Clone Name | bastl20c06 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_506161.1| PREDICTED Oryza sativa (japonica cultivar-group), P0022E03.2 mRNA Length = 3539 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Plus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 830 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 889 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 890 tctcc---caagaacttcacactcagctt 915
>ref|XM_476621.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3109 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Plus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 381 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 440 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 441 tctcc---caagaacttcacactcagctt 466
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Minus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 2493156 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 2493097 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 2493096 tctcc---caagaacttcacactcagctt 2493071 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 16833422 ttgcggcggcggcggcggagga 16833401 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 243 aaattgcggcggcggcggcgg 263 ||||||||||||||||||||| Sbjct: 11506600 aaattgcggcggcggcggcgg 11506620 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 5567390 gcggcggcggcggcggaggat 5567370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 2460337 gcggcggcggcggcggaggat 2460317 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27891640 gcggcggcggcggcggagga 27891621 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 26359579 gcggcggcggcggcggagga 26359560 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 26167037 gcggcggcggcggcggagga 26167056 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24902938 gcggcggcggcggcggagga 24902919 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24424350 gcggcggcggcggcggagga 24424331 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24223286 gcggcggcggcggcggagga 24223267 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19885050 gcggcggcggcggcggagga 19885069 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19692582 gcggcggcggcggcggagga 19692563 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17785030 gcggcggcggcggcggagga 17785011 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16880350 gcggcggcggcggcggagga 16880369 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14687879 gcggcggcggcggcggagga 14687860 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 5141552 cggcggcggcggcggaggat 5141533 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3157171 gcggcggcggcggcggagga 3157190
>dbj|AP004263.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0022E03 Length = 163032 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Minus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 58136 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 58077 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 58076 tctcc---caagaacttcacactcagctt 58051 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 25317 gcggcggcggcggcggaggat 25297
>dbj|AK102834.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033109J23, full insert sequence Length = 3540 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Plus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 831 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 890 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 891 tctcc---caagaacttcacactcagctt 916
>dbj|AK099551.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013033H24, full insert sequence Length = 3109 Score = 69.9 bits (35), Expect = 7e-09 Identities = 76/89 (85%), Gaps = 3/89 (3%) Strand = Plus / Plus Query: 367 atcaactgcggctcggattccgccaccaatgccgatgccaggatatggattggggattct 426 |||||||||||||| |||||| ||||| ||| |||| ||||| |||||||||||||||| Sbjct: 381 atcaactgcggctcagattccaccaccgatgttgatggcaggagatggattggggattct 440 Query: 427 tccccttccagcaacttcacactcagctt 455 || || || ||||||||||||||||| Sbjct: 441 tctcc---caagaacttcacactcagctt 466
>ref|XM_538379.2| PREDICTED: Canis familiaris similar to SRY (sex determining region Y)-box 10 (LOC481258), mRNA Length = 1987 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggatcg 270 ||||||||||||||||||||||| Sbjct: 563 gcggcggcggcggcggaggatcg 585
>gb|AY155576.1| Bordetella avium strain 197N ABC transporter gene, partial cds; and adhesin FhaB (fhaB), complete cds; fimbrial gene cluster, complete sequence; and FHA accessory protein FhaC (fhaC) gene, complete cds Length = 16356 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcg 270 ||||||||||||||||||||||| Sbjct: 8379 gcggcggcggcggcggaggatcg 8357 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcg 270 ||||||||||||||||||||||| Sbjct: 8184 gcggcggcggcggcggaggatcg 8162 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcg 270 ||||||||||||||||||||||| Sbjct: 7995 gcggcggcggcggcggaggatcg 7973
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggaggatc 269 ||||||||||||||||||||||| Sbjct: 8951568 tgcggcggcggcggcggaggatc 8951546 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 40482169 tgcggcggcggcggcggagga 40482189 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 ggcggcggcggcggaggatcg 270 ||||||||||||||||||||| Sbjct: 34683237 ggcggcggcggcggaggatcg 34683217 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 28224751 gcggcggcggcggcggaggat 28224731 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 25675600 tgcggcggcggcggcggagga 25675620 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 9683272 tgcggcggcggcggcggagga 9683292 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 40770812 gcggcggcggcggcggagga 40770831 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggatcgt 271 ||||||||||||||||||| |||| Sbjct: 37559542 gcggcggcggcggcggaggctcgt 37559565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 37006094 tgcggcggcggcggcggagg 37006113 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 32926038 gcggcggcggcggcggagga 32926019 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 32534766 gcggcggcggcggcggagga 32534785 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 28673281 gcggcggcggcggcggagga 28673300 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22988745 gcggcggcggcggcggagga 22988726 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18107324 gcggcggcggcggcggagga 18107343 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15342537 gcggcggcggcggcggagga 15342556 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 13754631 gcggcggcggcggcggagga 13754650 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 10019243 gcggcggcggcggcggagga 10019224 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 9769443 tgcggcggcggcggcggagg 9769462 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 8403735 gcggcggcggcggcggagga 8403754 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5378125 gcggcggcggcggcggagga 5378144 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 3574392 tgcggcggcggcggcggagg 3574373 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3414593 gcggcggcggcggcggagga 3414574 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2402605 gcggcggcggcggcggagga 2402624
>dbj|AP001383.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0453A06 Length = 154378 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggaggatc 269 ||||||||||||||||||||||| Sbjct: 59323 tgcggcggcggcggcggaggatc 59301
>ref|XM_507302.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1770_H02.14 mRNA Length = 1591 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 84 cggcggcggcggcggaggatcg 63
>ref|XM_483457.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1562 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 85 cggcggcggcggcggaggatcg 64
>ref|XM_475325.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1866 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggatcgtccggga 277 |||||||||||||||| || |||||||||| Sbjct: 404 gcggcggcggcggcggggggtcgtccggga 433
>ref|NM_194083.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1352 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 45 ttgcggcggcggcggcggagga 24
>ref|XM_478039.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1835 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 104 ttgcggcggcggcggcggagga 83
>gb|AC137611.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0020H14, complete sequence Length = 185623 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcgtccggga 277 |||||||||||||||| || |||||||||| Sbjct: 50144 gcggcggcggcggcggggggtcgtccggga 50115
>gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1110B01, complete sequence Length = 160142 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcgtccggga 277 |||||||||||||||| || |||||||||| Sbjct: 89371 gcggcggcggcggcggggggtcgtccggga 89342
>gb|DQ195081.1| Oryza sativa (indica cultivar-group) putative leucine-rich repeat receptor-like kinase gene cluster, complete sequence; ternary complex factor MIP1-like gene, complete cds; putative membrane-associated protein and gag-pol precursor, pseudogenes, complete sequence; and unknown genes Length = 94077 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggaggat 268 |||||||||||||||||||||| Sbjct: 48503 tgcggcggcggcggcggaggat 48524
