence Length = 1593 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1181 ggctgcgggcctgctgtgcctg 1160
>gb|AC026385.19|AC026385 Mus musculus 17 BAC RP23-413K14 complete sequence Length = 222610 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 159176 ggctgcgggcctgctgtgcctg 159197
>dbj|AK050140.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length enriched library, clone:C730019N09 product:similar to CARGO SELECTION PROTEIN TIP47 (47 KDA MANNOSE 6-PHOSPHATE RECEPTOR-BINDING PROTEIN) (47 KDA MPR-BINDING PROTEIN) (PLACENTAL PROTEIN 17) [Homo sapiens], full insert sequence Length = 1593 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1182 ggctgcgggcctgctgtgcctg 1161
>dbj|AK012517.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700073F06 product:similar to CARGO SELECTION PROTEIN TIP47 (47 KDA MANNOSE 6-PHOSPHATE RECEPTOR-BINDING PROTEIN) (47 KDA MPR-BINDING PROTEIN) (PLACENTAL PROTEIN 17) [Homo sapiens], full insert sequence Length = 2152 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1181 ggctgcgggcctgctgtgcctg 1160
>dbj|AK004970.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched library, clone:1300012C15 product:similar to CARGO SELECTION PROTEIN TIP47 (47 KDA MANNOSE 6-PHOSPHATE RECEPTOR- BINDING PROTEIN) (47 KDA MPR-BINDING PROTEIN) (PLACENTAL PROTEIN 17) [Homo sapiens], full insert sequence Length = 2162 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1181 ggctgcgggcctgctgtgcctg 1160
>dbj|AK044144.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830094P10 product:unclassifiable, full insert sequence Length = 1350 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 563 tcttcttcttcttcctccttctccttctcc 592
>dbj|AK003971.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110030D14 product:mannose-6-phosphate receptor binding protein 1, full insert sequence Length = 1006 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 33 ggctgcgggcctgctgtgcctg 12
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 42 gtggagtggagtggagggagga 63 |||||||||||||||||||||| Sbjct: 19013510 gtggagtggagtggagggagga 19013531 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 tggcgcggcggtgggcggctg 187 ||||||||||||||||||||| Sbjct: 25448583 tggcgcggcggtgggcggctg 25448563 Score = 42.1 bits (21), Expect = 0.67 Identities = 24/25 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtct 148 ||||||||||||||||| ||||||| Sbjct: 17489086 tcttcttcttcttcctctttcgtct 17489062
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcg 145 |||||||||||||||||||||| Sbjct: 34702459 tcttcttcttcttcctccttcg 34702480
>gb|AC112227.4| Homo sapiens BAC clone RP13-552G12 from 4, complete sequence Length = 151609 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 91813 tcttcttcttcttccttcttcttcttctcc 91842
>gb|AC151730.5| Mus musculus BAC clone RP24-84E18 from chromosome 19, complete sequence Length = 222459 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtctt 149 ||||||||||||||||||||| |||| Sbjct: 48741 tcttcttcttcttcctccttcttctt 48766 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 cttcttcttcttcctccttc 144 |||||||||||||||||||| Sbjct: 48777 cttcttcttcttcctccttc 48796
>ref|NM_025836.1| Mus musculus mannose-6-phosphate receptor binding protein 1 (M6prbp1), mRNA Length = 2162 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1181 ggctgcgggcctgctgtgcctg 1160
>gb|AC079607.5| Homo sapiens BAC clone CTD-2262F3 from 2, complete sequence Length = 50833 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 32842 tcttcttcttcttcctccttctccttctcc 32871
>dbj|AP005303.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0016F11 Length = 134907 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcg 145 |||||||||||||||||||||| Sbjct: 20307 tcttcttcttcttcctccttcg 20328
>dbj|AP004081.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_E04 Length = 94096 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcg 145 |||||||||||||||||||||| Sbjct: 59410 tcttcttcttcttcctccttcg 59431
>gb|BC011116.1| Mus musculus mannose-6-phosphate receptor binding protein 1, mRNA (cDNA clone MGC:19018 IMAGE:4023354), complete cds Length = 1612 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 1176 ggctgcgggcctgctgtgcctg 1155
>gb|AC006101.3|AC006101 citb_338_f_24, complete sequence Length = 148278 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 130778 tcttcttcttcttcttccttcttcttctcc 130807
>gb|AC151533.3| Mus musculus BAC clone RP24-92D11 from 14, complete sequence Length = 230285 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| ||||||| ||||||| Sbjct: 201753 tcttcttcttcttcttccttcgccttctcc 201782
>gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, complete sequence Length = 168604 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtctt 149 ||||||||||||||||||||| |||| Sbjct: 90916 tcttcttcttcttcctccttcttctt 90941 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtctt 149 ||||||||||||||||||||| |||| Sbjct: 90627 tcttcttcttcttcctccttcttctt 90652
>gb|AC137976.13| Mus musculus chromosome 8, clone RP23-262K12, complete sequence Length = 238720 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 221993 tcttcttcttcttcctccttctccttctcc 222022 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 221668 tcttcttcttcttcctccttctccttctcc 221697
