ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl20b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC139186.4| Mus musculus BAC clone RP24-92D20 from 8, complet... 44 0.40
2gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complet... 44 0.40
3gb|AC142352.1| Pan troglodytes BAC clone RP43-21K18 from 7, comp... 42 1.6
4emb|AJ308252.1|UFA308252 Uromyces fabae AAT1 gene for amino acid... 42 1.6
5emb|Y09231.1|PBCHS2 Paracoccidioides brasiliensis CHS2 gene 42 1.6
6gb|AY842481.1| Homo sapiens growth associated protein 43 (GAP43)... 40 6.2
7gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome... 40 6.2
8ref|XM_607234.2| PREDICTED: Bos taurus similar to zinc finger pr... 40 6.2
9ref|XM_822016.1| Trypanosoma brucei TREU927 hypothetical protein... 40 6.2
10gb|AC146272.3| Pan troglodytes BAC clone RP43-29H6 from 7, compl... 40 6.2
11gb|AC122794.3| Mus musculus BAC clone RP24-202L5 from chromosome... 40 6.2
12gb|AC121921.2| Mus musculus BAC clone RP24-198H8 from 9, complet... 40 6.2
13emb|AL590638.6| Human DNA sequence from clone RP11-231A18 on chr... 40 6.2
14gb|AC162917.3| Mus musculus BAC clone RP23-379N7 from chromosome... 40 6.2
15gb|AC092468.9| Homo sapiens 3 BAC RP11-326J18 (Roswell Park Canc... 40 6.2
16gb|AC015656.9| Homo sapiens, clone RP11-81K2, complete sequence 40 6.2
17gb|AC091180.20| Homo sapiens chromosome 17, clone RP11-1079K10, ... 40 6.2
18gb|AY661366.1| Pteroglossus torquatus isolate Pto3778 cytochrome... 40 6.2
19gb|AY661365.1| Pteroglossus torquatus isolate Pto26569 cytochrom... 40 6.2
20gb|AY661364.1| Pteroglossus torquatus isolate Pto16076 cytochrom... 40 6.2
21gb|AY661363.1| Pteroglossus torquatus isolate Pto16075 cytochrom... 40 6.2
22gb|AY661362.1| Pteroglossus sanguineus isolate Psa2403 cytochrom... 40 6.2
23gb|AY661361.1| Pteroglossus sanguineus isolate Psa2387 cytochrom... 40 6.2
24gb|AY661358.1| Pteroglossus mariae isolate Pma749 cytochrome oxi... 40 6.2
25gb|AY661357.1| Pteroglossus mariae isolate Pma726 cytochrome oxi... 40 6.2
26gb|AY661350.1| Pteroglossus flavirostris isolate Pfl4478 cytochr... 40 6.2
27gb|AY661349.1| Pteroglossus flavirostris isolate Pfl27737 cytoch... 40 6.2
28gb|AY661348.1| Pteroglossus flavirostris isolate Pfl2620 cytochr... 40 6.2
29gb|AY661347.1| Pteroglossus erythropygius isolate Per3582 cytoch... 40 6.2
30gb|AY661345.1| Pteroglossus bitorquatus isolate Pbt31 cytochrome... 40 6.2
31gb|AY661344.1| Pteroglossus bitorquatus isolate Pbt21 cytochrome... 40 6.2
32gb|AY661343.1| Pteroglossus beauharnaesii isolate Pbe9295 cytoch... 40 6.2
33gb|AY661342.1| Pteroglossus beauharnaesii isolate Pbe4950 cytoch... 40 6.2
34gb|AY661340.1| Pteroglossus aracari isolate Par7570 cytochrome o... 40 6.2
35gb|AC161052.2| Mus musculus BAC clone RP23-393J15 from chromosom... 40 6.2
36gb|AC154909.4| Mus musculus BAC clone RP23-185B22 from chromosom... 40 6.2
37gb|AY940789.1| Pteroglossus flavirostris cytochrome oxidase subu... 40 6.2
38dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.2
39gb|AC116688.14| Mus musculus chromosome 17, clone RP24-169A20, c... 40 6.2
40emb|CT030230.13| Mouse DNA sequence from clone RP23-392N1 on chr... 40 6.2

>gb|AC139186.4| Mus musculus BAC clone RP24-92D20 from 8, complete sequence
          Length = 206436

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 385  ccctcagtcccacctggatttg 406
            ||||||||||||||||||||||
Sbjct: 5821 ccctcagtcccacctggatttg 5842



to top

>gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complete sequence
          Length = 234976

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 385  ccctcagtcccacctggatttg 406
            ||||||||||||||||||||||
Sbjct: 8790 ccctcagtcccacctggatttg 8769



to top

>gb|AC142352.1| Pan troglodytes BAC clone RP43-21K18 from 7, complete sequence
          Length = 171165

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 182    tttccttccctttcctccccg 202
              |||||||||||||||||||||
Sbjct: 103724 tttccttccctttcctccccg 103744



to top

>emb|AJ308252.1|UFA308252 Uromyces fabae AAT1 gene for amino acid transporter, exons 1-18
          Length = 4694

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 401  gatttggaccgccacctgaat 421
            |||||||||||||||||||||
Sbjct: 2558 gatttggaccgccacctgaat 2538



to top

>emb|Y09231.1|PBCHS2 Paracoccidioides brasiliensis CHS2 gene
          Length = 4826

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 201 cggattcggcatcctcaccatcatc 225
           |||||||| ||||||||||||||||
Sbjct: 834 cggattcgtcatcctcaccatcatc 810



to top

>gb|AY842481.1| Homo sapiens growth associated protein 43 (GAP43) gene, complete cds
          Length = 100848