>gb|AY756174.4| Oryza rufipogon putative leucine-rich repeat receptor-like kinases and ternary complex factor MIP1-like genes, complete cds; retrotransposon putative membrane-associated protein and gag-pol precursor, pseudogenes, complete sequence; and unknown genes Length = 102522 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggaggat 268 |||||||||||||||||||||| Sbjct: 56914 tgcggcggcggcggcggaggat 56935
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 31785539 ttgcggcggcggcggcggagga 31785560 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 34909070 tgcggcggcggcggcggagga 34909050 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 26239344 gcggcggcggcggcggaggat 26239364 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 6333643 gcggcggcggcggcggaggat 6333623 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 4495704 gcggcggcggcggcggaggat 4495724 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 33493003 gcggcggcggcggcggagga 33492984 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 32342040 gcggcggcggcggcggagga 32342059 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 31381024 gcggcggcggcggcggagga 31381043 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27599662 gcggcggcggcggcggagga 27599681 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 25559150 tgcggcggcggcggcggagg 25559169 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 244 aattgcggcggcggcggcggagga 267 ||||| |||||||||||||||||| Sbjct: 25355556 aattgaggcggcggcggcggagga 25355579 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 25313590 gcggcggcggcggcggagga 25313571 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24228751 gcggcggcggcggcggagga 24228732 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18181982 gcggcggcggcggcggagga 18182001 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17590593 gcggcggcggcggcggagga 17590574 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17324972 gcggcggcggcggcggagga 17324991 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16860703 gcggcggcggcggcggagga 16860722 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15837709 gcggcggcggcggcggagga 15837690 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14774926 gcggcggcggcggcggagga 14774945 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14377508 gcggcggcggcggcggagga 14377527 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 11038805 gcggcggcggcggcggagga 11038824 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 10878122 gcggcggcggcggcggagga 10878141 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 9675778 gcggcggcggcggcggagga 9675759 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6132596 gcggcggcggcggcggagga 6132577 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5183202 gcggcggcggcggcggagga 5183221 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4754480 gcggcggcggcggcggagga 4754461 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3183107 gcggcggcggcggcggagga 3183126 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3151871 gcggcggcggcggcggagga 3151852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1713318 gcggcggcggcggcggagga 1713299 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1302536 gcggcggcggcggcggagga 1302555 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 734004 gcggcggcggcggcggagga 733985
>ref|XM_757362.1| Ustilago maydis 521 hypothetical protein (UM06308.1) partial mRNA Length = 2019 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 384 ttccgccaccaatgccgatgcc 405 |||||||||||||||||||||| Sbjct: 415 ttccgccaccaatgccgatgcc 394
>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence Length = 134496 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 110765 ttgcggcggcggcggcggagga 110786
>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete sequence Length = 162339 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 252 cggcggcggcggaggatcgtccggga 277 |||||||||||||||||| ||||||| Sbjct: 32583 cggcggcggcggaggatcctccggga 32608
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 252 cggcggcggcggaggatcgtccggga 277 |||||||||||||||||| ||||||| Sbjct: 16688066 cggcggcggcggaggatcctccggga 16688091 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 19411613 tgcggcggcggcggcggagga 19411633 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22307877 gcggcggcggcggcggagga 22307896 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21118282 gcggcggcggcggcggagga 21118301 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18270056 gcggcggcggcggcggagga 18270075 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17263685 tgcggcggcggcggcggagg 17263666 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 243 aaattgcggcggcggcggcggagg 266 |||| ||||||||||||||||||| Sbjct: 17163079 aaatggcggcggcggcggcggagg 17163056 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15572326 gcggcggcggcggcggagga 15572307 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 11069504 cggcggcggcggcggaggat 11069523 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2546592 gcggcggcggcggcggagga 2546573
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 26317846 cggcggcggcggcggaggatcg 26317825 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 19376069 tgcggcggcggcggcggagga 19376049 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 16832101 tgcggcggcggcggcggagga 16832121 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 27885460 tgcggcggcggcggcggagg 27885441 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 26346428 gcggcggcggcggcggagga 26346409 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 26159480 gcggcggcggcggcggagga 26159499 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gcggcggcggcggaggatcg 270 |||||||||||||||||||| Sbjct: 24554579 gcggcggcggcggaggatcg 24554598 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24485410 gcggcggcggcggcggagga 24485429 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22183173 gcggcggcggcggcggagga 22183154 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22085833 gcggcggcggcggcggagga 22085852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22059283 gcggcggcggcggcggagga 22059302 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21348250 gcggcggcggcggcggagga 21348269 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21035823 gcggcggcggcggcggagga 21035804 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtc 272 ||||||||||||||| |||||||| Sbjct: 20157936 cggcggcggcggcgggggatcgtc 20157913 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16302125 gcggcggcggcggcggagga 16302106 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15923015 gcggcggcggcggcggagga 15922996 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15922880 gcggcggcggcggcggagga 15922861 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15630914 gcggcggcggcggcggagga 15630933 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15630623 gcggcggcggcggcggagga 15630604 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 245 attgcggcggcggcggcggaggat 268 ||||||||||||||||||| |||| Sbjct: 14418249 attgcggcggcggcggcggcggat 14418272 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 11547615 gcggcggcggcggcggagga 11547634 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 9105206 gcggcggcggcggcggagga 9105225 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 8881643 gcggcggcggcggcggagga 8881662 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5842811 gcggcggcggcggcggagga 5842830 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3169589 gcggcggcggcggcggagga 3169570 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3079758 gcggcggcggcggcggagga 3079777 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 928090 gcggcggcggcggcggagga 928109
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatcgtccggga 277 |||||||||||||||| || |||||||||| Sbjct: 21496288 gcggcggcggcggcggggggtcgtccggga 21496259 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 25560228 gcggcggcggcggcggaggat 25560208 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 680310 tgcggcggcggcggcggagga 680290 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 28024775 gcggcggcggcggcggagga 28024794 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 26354422 gcggcggcggcggcggagga 26354403 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23888583 gcggcggcggcggcggagga 23888564 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23366671 gcggcggcggcggcggagga 23366690 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17301924 gcggcggcggcggcggagga 17301905 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16858368 gcggcggcggcggcggagga 16858387 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16465875 gcggcggcggcggcggagga 16465894 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16465552 gcggcggcggcggcggagga 16465533 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16154128 gcggcggcggcggcggagga 16154109 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16086170 gcggcggcggcggcggagga 16086151 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 13798944 gcggcggcggcggcggagga 13798963 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 7046444 gcggcggcggcggcggagga 7046425 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6433562 gcggcggcggcggcggagga 6433543 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6067001 gcggcggcggcggcggagga 6066982 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4729126 gcggcggcggcggcggagga 4729145 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 4678734 tgcggcggcggcggcggagg 4678753 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 4148489 tgcggcggcggcggcggagg 4148470 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1583299 gcggcggcggcggcggagga 1583280 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1140569 gcggcggcggcggcggagga 1140588