>gb|AC101931.8| Mus musculus chromosome 1, clone RP24-63O23, complete sequence Length = 209705 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||| | |||||||| Sbjct: 94307 tcttcttcttcttcctcctccttcttctcc 94336
>gb|AC108782.9| Mus musculus chromosome 8, clone RP23-350C11, complete sequence Length = 221428 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 100257 tcttcttcttcttcctccttctccttctcc 100286 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 99932 tcttcttcttcttcctccttctccttctcc 99961
>gb|AC118731.11| Mus musculus chromosome 1, clone RP24-169M20, complete sequence Length = 160688 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 79938 tcttcttcttcttcttccttcttcttctcc 79909
>emb|CT025760.12| Mouse DNA sequence from clone RP23-351E9 on chromosome 17, complete sequence Length = 128479 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 ggctgcgggcctgctgtgcctg 204 |||||||||||||||||||||| Sbjct: 120760 ggctgcgggcctgctgtgcctg 120781
>gb|AC137126.13| Mus musculus chromosome 15, clone RP24-250I9, complete sequence Length = 193459 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||| |||||||| ||||||| Sbjct: 192338 tcttcttcttctttctccttcgccttctcc 192367
>gb|AC127244.3| Mus musculus BAC clone RP24-416M6 from 6, complete sequence Length = 165720 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| |||||| |||||||| Sbjct: 75748 tcttcttcttcttcttccttcttcttctcc 75719
>emb|CT010489.8| Mouse DNA sequence from clone RP23-189F18 on chromosome 12, complete sequence Length = 112028 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 13772 tcttcttcttcttcctccttctccttctcc 13743
>gb|AC122240.4| Mus musculus BAC clone RP23-145L9 from 6, complete sequence Length = 211740 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 ||||||||||||||||||||| ||||||| Sbjct: 52380 tcttcttcttcttcctccttctccttctcc 52351
>gb|AC148978.3| Mus musculus BAC clone RP23-359K8 from 14, complete sequence Length = 241799 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||| ||||||| ||||||| Sbjct: 50903 tcttcttcttcttcttccttcgccttctcc 50932
>dbj|AP004930.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13G01, TM0093a, complete sequence Length = 42990 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 125 cttcttcttcttcctccttcgt 146 |||||||||||||||||||||| Sbjct: 26785 cttcttcttcttcctccttcgt 26764
>emb|AL353998.5|HS35M08 Homo sapiens chromosome 19 from PAC RPCI-1 35M08, complete sequence Length = 99187 Score = 44.1 bits (22), Expect = 0.17 Identities = 31/34 (91%) Strand = Plus / Plus Query: 120 gctgtcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||||| | |||| |||||||| Sbjct: 46272 gctgtcttcttcttcttctttcttcttcttctcc 46305
>emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-138H18 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 150572 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttc 144 |||||||||||||||||||||| Sbjct: 127967 gtcttcttcttcttcctccttc 127946
>gb|AC104620.5| Homo sapiens BAC clone RP11-294O2 from 4, complete sequence Length = 155643 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctcc 153 |||||||||||||||| |||| |||||||| Sbjct: 128236 tcttcttcttcttccttcttcttcttctcc 128207
>dbj|AB057357.2| Mus musculus gene for Ankyrin 3, partial cds Length = 24885 Score = 44.1 bits (22), Expect = 0.17 Identities = 28/30 (93%) Strand = Plus / Minus Query: 122 tgtcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||||| |||||| Sbjct: 14248 tgtcttcttcttcttcttccttcttcttct 14219 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 14243 tcttcttcttcttccttcttcttcttct 14216
>ref|NM_113581.3| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT3G26700 mRNA, complete cds Length = 2006 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcctt 143 ||||||||||||||||||||| Sbjct: 1810 gtcttcttcttcttcctcctt 1790
>ref|NM_127445.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G18890 transcript variant AT2G18890.1 mRNA, complete cds Length = 1382 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 7 tcttcttcttcttcctccttc 27
>ref|NM_001036296.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G18890 transcript variant AT2G18890.2 mRNA, complete cds Length = 1363 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 32 tcttcttcttcttcctccttc 52
>ref|NM_101583.2| Arabidopsis thaliana GTP binding / translation initiation factor AT1G17220 mRNA, complete cds Length = 3633 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 53 tcttcttcttcttcctccttc 73
>ref|NM_124330.3| Arabidopsis thaliana DNA-directed RNA polymerase AT5G49530 mRNA, complete cds Length = 2429 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 495 tcttcttcttcttcctccttc 475
>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence Length = 200560 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 150317 tcttcttcttcttcctccttc 150337
>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence Length = 202649 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 62051 tcttcttcttcttcctccttc 62031 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 61967 tcttcttcttcttcctccttc 61947