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 31876055 ttgcggcggcggcggcggagga 31876076 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 34999142 tgcggcggcggcggcggagga 34999122 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 26330653 gcggcggcggcggcggaggat 26330673 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 6332856 gcggcggcggcggcggaggat 6332836 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 4495819 gcggcggcggcggcggaggat 4495839 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 33583475 gcggcggcggcggcggagga 33583456 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 32432550 gcggcggcggcggcggagga 32432569 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 31471540 gcggcggcggcggcggagga 31471559 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27690985 gcggcggcggcggcggagga 27691004 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 25650459 tgcggcggcggcggcggagg 25650478 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 244 aattgcggcggcggcggcggagga 267 ||||| |||||||||||||||||| Sbjct: 25446865 aattgaggcggcggcggcggagga 25446888 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 25404899 gcggcggcggcggcggagga 25404880 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24146220 gcggcggcggcggcggagga 24146201 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18175523 gcggcggcggcggcggagga 18175542 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17584134 gcggcggcggcggcggagga 17584115 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 17318513 gcggcggcggcggcggagga 17318532 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16854336 gcggcggcggcggcggagga 16854355 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15832243 gcggcggcggcggcggagga 15832224 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14769460 gcggcggcggcggcggagga 14769479 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14372483 gcggcggcggcggcggagga 14372502 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 11035568 gcggcggcggcggcggagga 11035587 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 10876223 gcggcggcggcggcggagga 10876242 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 9673899 gcggcggcggcggcggagga 9673880 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6131809 gcggcggcggcggcggagga 6131790 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5182417 gcggcggcggcggcggagga 5182436 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4754595 gcggcggcggcggcggagga 4754576 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3183218 gcggcggcggcggcggagga 3183237 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3151982 gcggcggcggcggcggagga 3151963 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1713316 gcggcggcggcggcggagga 1713297 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1302534 gcggcggcggcggcggagga 1302553 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 734002 gcggcggcggcggcggagga 733983
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatc 269 |||||||||||||||||||||| Sbjct: 11360646 gcggcggcggcggcggaggatc 11360625 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggaggat 268 |||||||||||||||||||||| Sbjct: 2927664 tgcggcggcggcggcggaggat 2927643 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtcc 273 |||||||||||||||||| |||||| Sbjct: 30029892 cggcggcggcggcggaggctcgtcc 30029868 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 18916249 tgcggcggcggcggcggagga 18916229 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 16010832 tgcggcggcggcggcggagga 16010852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 35408195 gcggcggcggcggcggagga 35408214 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 34261193 gcggcggcggcggcggagga 34261174 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 30717676 gcggcggcggcggcggagga 30717657 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 30327884 gcggcggcggcggcggagga 30327865 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23917980 gcggcggcggcggcggagga 23917999 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22716548 gcggcggcggcggcggagga 22716529 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22608772 gcggcggcggcggcggagga 22608753 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21013160 gcggcggcggcggcggagga 21013141 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15870544 gcggcggcggcggcggagga 15870525 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 12163713 gcggcggcggcggcggagga 12163732 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 10282415 gcggcggcggcggcggagga 10282396 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 8004237 gcggcggcggcggcggagga 8004218 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6681983 gcggcggcggcggcggagga 6681964 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5121419 gcggcggcggcggcggagga 5121438 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3673245 gcggcggcggcggcggagga 3673264 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3459740 gcggcggcggcggcggagga 3459759 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2728949 gcggcggcggcggcggagga 2728930 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 245 attgcggcggcggcggcggaggat 268 ||||||||||||||||||| |||| Sbjct: 2450845 attgcggcggcggcggcggcggat 2450868 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2125557 gcggcggcggcggcggagga 2125576 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1655315 gcggcggcggcggcggagga 1655334 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1467970 gcggcggcggcggcggagga 1467989
>dbj|AP007224.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0463E12 Length = 161081 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggaggat 268 |||||||||||||||||||||| Sbjct: 53303 tgcggcggcggcggcggaggat 53282
>dbj|AP004347.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0675B10 Length = 136229 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 9176 ttgcggcggcggcggcggagga 9155 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 56104 gcggcggcggcggcggagga 56123
>dbj|AP003806.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1103_E04 Length = 111354 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 49989 ttgcggcggcggcggcggagga 49968 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 96917 gcggcggcggcggcggagga 96936
>dbj|AP004123.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1654_A02 Length = 128520 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggatc 269 |||||||||||||||||||||| Sbjct: 30118 gcggcggcggcggcggaggatc 30097
>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1770_H02 Length = 170648 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 47427 cggcggcggcggcggaggatcg 47406 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 76009 gcggcggcggcggcggagga 75990
>dbj|AK103840.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148I08, full insert sequence Length = 1833 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 103 ttgcggcggcggcggcggagga 82
>dbj|AK103731.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138E22, full insert sequence Length = 1561 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 85 cggcggcggcggcggaggatcg 64
>dbj|AK067105.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013097J20, full insert sequence Length = 1497 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 223 ttgcggcggcggcggcggagga 202
>dbj|AK065800.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039B12, full insert sequence Length = 1590 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcg 270 |||||||||||||||||||||| Sbjct: 83 cggcggcggcggcggaggatcg 62
>dbj|AK064972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B17, full insert sequence Length = 1319 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 246 ttgcggcggcggcggcggagga 267 |||||||||||||||||||||| Sbjct: 30 ttgcggcggcggcggcggagga 9
>dbj|AK063749.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-G08, full insert sequence Length = 849 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 252 cggcggcggcggaggatcgtccggga 277 |||||||||||||||||| ||||||| Sbjct: 49 cggcggcggcggaggatcctccggga 24
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 252 cggcggcggcggaggatcgtccggga 277 |||||||||||||||||| ||||||| Sbjct: 16697106 cggcggcggcggaggatcctccggga 16697131 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 19422889 tgcggcggcggcggcggagga 19422909 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22319945 gcggcggcggcggcggagga 22319964 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21129546 gcggcggcggcggcggagga 21129565 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18279309 gcggcggcggcggcggagga 18279328 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17272725 tgcggcggcggcggcggagg 17272706 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 243 aaattgcggcggcggcggcggagg 266 |||| ||||||||||||||||||| Sbjct: 17172119 aaatggcggcggcggcggcggagg 17172096 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15580567 gcggcggcggcggcggagga 15580548 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 11075944 cggcggcggcggcggaggat 11075963 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2546543 gcggcggcggcggcggagga 2546524
>ref|XM_482311.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1070 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 359 tgcggcggcggcggcggagga 339
>ref|XM_481974.1| Oryza sativa (japonica cultivar-group), mRNA Length = 789 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 102 tgcggcggcggcggcggagga 122
>ref|XM_467536.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1026 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtcc 273 |||||||||||||||||| |||||| Sbjct: 31 cggcggcggcggcggaggctcgtcc 7
>ref|XM_465568.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1885 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 138 tgcggcggcggcggcggagga 158
>ref|NM_197355.1| Oryza sativa (japonica cultivar-group) putative transcription factor (OSJNBa0076F20.5), mRNA Length = 3478 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 1842 tgcggcggcggcggcggagga 1822
>ref|NM_192258.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 747 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 201 tgcggcggcggcggcggagga 221
>ref|XM_470355.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2548 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 60 tgcggcggcggcggcggagga 40
>ref|XM_477045.1| Oryza sativa (japonica cultivar-group), mRNA Length = 636 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 124 gcggcggcggcggcggaggat 144
>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete sequence Length = 1783081 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 443356 gcggcggcggcggcggaggat 443336
>gb|AY022874.1| Oryza sativa microsatellite MRG5199 containing (CGG)X8, closest to marker C1057 , genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 109 gcggcggcggcggcggaggat 129
>gb|AC132491.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0599F04, complete sequence Length = 169073 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 76635 gcggcggcggcggcggaggat 76615
>gb|AC148759.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0030K09, complete sequence Length = 143355 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 77313 gcggcggcggcggcggaggat 77333
>gb|AC120885.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0042J05, complete sequence Length = 150295 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 93528 gcggcggcggcggcggaggat 93508
>gb|AC134925.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0041J17, complete sequence Length = 148829 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 96362 gcggcggcggcggcggaggat 96342
>ref|XM_570644.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CND01630) partial mRNA Length = 2522 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 1587 gcggcggcggcggcggaggat 1567
>gb|BC036381.1| Homo sapiens Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans), mRNA (cDNA clone MGC:33347 IMAGE:4829267), complete cds Length = 4656 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 100 gcggcggcggcggcggaggat 120
>emb|Z84468.1|HS299D3 Human DNA sequence from clone CTA-299D3 on chromosome 22q13.3, complete sequence Length = 90736 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 74990 gcggcggcggcggcggaggat 74970
>emb|AL449223.7| Human DNA sequence from clone RP11-74N20 on chromosome 1 Contains the 5' end of the NMNAT2 gene for nicotinamide nucleotide adenylyltransferase 2, a novel transcript, the 5' end of the C1orf16 gene for chromosome 1 open reading frame 16 and a CpG island, complete sequence Length = 171467 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 167521 gcggcggcggcggcggaggat 167541
>gb|AC105364.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete sequence Length = 146568 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 13769 gcggcggcggcggcggaggat 13749
>dbj|AK091477.1| Homo sapiens cDNA FLJ34158 fis, clone FCBBF3013589, weakly similar to GLUTENIN, LOW MOLECULAR WEIGHT SUBUNIT PRECURSOR Length = 2483 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 101 gcggcggcggcggcggaggat 121
>dbj|AK056035.1| Homo sapiens cDNA FLJ31473 fis, clone NT2NE2001530 Length = 2517 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 101 gcggcggcggcggcggaggat 121
>dbj|AB220969.1| Ipomoea nil FE gene for KANADI-like transcription factor FEATHERED, complete cds Length = 5221 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 1355 tgcggcggcggcggcggagga 1335
>dbj|AB220968.1| Ipomoea nil FE mRNA for KANADI-like transcription factor FEATHERED, complete cds Length = 1894 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 955 tgcggcggcggcggcggagga 935
>ref|NM_173156.1| Homo sapiens Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7), transcript variant 1, mRNA Length = 5846 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 104 gcggcggcggcggcggaggat 124
>ref|NM_201569.1| Homo sapiens Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7), transcript variant 4, mRNA Length = 5676 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 104 gcggcggcggcggcggaggat 124
>ref|NM_201568.1| Homo sapiens Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7), transcript variant 2, mRNA Length = 5708 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 104 gcggcggcggcggcggaggat 124
>ref|NM_014837.3| Homo sapiens Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7), transcript variant 3, mRNA Length = 5648 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 104 gcggcggcggcggcggaggat 124
>gb|AC025296.10| Oryza sativa chromosome 10 BAC OSJNBa0076F20 genomic sequence, complete sequence Length = 165394 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 39479 tgcggcggcggcggcggagga 39499
>gb|AC116369.5| Oryza sativa chromosome 3 BAC OSJNBb0113I20 genomic sequence, complete sequence Length = 122939 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 68803 gcggcggcggcggcggaggat 68823
>gb|DQ060845.1| Clanis bilineata nucleopolyhedrosis virus polyhedrin gene, complete cds Length = 2200 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 242 caaattgcggcggcggcggcggagg 266 ||||||||||||| ||||||||||| Sbjct: 2011 caaattgcggcggtggcggcggagg 2035
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 20920643 gcggcggcggcggcggaggat 20920623 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 11146254 tgcggcggcggcggcggagga 11146234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 7021636 gcggcggcggcggcggaggat 7021616 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 25814820 gcggcggcggcggcggagga 25814839 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24271818 gcggcggcggcggcggagga 24271799 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22819347 gcggcggcggcggcggagga 22819328 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22776334 gcggcggcggcggcggagga 22776353 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22568249 gcggcggcggcggcggagga 22568268 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21734255 gcggcggcggcggcggagga 21734236 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19605705 gcggcggcggcggcggagga 19605686 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19554072 gcggcggcggcggcggagga 19554053 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19184292 gcggcggcggcggcggagga 19184311 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17972302 tgcggcggcggcggcggagg 17972321 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17580259 tgcggcggcggcggcggagg 17580278 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15887893 gcggcggcggcggcggagga 15887874 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14468447 gcggcggcggcggcggagga 14468466 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 13701507 gcggcggcggcggcggagga 13701526 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 8826058 tgcggcggcggcggcggagg 8826039 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 7429608 gcggcggcggcggcggagga 7429589 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 6725944 tgcggcggcggcggcggagg 6725925 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 4908828 tgcggcggcggcggcggagg 4908809 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3966502 gcggcggcggcggcggagga 3966521 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3742929 gcggcggcggcggcggagga 3742948 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 3496012 tgcggcggcggcggcggagg 3495993 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2761896 gcggcggcggcggcggagga 2761877
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 23077525 gcggcggcggcggcggaggat 23077505 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 18993164 gcggcggcggcggcggaggat 18993144 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 16628357 gcggcggcggcggcggaggat 16628377 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23797424 gcggcggcggcggcggagga 23797443 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23360043 gcggcggcggcggcggagga 23360062 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22573294 gcggcggcggcggcggagga 22573275 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21324607 gcggcggcggcggcggagga 21324626 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21159459 gcggcggcggcggcggagga 21159440 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18417587 gcggcggcggcggcggagga 18417568 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16330237 gcggcggcggcggcggagga 16330256 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15675064 gcggcggcggcggcggagga 15675083 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4869985 gcggcggcggcggcggagga 4870004 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4709077 gcggcggcggcggcggagga 4709058 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3703535 gcggcggcggcggcggagga 3703554 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 3017282 tgcggcggcggcggcggagg 3017301 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1647258 gcggcggcggcggcggagga 1647239