>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete sequence Length = 162597 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 7964 tcttcttcttcttcctccttc 7984
>ref|NG_002760.2| Mus musculus baculoviral IAP repeat-containing 1c, pseudogene 1 (Birc1c-ps1) on chromosome 13 Length = 18692 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 15943 tcttcttcttcttcctccttc 15963
>gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, complete sequence Length = 166975 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 57865 tcttcttcttcttcctccttc 57885
>gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, complete sequence Length = 159578 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 7205 tcttcttcttcttcctccttc 7185
>gb|AC137618.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0090H02, complete sequence Length = 135231 Score = 42.1 bits (21), Expect = 0.67 Identities = 24/25 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtct 148 ||||||||||||||||| ||||||| Sbjct: 116436 tcttcttcttcttcctctttcgtct 116412
>gb|AF259072.1| Mus musculus T-cell receptor alpha locus BAC clone MBAC1058 from 14D1-D2, complete sequence Length = 170356 Score = 42.1 bits (21), Expect = 0.67 Identities = 24/25 (96%) Strand = Plus / Plus Query: 126 ttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||| ||||| Sbjct: 70451 ttcttcttcttcctccttcttcttc 70475 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 49548 tcttcttcttcttcttccttcttcttct 49575
>gb|AC165225.5| Mus musculus chromosome 3, clone RP24-70J13, complete sequence Length = 205069 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 125334 tcttcttcttcttcctccttc 125314
>gb|AC165090.3| Mus musculus BAC clone RP23-95H4 from chromosome 8, complete sequence Length = 252334 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 212444 tcttcttcttcttcctccttc 212464
>gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosome 8, complete sequence Length = 196497 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 16819 tcttcttcttcttcctccttc 16839 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Plus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 ||||||||||||||| |||||| |||||| Sbjct: 16747 gtcttcttcttcttcttccttcttcttct 16775 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 16751 tcttcttcttcttccttcttcttcttct 16778
>gb|AC144519.4| Mus musculus BAC clone RP24-325A1 from chromosome 6, complete sequence Length = 195499 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 64314 tcttcttcttcttcctccttc 64294 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 64263 tcttcttcttcttcctccttc 64243
>gb|AC114984.18| Mus musculus chromosome 18, clone RP23-248F9, complete sequence Length = 185563 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 32322 tcttcttcttcttcctccttc 32342
>ref|XM_586057.2| PREDICTED: Bos taurus similar to olfactory receptor Olr1684 (LOC509155), partial mRNA Length = 1773 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 1102 tcttcttcttcttcctccttc 1082
>gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, complete sequence Length = 193624 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 176890 tcttcttcttcttcctccttc 176910
>gb|AC110499.19| Mus musculus chromosome 1, clone RP23-202J6, complete sequence Length = 212282 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 205433 tcttcttcttcttcctccttc 205453
>gb|AC101983.16| Mus musculus chromosome 6, clone RP24-352A8, complete sequence Length = 153860 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 |||||||||||||| |||||| ||||||| Sbjct: 38025 tcttcttcttcttcttccttcttcttctc 37997
>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence, complete sequence Length = 130272 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 107040 tcttcttcttcttcctccttc 107060
>gb|AC131190.3| Mus musculus BAC clone RP24-332E15 from chromosome 5, complete sequence Length = 176925 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 23412 tcttcttcttcttcctccttc 23432
>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence Length = 199604 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 6361 tcttcttcttcttcctccttc 6341
>gb|AC079277.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-65N7, complete sequence Length = 190328 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 aaacacggggaaggagaagga 29 ||||||||||||||||||||| Sbjct: 15009 aaacacggggaaggagaagga 15029
>gb|AC149545.1| Populus trichocarpa clone Pop1-71J23, complete sequence Length = 103543 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcctt 143 ||||||||||||||||||||| Sbjct: 79683 gtcttcttcttcttcctcctt 79663
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 42.1 bits (21), Expect = 0.67 Identities = 24/25 (96%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtct 148 ||||||||||||||||| ||||||| Sbjct: 18891 tcttcttcttcttcctctttcgtct 18867
>gb|AC104881.9| Mus musculus chromosome 18, clone RP23-244A24, complete sequence Length = 184796 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 63197 tcttcttcttcttcctccttc 63217
>gb|AC125105.3| Mus musculus BAC clone RP24-220B7 from chromosome 16, complete sequence Length = 153616 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 150152 tcttcttcttcttcctccttc 150132