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 28166134 tgcggcggcggcggcggagga 28166114 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 12040656 gcggcggcggcggcggaggat 12040636 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 30653444 gcggcggcggcggcggagga 30653425 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 29823207 gcggcggcggcggcggagga 29823226 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27498565 gcggcggcggcggcggagga 27498584 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27349952 gcggcggcggcggcggagga 27349933 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 27225313 gcggcggcggcggcggagga 27225332 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24715365 gcggcggcggcggcggagga 24715346 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23491019 gcggcggcggcggcggagga 23491038 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 19073823 tgcggcggcggcggcggagg 19073842 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18996550 gcggcggcggcggcggagga 18996531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 12168692 gcggcggcggcggcggagga 12168711 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 8052536 gcggcggcggcggcggagga 8052555 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 8045843 gcggcggcggcggcggagga 8045862 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 6258406 gcggcggcggcggcggagga 6258387 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5533527 gcggcggcggcggcggagga 5533546 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5359168 gcggcggcggcggcggagga 5359187 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 5228490 gcggcggcggcggcggagga 5228471 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 4395554 cggcggcggcggcggaggat 4395573 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4203358 gcggcggcggcggcggagga 4203339 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4098856 gcggcggcggcggcggagga 4098837 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2581930 gcggcggcggcggcggagga 2581949
>gb|AC125471.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0042J17, complete sequence Length = 171442 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 100996 gcggcggcggcggcggaggat 101016
>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0592G05 Length = 146220 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 133410 tgcggcggcggcggcggagga 133430
>dbj|AP004331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0085D07 Length = 172483 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 ggcggcggcggcggaggatcg 270 ||||||||||||||||||||| Sbjct: 135254 ggcggcggcggcggaggatcg 135234
>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1033B05 Length = 138882 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 43793 tgcggcggcggcggcggagga 43813
>gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genomic sequence, complete sequence Length = 171376 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 106410 tgcggcggcggcggcggagga 106430
>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024O21, complete sequence Length = 155651 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 146851 gcggcggcggcggcggaggat 146831
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0478H03 Length = 167560 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 59258 gcggcggcggcggcggaggat 59238
>dbj|AP003347.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0445E10 Length = 145912 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 108745 gcggcggcggcggcggaggat 108725
>dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0038F12 Length = 190014 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 121275 tgcggcggcggcggcggagga 121295
>dbj|AP005113.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0685G12 Length = 149155 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtcc 273 |||||||||||||||||| |||||| Sbjct: 9489 cggcggcggcggcggaggctcgtcc 9465
>dbj|AP003607.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0004A09 Length = 158826 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 122406 tgcggcggcggcggcggagga 122426
>dbj|AP005968.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1156C07 Length = 182153 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 89519 gcggcggcggcggcggaggat 89499
>dbj|AP003766.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0009H10 Length = 175754 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 97040 tgcggcggcggcggcggagga 97020
>dbj|AP005052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0654B04 Length = 156907 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtcc 273 |||||||||||||||||| |||||| Sbjct: 130168 cggcggcggcggcggaggctcgtcc 130144
>dbj|AP005830.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1120F06 Length = 186712 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 243 aaattgcggcggcggcggcgg 263 ||||||||||||||||||||| Sbjct: 70258 aaattgcggcggcggcggcgg 70278
>dbj|AP005258.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0446G09 Length = 146898 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 243 aaattgcggcggcggcggcgg 263 ||||||||||||||||||||| Sbjct: 116120 aaattgcggcggcggcggcgg 116140
>dbj|AP005171.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0081K20 Length = 117287 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 80475 gcggcggcggcggcggaggat 80455
>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461D06 Length = 112895 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 79782 tgcggcggcggcggcggagga 79762
>dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1371_D04 Length = 105468 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 41767 tgcggcggcggcggcggagga 41787
>dbj|AP004787.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0403C01 Length = 145635 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 9066 tgcggcggcggcggcggagga 9086
>dbj|AP005817.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1118_F01 Length = 119248 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 45466 tgcggcggcggcggcggagga 45486
>dbj|AK119646.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G06, full insert sequence Length = 1497 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 366 gcggcggcggcggcggaggat 346
>dbj|AK111695.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007A04, full insert sequence Length = 3108 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 219 gcggcggcggcggcggaggat 239
>dbj|AK111688.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170G06, full insert sequence Length = 3994 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 305 gcggcggcggcggcggaggat 325
>dbj|AP004636.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0685B10 Length = 148544 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 105512 tgcggcggcggcggcggagga 105492
>dbj|AK074297.1| Homo sapiens cDNA FLJ23717 fis, clone HEP13634 Length = 2520 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 89 gcggcggcggcggcggaggat 109
>dbj|AP003957.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1470_H06 Length = 62794 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 34084 gcggcggcggcggcggaggat 34064
>dbj|AK109881.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-C12, full insert sequence Length = 1806 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 28 gcggcggcggcggcggaggat 8
>dbj|AK108256.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-A09, full insert sequence Length = 1070 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 359 tgcggcggcggcggcggagga 339
>emb|AJ339466.1|HSA339466 Homo sapiens genomic sequence surrounding NotI site, clone NR5-HH9RS Length = 734 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 77 gcggcggcggcggcggaggat 97
>dbj|AK106443.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-D12, full insert sequence Length = 2781 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 107 tgcggcggcggcggcggagga 87
>emb|AJ340874.1|HSA340874 Homo sapiens genomic sequence surrounding NotI site, clone NR5-CL10RS Length = 686 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 78 gcggcggcggcggcggaggat 98
>emb|AJ341235.1|HSA341235 Homo sapiens genomic sequence surrounding NotI site, clone NR1-NF17RS Length = 676 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 77 gcggcggcggcggcggaggat 97
>dbj|AK105260.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-A01, full insert sequence Length = 1537 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 332 gcggcggcggcggcggaggat 312
>emb|AJ333100.1|HSA333100 Homo sapiens genomic sequence surrounding NotI site, clone NR5-KK18RS Length = 910 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 77 gcggcggcggcggcggaggat 97
>emb|AJ341074.1|HSA341074 Homo sapiens genomic sequence surrounding NotI site, clone NR1-WO12RS Length = 906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 77 gcggcggcggcggcggaggat 97
>dbj|AK103909.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033150O13, full insert sequence Length = 1434 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 130 gcggcggcggcggcggaggat 150
>dbj|AK103549.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132F01, full insert sequence Length = 2247 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 51 gcggcggcggcggcggaggat 71
>dbj|AK103388.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033127I24, full insert sequence Length = 1883 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 29 gcggcggcggcggcggaggat 9
>dbj|AK073525.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046F01, full insert sequence Length = 1962 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 75 gcggcggcggcggcggaggat 55
>dbj|AK072024.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100E02, full insert sequence Length = 1830 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 142 tgcggcggcggcggcggagga 162
>dbj|AK071015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081E02, full insert sequence Length = 1957 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 1523 gcggcggcggcggcggaggat 1503
>dbj|AK068346.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013148O22, full insert sequence Length = 2405 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 71 tgcggcggcggcggcggagga 51
>dbj|AK067056.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013088M21, full insert sequence Length = 1294 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 323 tgcggcggcggcggcggagga 343
>dbj|AK065847.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013042H05, full insert sequence Length = 1886 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 139 tgcggcggcggcggcggagga 159
>dbj|AK059055.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-F02, full insert sequence Length = 1418 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 110 tgcggcggcggcggcggagga 90
>dbj|AP004273.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0431A02 Length = 165038 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 29082 gcggcggcggcggcggaggat 29062
>dbj|AB085674.1| Homo sapiens mRNA for SMG-7, SMG-7 transcript variant 2, complete cds Length = 5732 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 45 gcggcggcggcggcggaggat 65
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 23387435 gcggcggcggcggcggaggat 23387415 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 19151813 gcggcggcggcggcggaggat 19151793 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 16707409 gcggcggcggcggcggaggat 16707429 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24109093 gcggcggcggcggcggagga 24109112 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 23669953 gcggcggcggcggcggagga 23669972 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22883205 gcggcggcggcggcggagga 22883186 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21634806 gcggcggcggcggcggagga 21634825 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21469700 gcggcggcggcggcggagga 21469681 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 18576988 gcggcggcggcggcggagga 18576969 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 16420216 gcggcggcggcggcggagga 16420235 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15762441 gcggcggcggcggcggagga 15762460 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4888769 gcggcggcggcggcggagga 4888788 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4727861 gcggcggcggcggcggagga 4727842 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3712229 gcggcggcggcggcggagga 3712248 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 3026313 tgcggcggcggcggcggagg 3026332 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1644979 gcggcggcggcggcggagga 1644960
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 20846857 gcggcggcggcggcggaggat 20846837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 11145953 tgcggcggcggcggcggagga 11145933 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 7021515 gcggcggcggcggcggaggat 7021495 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 25742996 gcggcggcggcggcggagga 25743015 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 24200024 gcggcggcggcggcggagga 24200005 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22747538 gcggcggcggcggcggagga 22747519 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22704525 gcggcggcggcggcggagga 22704544 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 22496594 gcggcggcggcggcggagga 22496613 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 21662600 gcggcggcggcggcggagga 21662581 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19531919 gcggcggcggcggcggagga 19531900 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19480285 gcggcggcggcggcggagga 19480266 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 19110519 gcggcggcggcggcggagga 19110538 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17898621 tgcggcggcggcggcggagg 17898640 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 17534630 tgcggcggcggcggcggagg 17534649 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15841126 gcggcggcggcggcggagga 15841107 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14422731 gcggcggcggcggcggagga 14422750 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 13655781 gcggcggcggcggcggagga 13655800 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 8825941 tgcggcggcggcggcggagg 8825922 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 7429487 gcggcggcggcggcggagga 7429468 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 6725819 tgcggcggcggcggcggagg 6725800 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 4908810 tgcggcggcggcggcggagg 4908791 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3966476 gcggcggcggcggcggagga 3966495 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3742903 gcggcggcggcggcggagga 3742922 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 3495957 tgcggcggcggcggcggagg 3495938 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2761840 gcggcggcggcggcggagga 2761821
>emb|AL831796.5|CNS08CA9 Oryza sativa chromosome 12, . BAC OSJNBa0012G19 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157771 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 39921 tgcggcggcggcggcggagga 39941
>emb|AL732533.4|CNS08C98 Oryza sativa chromosome 12, . BAC OSJNBa0084K07 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 147611 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 58577 gcggcggcggcggcggaggat 58597
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 6133 gcggcggcggcggcggaggat 6113
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 38352 gcggcggcggcggcggaggat 38372
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagga 267 ||||||||||||||||||||| Sbjct: 25509 tgcggcggcggcggcggagga 25489
>dbj|D87437.2| Human mRNA for KIAA0250 gene, partial cds Length = 5623 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggaggat 268 ||||||||||||||||||||| Sbjct: 76 gcggcggcggcggcggaggat 96
>gb|AY308814.1| Canis familiaris homeobox A11 gene, partial sequence Length = 383 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 240 gcggcggcggcggcggagga 259
>ref|XM_476097.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 834 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 754 gcggcggcggcggcggagga 773
>ref|XM_476065.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 936 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 28 gcggcggcggcggcggagga 47
>ref|XM_476055.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 579 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 492 tgcggcggcggcggcggagg 473
>ref|NM_001036861.1| Arabidopsis thaliana KNAT3 (KNOTTED1-LIKE HOMEOBOX GENE 3) AT5G25220 (KNAT3) transcript variant AT5G25220.2 mRNA, complete cds Length = 1891 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 397 gcggcggcggcggcggagga 378
>ref|NM_122431.2| Arabidopsis thaliana KNAT3 (KNOTTED1-LIKE HOMEOBOX GENE 3); transcription factor AT5G25220 (KNAT3) transcript variant AT5G25220.1 mRNA, complete cds Length = 1899 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 397 gcggcggcggcggcggagga 378
>gb|BC019835.1| Homo sapiens Notch homolog 2 (Drosophila) N-terminal like, mRNA (cDNA clone IMAGE:4155767), complete cds Length = 1110 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 190 gcggcggcggcggcggagga 209
>gb|AY722405.1| Drosophila yakuba paired-type homeodomain protein (unc-4) mRNA, partial cds Length = 1074 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 488 gcggcggcggcggcggagga 507
>gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, complete sequence Length = 149493 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 2972 gcggcggcggcggcggagga 2953
>gb|AY512658.1| Homo sapiens N-cadherin gene, promoter region and 5' UTR Length = 3681 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 3653 gcggcggcggcggcggagga 3634
>ref|XM_550264.1| Oryza sativa (japonica cultivar-group), mRNA Length = 378 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 374 tgcggcggcggcggcggagg 355
>ref|XM_550108.1| Oryza sativa (japonica cultivar-group), mRNA Length = 962 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 219 gcggcggcggcggcggagga 238
>ref|NM_187882.1| Oryza sativa (japonica cultivar-group), Ozsa8324 predicted mRNA Length = 1320 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 152 gcggcggcggcggcggagga 171