>ref|XM_658572.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6060.2), mRNA Length = 4344 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 1703 tcttcttcttcttcctccttc 1683
>gb|AC142405.4| Mus musculus BAC clone RP24-559P3 from chromosome 5, complete sequence Length = 144109 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 97378 tcttcttcttcttcctccttc 97398
>gb|AC158964.4| Mus musculus chromosome 1, clone RP23-376B19, complete sequence Length = 205656 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 176568 tcttcttcttcttcctccttc 176548
>ref|NM_173607.2| Homo sapiens chromosome 14 open reading frame 24 (C14orf24), mRNA Length = 2856 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 519 tcttcttcttcttcctccttc 499
>gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete sequence Length = 143073 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 tggcgcggcggtgggcggctg 187 ||||||||||||||||||||| Sbjct: 88944 tggcgcggcggtgggcggctg 88924
>gb|AC116569.6| Mus musculus BAC clone RP23-59O19 from chromosome 8, complete sequence Length = 132422 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 ||||||||||||||| |||||| |||||| Sbjct: 83745 gtcttcttcttcttcttccttcttcttct 83717 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 83673 tcttcttcttcttcctccttc 83653 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 83741 tcttcttcttcttccttcttcttcttct 83714
>gb|AY226091.1| Aurelia aurita 90-kDa heat-shock protein (hsp90) mRNA, partial cds Length = 878 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 646 tgtcttcttcttcttcctcct 626
>gb|AC110903.25| Mus musculus chromosome 7, clone RP24-174G2, complete sequence Length = 181076 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 109129 tcttcttcttcttcctccttc 109109
>gb|AC068607.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-392C14, complete sequence Length = 218081 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 42002 tgtcttcttcttcttcctcct 42022
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 35106139 tcttcttcttcttcctccttc 35106159 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctcctt 143 |||||||||||||||||||| Sbjct: 36036498 tcttcttcttcttcctcctt 36036517 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 ggtggagtggagtggaggga 60 |||||||||||||||||||| Sbjct: 17029876 ggtggagtggagtggaggga 17029895
>gb|AC113038.14| Mus musculus chromosome 17, clone RP23-228K17, complete sequence Length = 226769 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 111841 tcttcttcttcttcctccttc 111821
>gb|AC131105.4| Mus musculus BAC clone RP23-280N9 from chromosome 19, complete sequence Length = 225527 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 212413 tcttcttcttcttcctccttc 212433
>gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome 19, complete sequence Length = 184164 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 86734 tcttcttcttcttcctccttc 86754
>ref|XM_858565.1| PREDICTED: Canis familiaris similar to Protein KIAA0152 precursor, transcript variant 2 (LOC609274), mRNA Length = 1095 Score = 42.1 bits (21), Expect = 0.67 Identities = 33/37 (89%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctccagccctg 160 ||||||||||||||||||| |||||||||| |||| Sbjct: 789 tcttcttcttcttcctcctctttcttctccaggcctg 753
>ref|XM_846298.1| PREDICTED: Canis familiaris similar to Protein KIAA0152 precursor, transcript variant 1 (LOC609274), mRNA Length = 2265 Score = 42.1 bits (21), Expect = 0.67 Identities = 33/37 (89%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctccagccctg 160 ||||||||||||||||||| |||||||||| |||| Sbjct: 840 tcttcttcttcttcctcctctttcttctccaggcctg 804
>gb|AC133514.4| Mus musculus BAC clone RP23-212F6 from chromosome 5, complete sequence Length = 208083 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 176753 tcttcttcttcttcctccttc 176733
>gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome 19, complete sequence Length = 237854 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 45565 tcttcttcttcttcctccttc 45585
>emb|CT009518.6| Mouse DNA sequence from clone RP23-118M14 on chromosome 13, complete sequence Length = 221250 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 161160 tcttcttcttcttcctccttc 161180
>emb|AJ783629.1| Lacerta viridis microsatellite DNA, locus 9, clone Lvir14 Length = 498 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 290 tcttcttcttcttcctccttc 310
>gb|AC132357.3| Mus musculus BAC clone RP24-120G2 from chromosome 18, complete sequence Length = 189088 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 127947 tcttcttcttcttcctccttc 127927
>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence Length = 152908 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 74143 tcttcttcttcttcctccttc 74163
>gb|AC133093.4| Mus musculus BAC clone RP23-442I18 from chromosome 8, complete sequence Length = 177876 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 27783 tcttcttcttcttcctccttc 27763
>ref|XM_805547.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510611.10) partial mRNA Length = 2052 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 776 tcttcttcttcttcctccttc 756