>ref|NM_188105.1| Oryza sativa (japonica cultivar-group), Ozsa8537 predicted mRNA Length = 1089 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 914 tgcggcggcggcggcggagg 895
>ref|XM_462831.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 744 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 110 gcggcggcggcggcggagga 129
>ref|NM_184519.2| Oryza sativa (japonica cultivar-group), mRNA Length = 983 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 352 gcggcggcggcggcggagga 371
>ref|NM_188268.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 915 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 367 gcggcggcggcggcggagga 386
>gb|AC136520.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017O06, complete sequence Length = 151656 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 14570 gcggcggcggcggcggagga 14551
>ref|XM_468656.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1384 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 663 gcggcggcggcggcggagga 682
>ref|XM_468655.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1091 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 370 gcggcggcggcggcggagga 389
>ref|XM_493824.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 816 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 479 gcggcggcggcggcggagga 498
>ref|XM_481907.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2375 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 685 gcggcggcggcggcggagga 704
>ref|XM_481845.1| Oryza sativa (japonica cultivar-group), mRNA Length = 540 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 322 gcggcggcggcggcggagga 341
>ref|XM_481801.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1644 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 399 gcggcggcggcggcggagga 418 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 108 gcggcggcggcggcggagga 89
>ref|XM_481319.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2421 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 83 gcggcggcggcggcggagga 64
>ref|XM_483748.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1139 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 337 tgcggcggcggcggcggagg 356
>ref|XM_483462.1| Oryza sativa (japonica cultivar-group), mRNA Length = 543 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 476 gcggcggcggcggcggagga 457
>ref|XM_483427.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1956 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 302 gcggcggcggcggcggagga 283
>ref|XM_483162.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2350 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gcggcggcggcggaggatcg 270 |||||||||||||||||||| Sbjct: 343 gcggcggcggcggaggatcg 362
>ref|XM_483147.1| Oryza sativa (japonica cultivar-group), mRNA Length = 465 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 230 gcggcggcggcggcggagga 249
>ref|XM_507250.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1117_F10.6 mRNA Length = 3919 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 581 gcggcggcggcggcggagga 562
>ref|XM_482709.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1029 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 142 gcggcggcggcggcggagga 161
>ref|XM_482551.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1806 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 62 gcggcggcggcggcggagga 43
>ref|XM_482451.1| Oryza sativa (japonica cultivar-group), mRNA Length = 669 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggatcgtc 272 ||||||||||||||| |||||||| Sbjct: 144 cggcggcggcggcgggggatcgtc 121
>ref|XM_481640.1| Oryza sativa (japonica cultivar-group), mRNA Length = 606 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 245 attgcggcggcggcggcggaggat 268 ||||||||||||||||||| |||| Sbjct: 317 attgcggcggcggcggcggcggat 340
>ref|XM_480992.1| Oryza sativa (japonica cultivar-group), mRNA Length = 498 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 200 gcggcggcggcggcggagga 181
>ref|XM_480953.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2850 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 157 gcggcggcggcggcggagga 138
>ref|XM_475515.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 651 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 71 gcggcggcggcggcggagga 52
>ref|XM_480565.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1312 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 470 gcggcggcggcggcggagga 451
>ref|XM_474463.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1434 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1291 gcggcggcggcggcggagga 1310
>ref|XM_480161.1| Oryza sativa (japonica cultivar-group), mRNA Length = 369 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 70 gcggcggcggcggcggagga 89
>ref|XM_480145.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 515 gcggcggcggcggcggagga 534
>ref|XM_475421.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 570 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 236 gcggcggcggcggcggagga 255
>ref|XM_474696.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1767 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 313 gcggcggcggcggcggagga 332
>ref|XM_474222.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 531 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 98 gcggcggcggcggcggagga 79
>ref|XM_474192.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1866 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 620 gcggcggcggcggcggagga 601
>ref|XM_471560.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2922 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 212 gcggcggcggcggcggagga 231
>ref|XM_470043.1| Oryza sativa (japonica cultivar-group), mRNA Length = 903 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 803 gcggcggcggcggcggagga 822
>ref|XM_469116.1| Oryza sativa (japonica cultivar-group), mRNA Length = 645 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 478 tgcggcggcggcggcggagg 497
>ref|XM_468587.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 169 gcggcggcggcggcggagga 188
>ref|XM_469073.1| Oryza sativa (japonica cultivar-group), mRNA Length = 924 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 655 gcggcggcggcggcggagga 674
>ref|XM_468470.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1035 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 937 gcggcggcggcggcggagga 918
>ref|XM_467667.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2072 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 127 gcggcggcggcggcggagga 108
>ref|XM_467588.1| Oryza sativa (japonica cultivar-group), mRNA Length = 552 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 4 gcggcggcggcggcggagga 23
>gb|DQ216325.1| Taeniopygia guttata clone 0061P0017H11 ARM-1 protein variant 5-like mRNA, complete sequence Length = 1413 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 15 gcggcggcggcggcggagga 34
>ref|XM_466656.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1399 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 245 gcggcggcggcggcggagga 226
>ref|XM_506859.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0030C08.39 mRNA Length = 1432 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 211 gcggcggcggcggcggagga 192
>ref|XM_464682.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1001 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 118 gcggcggcggcggcggagga 137
>ref|XM_507465.1| PREDICTED Oryza sativa (japonica cultivar-group), P0027A02.30 mRNA Length = 1030 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 145 gcggcggcggcggcggagga 164
>ref|XM_466427.1| Oryza sativa (japonica cultivar-group), mRNA Length = 435 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 130 gcggcggcggcggcggagga 149
>ref|XM_507464.1| PREDICTED Oryza sativa (japonica cultivar-group), P0027A02.30 mRNA Length = 1031 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 146 gcggcggcggcggcggagga 165
>ref|XM_506760.2| PREDICTED Oryza sativa (japonica cultivar-group), P0027A02.30 mRNA Length = 1031 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 146 gcggcggcggcggcggagga 165
>ref|XM_506824.1| PREDICTED Oryza sativa (japonica cultivar-group), P0470G10.34 mRNA Length = 2410 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1952 gcggcggcggcggcggagga 1933
>ref|XM_466201.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2240 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1854 gcggcggcggcggcggagga 1835
>ref|XM_466454.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1009 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 417 gcggcggcggcggcggagga 436
>ref|XM_465549.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1888 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 296 gcggcggcggcggcggagga 277
>ref|XM_464216.1| Oryza sativa (japonica cultivar-group), mRNA Length = 861 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 298 gcggcggcggcggcggagga 317
>ref|XM_464425.1| Oryza sativa (japonica cultivar-group), mRNA Length = 210 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 41 gcggcggcggcggcggagga 60
>ref|XM_464424.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2180 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 92 gcggcggcggcggcggagga 73
>ref|XM_464178.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2489 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 74 gcggcggcggcggcggagga 55
>ref|XM_464087.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1527 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 275 gcggcggcggcggcggagga 294