>gb|AC007651.2| Arabidopsis thaliana chromosome I BAC F20D23 genomic sequence, complete sequence Length = 114935 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 38302 tcttcttcttcttcctccttc 38282
>ref|XM_548324.2| PREDICTED: Canis familiaris similar to GTPase activating RANGAP domain-like 4 (LOC491204), mRNA Length = 2751 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gctgtcttcttcttcttcctc 140 ||||||||||||||||||||| Sbjct: 741 gctgtcttcttcttcttcctc 721
>gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosome 7, complete sequence Length = 195987 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 137296 tcttcttcttcttcctccttc 137276
>gb|AC125181.4| Mus musculus BAC clone RP23-324L6 from chromosome 8, complete sequence Length = 223306 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 209235 tcttcttcttcttcctccttc 209215 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 39057 tcttcttcttcttccttcttcttcttct 39084 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 39054 tcttcttcttcttcttccttcttcttct 39081
>gb|AC124502.4| Mus musculus BAC clone RP23-414G6 from chromosome 19, complete sequence Length = 219212 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 168259 tcttcttcttcttcctccttc 168239
>gb|AC121914.3| Mus musculus BAC clone RP24-186A10 from chromosome 3, complete sequence Length = 172937 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 114128 tgtcttcttcttcttcctcct 114148
>gb|AC122216.4| Mus musculus BAC clone RP23-118H9 from 5, complete sequence Length = 196273 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 81581 tgtcttcttcttcttcctcct 81561
>gb|AC124776.3| Mus musculus BAC clone RP23-89D11 from 12, complete sequence Length = 179618 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 166193 tcttcttcttcttcctccttc 166173
>gb|AC125347.2| Mus musculus BAC clone RP24-136B2 from 5, complete sequence Length = 130354 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 12375 tcttcttcttcttcctccttc 12355
>gb|AC073136.6| Homo sapiens BAC clone RP11-700P18 from 7, complete sequence Length = 80796 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 gctgtcttcttcttcttcctc 140 ||||||||||||||||||||| Sbjct: 33255 gctgtcttcttcttcttcctc 33275
>gb|AC092536.3| Homo sapiens BAC clone RP11-32N3 from 7, complete sequence Length = 132755 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 ||||||||||||||||| ||| ||||||| Sbjct: 30702 tcttcttcttcttcctctttcttcttctc 30674
>ref|XM_660247.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20054) partial mRNA Length = 2769 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 1928 tgtcttcttcttcttcctcct 1948
>gb|AC115737.9| Mus musculus chromosome 3, clone RP23-473G18, complete sequence Length = 179034 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 56731 tcttcttcttcttcctccttc 56711
>gb|AC144766.18| Medicago truncatula clone mth2-17c2, complete sequence Length = 92099 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 |||||||||||||| |||||| ||||||| Sbjct: 82591 tcttcttcttcttcttccttcttcttctc 82619
>gb|AC153364.4| Mus musculus BAC clone RP23-35J21 from chromosome 10, complete sequence Length = 231668 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 82964 tcttcttcttcttcctccttc 82984
>gb|AC161366.6| Mus musculus BAC clone RP24-230D17 from chromosome 9, complete sequence Length = 155733 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 52607 tcttcttcttcttcctccttc 52627
>gb|AC094784.13| Rattus norvegicus 11 BAC CH230-4O6 (Children's Hospital Oakland Research Institute) complete sequence Length = 228501 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 144415 tcttcttcttcttcctccttc 144435
>gb|AC133425.3| Rattus norvegicus 7 BAC CH230-333I12 (Children's Hospital Oakland Research Institute) complete sequence Length = 64809 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gctgtcttcttcttcttcctc 140 ||||||||||||||||||||| Sbjct: 37334 gctgtcttcttcttcttcctc 37314
>gb|AC182767.3| Pan troglodytes BAC clone CH251-283B24 from chromosome 7, complete sequence Length = 155153 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 ||||||||||| ||||||||| ||||||| Sbjct: 88900 tcttcttcttcctcctccttcttcttctc 88928 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||||| | |||||| Sbjct: 88897 tcttcttcttcttcctcctccttcttct 88924
>gb|AY360170.3| Lycopersicon esculentum strain L402 glycerol-3-phosphate acyltransferase (GPAT) mRNA, complete cds Length = 1772 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 101 tcttcttcttcttcctccttc 121
>emb|AL591499.7| Human DNA sequence from clone RP11-15G8 on chromosome 6 Contains the 5' end of a novel gene (KIAA1116), a stathmin-like 2 (Superiorcervical ganglia, neural specific 10 superior cervical ganglia, neural specific 10 neuronal growth-associated protein (silencer) (STMN2) (SCG10, SGC10, SCGN10) pseudogene and two CpG islands, complete sequence Length = 111864 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 13711 tcttcttcttcttcctccttc 13691
>gb|DQ459433.1| Lycopersicon esculentum cultivar Zhongshu 4 glycerol-3-phosphate acyltransferase (GPAT) mRNA, complete cds Length = 1314 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 31 tcttcttcttcttcctccttc 51