>ref|XM_462679.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1545 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 418 tgcggcggcggcggcggagg 437
>ref|XM_450612.1| Oryza sativa (japonica cultivar-group), mRNA Length = 198 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 70 gcggcggcggcggcggagga 89
>ref|XM_450590.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1369 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 350 gcggcggcggcggcggagga 331
>ref|XM_450276.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2211 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 129 gcggcggcggcggcggagga 110
>ref|NM_197150.1| Oryza sativa (japonica cultivar-group) putative ABC transporter (OSJNBa0041P03.4), mRNA Length = 2284 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 233 gcggcggcggcggcggagga 252
>ref|NM_183989.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2013 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1703 gcggcggcggcggcggagga 1722
>ref|NM_196731.1| Oryza sativa (japonica cultivar-group) putative AP2-domain DNA-binding protein (OSJNBa0094K20.6), mRNA Length = 807 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 61 gcggcggcggcggcggagga 80
>ref|NM_190668.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1359 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 909 tgcggcggcggcggcggagg 928
>gb|AC116815.15| Mus musculus chromosome 5, clone RP24-357H22, complete sequence Length = 179737 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 10597 gcggcggcggcggcggagga 10578
>ref|NM_191481.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1266 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 7 gcggcggcggcggcggagga 26
>ref|NM_192170.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1614 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 37 gcggcggcggcggcggagga 18
>ref|NM_005654.4| Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F1), mRNA Length = 3210 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1000 gcggcggcggcggcggagga 981
>ref|NM_191421.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 732 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 83 gcggcggcggcggcggagga 64
>ref|NM_192566.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1620 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1538 gcggcggcggcggcggagga 1557
>gb|BT017014.1| Zea mays clone EK07D2311D11.c mRNA sequence Length = 682 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 153 cggcggcggcggcggaggat 134
>ref|XM_478049.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1305 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 167 gcggcggcggcggcggagga 186
>ref|NM_205114.1| Gallus gallus slow muscle troponin T (LOC396009), mRNA Length = 898 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 99 gcggcggcggcggcggagga 118
>ref|XM_468765.1| Oryza sativa (japonica cultivar-group), mRNA Length = 765 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 656 gcggcggcggcggcggagga 637
>ref|NM_186039.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1238 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 43 gcggcggcggcggcggagga 24
>ref|XM_479250.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1297 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 186 gcggcggcggcggcggagga 167
>ref|NM_193096.1| Oryza sativa (japonica cultivar-group), mRNA Length = 648 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 508 gcggcggcggcggcggagga 489
>ref|XM_479034.1| Oryza sativa (japonica cultivar-group), mRNA Length = 776 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 226 gcggcggcggcggcggagga 245
>ref|XM_525706.1| PREDICTED: Pan troglodytes LOC470324 (LOC470324), mRNA Length = 15741 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1004 gcggcggcggcggcggagga 1023
>ref|XM_478424.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2115 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 11 gcggcggcggcggcggagga 30
>ref|XM_478397.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1617 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 70 gcggcggcggcggcggagga 89
>ref|XM_477826.1| Oryza sativa (japonica cultivar-group), mRNA Length = 771 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 89 gcggcggcggcggcggagga 70
>gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V, containing KNAT3 and mapping near 60.5 cM, complete sequence Length = 110680 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 72757 gcggcggcggcggcggagga 72738
>ref|XM_476971.1| Oryza sativa (japonica cultivar-group), mRNA Length = 507 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cggcggcggcggcggaggat 268 |||||||||||||||||||| Sbjct: 308 cggcggcggcggcggaggat 327
>ref|XM_530160.1| PREDICTED: Pan troglodytes LOC457174 (LOC457174), mRNA Length = 1115 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 717 gcggcggcggcggcggagga 736
>ref|XM_476684.1| Oryza sativa (japonica cultivar-group), mRNA Length = 579 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 76 gcggcggcggcggcggagga 95
>ref|XM_473527.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2592 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 176 gcggcggcggcggcggagga 157
>ref|XM_473734.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1545 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 418 tgcggcggcggcggcggagg 437
>ref|XM_473062.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1152 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 145 gcggcggcggcggcggagga 164
>ref|XM_472858.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1182 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 694 gcggcggcggcggcggagga 713
>ref|XM_472288.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 594 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 161 gcggcggcggcggcggagga 142
>ref|XM_472239.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2403 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 tgcggcggcggcggcggagg 266 |||||||||||||||||||| Sbjct: 18 tgcggcggcggcggcggagg 37
>ref|XM_470862.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1176 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 158 gcggcggcggcggcggagga 139
>ref|XM_470725.1| Oryza sativa (japonica cultivar-group), mRNA Length = 654 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 68 gcggcggcggcggcggagga 87
>ref|NM_184593.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1224 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 269 gcggcggcggcggcggagga 250
>gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete sequence Length = 143130 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 70864 gcggcggcggcggcggagga 70883
>gb|AC134928.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1164G01, complete sequence Length = 151938 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 1485 gcggcggcggcggcggagga 1466
>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete sequence Length = 143400 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 105298 gcggcggcggcggcggagga 105279 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 37340 gcggcggcggcggcggagga 37321
>gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015F11, complete sequence Length = 177574 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 171919 gcggcggcggcggcggagga 171900
>gb|AC136221.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0077J17, complete sequence Length = 141598 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 106312 gcggcggcggcggcggagga 106331 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 105989 gcggcggcggcggcggagga 105970
>gb|AC099404.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0019D02, complete sequence Length = 154692 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 20011 gcggcggcggcggcggagga 20030
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence Length = 384518 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 222398 gcggcggcggcggcggagga 222417
>gb|BT017933.1| Zea mays clone EL01N0520D05.c mRNA sequence Length = 808 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 39 gcggcggcggcggcggagga 20
>gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence Length = 424 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 attgcggcggcggcggcgga 264 |||||||||||||||||||| Sbjct: 12 attgcggcggcggcggcgga 31
>gb|AC135927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B02, complete sequence Length = 146435 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 47977 gcggcggcggcggcggagga 47958
>gb|AC093088.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1001_G01, complete sequence Length = 122768 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 gcggcggcggcggcggagga 267 |||||||||||||||||||| Sbjct: 96180 gcggcggcggcggcggagga 96199 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,392,000 Number of Sequences: 3902068 Number of extensions: 4392000 Number of successful extensions: 301044 Number of sequences better than 10.0: 906 Number of HSP's better than 10.0 without gapping: 984 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 240808 Number of HSP's gapped (non-prelim): 60183 length of query: 488 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 466 effective length of database: 17,147,199,772 effective search space: 7990595093752 effective search space used: 7990595093752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)