>emb|AL162575.15| Human DNA sequence from clone RP11-310K10 on chromosome 13 Contains the 3' end of the PCDH20 gene for protocadherin 20 and a CpG island, complete sequence Length = 163231 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 152145 tgtcttcttcttcttcctcct 152125
>gb|AC115802.10| Mus musculus, clone RP23-408J7, complete sequence Length = 185710 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 104764 tcttcttcttcttcctccttc 104744
>emb|AL158052.10| Human DNA sequence from clone RP11-570J20 on chromosome 9q33.1-34.12 Contains three novel genes, the 3' end of the LHX2 gene for LIM homeobox protein 2 and four CpG islands, complete sequence Length = 221887 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 175123 tcttcttcttcttcctccttc 175143
>emb|AL138815.6| Human DNA sequence from clone RP11-141F12 on chromosome 13 Contains part of the ATP8A2 gene for ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2 (ML-1 protein (IB, ATP, ML-1, ATPIB, DKFZP434B1913)), a novel pseudogene and a CpG island, complete sequence Length = 160210 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 ggtggagtggagtggagggag 61 ||||||||||||||||||||| Sbjct: 114572 ggtggagtggagtggagggag 114592
>gb|AC164154.2| Mus musculus chromosome 18, clone RP23-60G12, complete sequence Length = 238662 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 96389 tcttcttcttcttcctccttc 96369
>gb|AC112162.8| Mus Musculus chromosome 9 BAC clone MGS1-296M6 ES cell line, complete sequence Length = 116580 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 26387 tcttcttcttcttcctccttc 26407
>emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence Length = 81493 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcctt 143 ||||||||||||||||||||| Sbjct: 64654 gtcttcttcttcttcctcctt 64634
>gb|AC164106.3| Mus musculus BAC clone RP23-445D20 from chromosome 18, complete sequence Length = 195721 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 33066 tcttcttcttcttcctccttc 33046
>emb|AL646088.23| Mouse DNA sequence from clone RP23-58E13 on chromosome 11 Contains the genes for three novel proteins (MOR256-22, MOR256-23 and MOR256-26), five genes for novel proteins similar to the olfactory receptor family MOR256, a ribosomal protein S28 (Rps28) pseudogene, the Flt4 gene for FMS-like tyrosine kinase 4 and two CpG islands, complete sequence Length = 211330 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 153989 tcttcttcttcttcctccttc 153969
>gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromosome 7, complete sequence Length = 219717 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 ||||||||||||||||| ||| ||||||| Sbjct: 159000 tcttcttcttcttcctctttcttcttctc 158972
>emb|BX294024.1|NC20H10 Neurospora crassa DNA linkage group V Cosmid contig 20H10 Length = 96283 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 32076 tcttcttcttcttcctccttc 32096
>gb|BC029559.1| Homo sapiens chromosome 14 open reading frame 24, mRNA (cDNA clone MGC:39507 IMAGE:5310901), complete cds Length = 724 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 500 tcttcttcttcttcctccttc 480
>emb|AL731635.3|OSJN00277 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0016B03, complete sequence Length = 125780 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 98437 tcttcttcttcttcctccttc 98457
>emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete sequence Length = 175698 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 128595 tcttcttcttcttcctccttc 128575
>gb|AC122587.5| Rattus norvegicus BAC CH230-173H6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 202972 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 140396 tcttcttcttcttcctccttc 140376
>emb|AL645967.20| Mouse DNA sequence from clone RP23-82J18 on chromosome 11 Contains a novel pseudogene, complete sequence Length = 166549 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 ||||||||||||||||| |||| |||||| Sbjct: 159921 gtcttcttcttcttccttcttcttcttct 159893
>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a novel pseudogene, complete sequence Length = 203319 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 112522 tcttcttcttcttcctccttc 112502
>emb|AL928931.15| Mouse DNA sequence from clone RP23-419H3 on chromosome 2, complete sequence Length = 148740 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 53429 tcttcttcttcttcctccttc 53409
>gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 210578 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 60593 tgtcttcttcttcttcctcct 60613
>emb|CR749796.1| Homo sapiens mRNA; cDNA DKFZp686J1254 (from clone DKFZp686J1254) Length = 2937 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 578 tcttcttcttcttcctccttc 558
>gb|AC148939.8| Pan troglodytes BAC clone CH251-51M11 from chromosome 7, complete sequence Length = 183313 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 gctgtcttcttcttcttcctc 140 ||||||||||||||||||||| Sbjct: 12224 gctgtcttcttcttcttcctc 12244
>gb|AC090701.5| Homo sapiens chromosome 18, clone RP11-810M21, complete sequence Length = 188779 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 80688 tcttcttcttcttcctccttc 80708
>dbj|AK096173.1| Homo sapiens cDNA FLJ38854 fis, clone MESAN2010664 Length = 2856 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 519 tcttcttcttcttcctccttc 499
>gb|AC073437.50| Mus musculus strain 129/Sv chromosome 2 clone ct7-531j6, complete sequence Length = 176056 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 108000 tcttcttcttcttcctccttc 107980
>gb|AC068496.7| Mus musculus chromosome 3 clone RP23-75F13 clone RP23-75F13, complete sequence Length = 136268 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 112803 tcttcttcttcttcctccttc 112823
>gb|AC102341.10| Mus musculus chromosome 8, clone RP23-214E1, complete sequence Length = 187701 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 160943 tgtcttcttcttcttcctcct 160923
>gb|AY049031.1| Ajellomyces capsulatus mold-specific MS8 protein (MS8) gene, complete cds Length = 2088 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 1713 tcttcttcttcttcctccttc 1733
>gb|AC021683.10| Homo sapiens chromosome 17, clone RP11-13K12, complete sequence Length = 162615 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 126958 tcttcttcttcttcctccttc 126978
>gb|AC003673.3| Arabidopsis thaliana chromosome 2 clone F19F24 map CIC06E08, complete sequence Length = 99359 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 35671 tcttcttcttcttcctccttc 35691
>gb|AC116310.2| Homo sapiens chromosome 5 clone RP11-203E6, complete sequence Length = 149704 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 59874 tcttcttcttcttcctccttc 59894
>gb|AF367343.1| Arabidopsis thaliana At1g17220/F20D23_8 mRNA, complete cds Length = 3631 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 53 tcttcttcttcttcctccttc 73
>gb|AF292398.2|AF292398 Ajellomyces capsulatus MS8 (MS8) mRNA, complete cds Length = 1229 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 983 tcttcttcttcttcctccttc 1003
>gb|AC010229.7| Homo sapiens chromosome 5 clone CTC-312N19, complete sequence Length = 70533 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 45194 tcttcttcttcttcctccttc 45174
>gb|AE008683.1|AE008683 Mus musculus T-cell receptor alpha/delta locus section 1 of 4 of the complete region Length = 404892 Score = 42.1 bits (21), Expect = 0.67 Identities = 24/25 (96%) Strand = Plus / Plus Query: 126 ttcttcttcttcctccttcgtcttc 150 ||||||||||||||||||| ||||| Sbjct: 70451 ttcttcttcttcctccttcttcttc 70475 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 49548 tcttcttcttcttcttccttcttcttct 49575
>gb|AC136742.15| Mus musculus chromosome 5, clone RP23-145H8, complete sequence Length = 197131 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 148923 tcttcttcttcttcctccttc 148903
>gb|AC159265.2| Mus musculus BAC clone RP23-462H20 from chromosome 8, complete sequence Length = 201728 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctccttcgtcttct 151 ||||||||||||||| |||||| |||||| Sbjct: 74907 gtcttcttcttcttcttccttcttcttct 74879 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 74835 tcttcttcttcttcctccttc 74815 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||||| |||| |||||| Sbjct: 74903 tcttcttcttcttccttcttcttcttct 74876
>gb|AC159258.2| Mus musculus BAC clone RP24-87A4 from chromosome 13, complete sequence Length = 221108 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 64807 tcttcttcttcttcctccttc 64787
>gb|AC016598.5|AC016598 Homo sapiens chromosome 5 clone CTD-2050E21, complete sequence Length = 159866 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 3464 tcttcttcttcttcctccttc 3444
>dbj|AK075644.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110032I23 product:unclassifiable, full insert sequence Length = 1494 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 1414 tcttcttcttcttcctccttc 1434
>gb|AC148711.1| Macaca mulatta Major Histocompatibility Complex BAC MMU404O15, complete sequence Length = 157177 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 |||||||||||||||| |||| ||||||| Sbjct: 93401 tcttcttcttcttccttcttcttcttctc 93373 Score = 40.1 bits (20), Expect = 2.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttct 151 |||||||||||||| |||||| |||||| Sbjct: 93404 tcttcttcttcttcttccttcttcttct 93377
>gb|AC148674.1| Macaca mulatta Major Histocompatibility Complex BAC MMU103F20, complete sequence Length = 174172 Score = 42.1 bits (21), Expect = 0.67 Identities = 27/29 (93%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttcgtcttctc 152 |||||||||||||| |||||| ||||||| Sbjct: 51632 tcttcttcttcttcttccttcttcttctc 51604
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 22524840 tcttcttcttcttcctccttc 22524820 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 ggcggtgggcggctgcgggcc 193 ||||||||||||||||||||| Sbjct: 3320139 ggcggtgggcggctgcgggcc 3320159 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 2373118 tcttcttcttcttcctccttc 2373138 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 33752952 gtcttcttcttcttcctcct 33752933 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 32052066 gtcttcttcttcttcctcct 32052085 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 28835904 gtcttcttcttcttcctcct 28835923
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 7478026 tcttcttcttcttcctccttc 7478006 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 126 ttcttcttcttcctccttcg 145 |||||||||||||||||||| Sbjct: 27927065 ttcttcttcttcctccttcg 27927046 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 21113498 gtcttcttcttcttcctcct 21113479 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctcctt 143 |||||||||||||||||||| Sbjct: 11275164 tcttcttcttcttcctcctt 11275183 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 4288142 gtcttcttcttcttcctcct 4288161 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gtcttcttcttcttcctcct 142 |||||||||||||||||||| Sbjct: 312672 gtcttcttcttcttcctcct 312691
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 35196211 tcttcttcttcttcctccttc 35196231 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctcctt 143 |||||||||||||||||||| Sbjct: 36126572 tcttcttcttcttcctcctt 36126591 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 ggtggagtggagtggaggga 60 |||||||||||||||||||| Sbjct: 17023445 ggtggagtggagtggaggga 17023464
>gb|AF532115.1| Mus musculus strain 129/SvJ BAC clone citb553n23 from the MHC region, complete sequence Length = 161729 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 71040 tcttcttcttcttcctccttc 71060
>gb|AC158937.4| Mus musculus chromosome 3, clone RP23-290L18, complete sequence Length = 196087 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 57598 tcttcttcttcttcctccttc 57578
>gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, complete sequence Length = 176303 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 70249 tcttcttcttcttcctccttc 70229
>emb|BX820474.1|CNS0A8KK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1350 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 7 tcttcttcttcttcctccttc 27
>emb|BX822648.1|CNS0A4QQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB56ZC12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1962 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gtcttcttcttcttcctcctt 143 ||||||||||||||||||||| Sbjct: 1810 gtcttcttcttcttcctcctt 1790
>emb|BX830554.1|CNS0A1MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB8ZF03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2344 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 503 tcttcttcttcttcctccttc 483
>gb|AC153909.5| Mus musculus 6 BAC RP23-190O15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 226538 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 9 aaacacggggaaggagaagga 29 ||||||||||||||||||||| Sbjct: 100996 aaacacggggaaggagaagga 100976
>gb|AC150749.3| Pan troglodytes BAC clone CH251-553P23 from chromosome 7, complete sequence Length = 237211 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gctgtcttcttcttcttcctc 140 ||||||||||||||||||||| Sbjct: 163618 gctgtcttcttcttcttcctc 163598
>gb|AC154535.2| Mus musculus BAC clone RP23-447M9 from chromosome 13, complete sequence Length = 179176 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 116819 tcttcttcttcttcctccttc 116839
>gb|AC116348.3| Homo sapiens chromosome 16 clone RP11-297C4, complete sequence Length = 149508 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 118096 tcttcttcttcttcctccttc 118076
>gb|AC093798.3| Homo sapiens BAC clone RP11-306N14 from 2, complete sequence Length = 233877 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 160798 tcttcttcttcttcctccttc 160818
>gb|AF242435.1|AF242433S3 Mus musculus delta Naip2 pseudogene, exons 9 and 11-14 Length = 14784 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 183 tcttcttcttcttcctccttc 163
>gb|AF367969.1|AF367967S3 Mus musculus neuronal apoptosis inhibitory protein 2 (Naip2) gene, exons 1 through 8 and complete cds; neuronal apoptosis inhibitory protein 5 (Naip5) gene, complete cds; delta neuronal apoptosis inhibitory protein (deltaNaip) pseudogene; and neuronal apoptosis inhibitory protein 6 (Naip6) gene, complete cds Length = 147984 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 95117 tcttcttcttcttcctccttc 95097
>gb|AC104981.9| Homo sapiens chromosome 17, clone RP11-316M20, complete sequence Length = 193181 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 tcttcttcttcttcctccttc 144 ||||||||||||||||||||| Sbjct: 183221 tcttcttcttcttcctccttc 183201
>gb|AC098807.3| Papio anubis clone RP41-157N15, complete sequence Length = 212643 Score = 42.1 bits (21), Expect = 0.67 Identities = 21/21 (100%) Strand = Plus / Plus Query: 122 tgtcttcttcttcttcctcct 142 ||||||||||||||||||||| Sbjct: 74158 tgtcttcttcttcttcctcct 74178 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,595,633 Number of Sequences: 3902068 Number of extensions: 3595633 Number of successful extensions: 1010077 Number of sequences better than 10.0: 1007 Number of HSP's better than 10.0 without gapping: 1011 Number of HSP's successfully gapped in prelim test: 11 Number of HSP's that attempted gapping in prelim test: 952638 Number of HSP's gapped (non-prelim): 56531 length of query: 210 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 188 effective length of database: 17,147,199,772 effective search space: 3223673557136 effective search space used: 3223673557136 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