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 50219 tttccttccctttcctcccc 50238



to top

>gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome 8, complete sequence
          Length = 212727

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    tttccttccctttcctcccc 201
              ||||||||||||||||||||
Sbjct: 198116 tttccttccctttcctcccc 198135



to top

>ref|XM_607234.2| PREDICTED: Bos taurus similar to zinc finger protein 419
           (LOC528802), mRNA
          Length = 1551

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 334 gtgatgatgggaacagagtg 353
           ||||||||||||||||||||
Sbjct: 52  gtgatgatgggaacagagtg 33



to top

>ref|XM_822016.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.5570)
           partial mRNA
          Length = 1728

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 175 ccgggggtttccttccctttcctc 198
           ||||||||||||||| ||||||||
Sbjct: 374 ccgggggtttccttcactttcctc 351



to top

>gb|AC146272.3| Pan troglodytes BAC clone RP43-29H6 from 7, complete sequence
          Length = 149408

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 81308 tttccttccctttcctcccc 81327



to top

>gb|AC122794.3| Mus musculus BAC clone RP24-202L5 from chromosome 8, complete sequence
          Length = 157120

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 98787 tttccttccctttcctcccc 98768



to top

>gb|AC121921.2| Mus musculus BAC clone RP24-198H8 from 9, complete sequence
          Length = 175965

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    tttccttccctttcctcccc 201
              ||||||||||||||||||||
Sbjct: 154813 tttccttccctttcctcccc 154794



to top

>emb|AL590638.6| Human DNA sequence from clone RP11-231A18 on chromosome 6, complete
             sequence
          Length = 55807

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 376   gatcctgaaccctcagtccc 395
             ||||||||||||||||||||
Sbjct: 41607 gatcctgaaccctcagtccc 41588



to top

>gb|AC162917.3| Mus musculus BAC clone RP23-379N7 from chromosome 9, complete sequence
          Length = 189606

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 77978 tttccttccctttcctcccc 77959



to top

>gb|AC092468.9| Homo sapiens 3 BAC RP11-326J18 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 114428

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  tttccttccctttcctcccc 201
            ||||||||||||||||||||
Sbjct: 3207 tttccttccctttcctcccc 3188



to top

>gb|AC015656.9| Homo sapiens, clone RP11-81K2, complete sequence
          Length = 147775

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    tttccttccctttcctcccc 201
              ||||||||||||||||||||
Sbjct: 132392 tttccttccctttcctcccc 132373



to top

>gb|AC091180.20| Homo sapiens chromosome 17, clone RP11-1079K10, complete sequence
          Length = 183690

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 84768 tttccttccctttcctcccc 84787



to top

>gb|AY661366.1| Pteroglossus torquatus isolate Pto3778 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661365.1| Pteroglossus torquatus isolate Pto26569 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661364.1| Pteroglossus torquatus isolate Pto16076 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661363.1| Pteroglossus torquatus isolate Pto16075 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661362.1| Pteroglossus sanguineus isolate Psa2403 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661361.1| Pteroglossus sanguineus isolate Psa2387 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661358.1| Pteroglossus mariae isolate Pma749 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661357.1| Pteroglossus mariae isolate Pma726 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661350.1| Pteroglossus flavirostris isolate Pfl4478 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661349.1| Pteroglossus flavirostris isolate Pfl27737 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661348.1| Pteroglossus flavirostris isolate Pfl2620 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661347.1| Pteroglossus erythropygius isolate Per3582 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661345.1| Pteroglossus bitorquatus isolate Pbt31 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661344.1| Pteroglossus bitorquatus isolate Pbt21 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661343.1| Pteroglossus beauharnaesii isolate Pbe9295 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 621

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 43  tcctccccggattcggcatc 62



to top

>gb|AY661342.1| Pteroglossus beauharnaesii isolate Pbe4950 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AY661340.1| Pteroglossus aracari isolate Par7570 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 622

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 44  tcctccccggattcggcatc 63



to top

>gb|AC161052.2| Mus musculus BAC clone RP23-393J15 from chromosome 12, complete
             sequence
          Length = 201284

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tttccttccctttcctcccc 201
             ||||||||||||||||||||
Sbjct: 27456 tttccttccctttcctcccc 27437



to top

>gb|AC154909.4| Mus musculus BAC clone RP23-185B22 from chromosome 8, complete sequence
          Length = 195479

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    tttccttccctttcctcccc 201
              ||||||||||||||||||||
Sbjct: 107010 tttccttccctttcctcccc 107029



to top

>gb|AY940789.1| Pteroglossus flavirostris cytochrome oxidase subunit I (COI) gene,
           partial cds; mitochondrial
          Length = 1512

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 tcctccccggattcggcatc 213
           ||||||||||||||||||||
Sbjct: 743 tcctccccggattcggcatc 762



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 85      ggcttcggatttgtggctgg 104
               ||||||||||||||||||||
Sbjct: 6430635 ggcttcggatttgtggctgg 6430616



to top

>gb|AC116688.14| Mus musculus chromosome 17, clone RP24-169A20, complete sequence
          Length = 150860

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   ggtttccttccctttcctcc 199
             ||||||||||||||||||||
Sbjct: 46124 ggtttccttccctttcctcc 46143



to top

>emb|CT030230.13| Mouse DNA sequence from clone RP23-392N1 on chromosome 17, complete
             sequence
          Length = 162981

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   ggtttccttccctttcctcc 199
             ||||||||||||||||||||
Sbjct: 95730 ggtttccttccctttcctcc 95749


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,765,232
Number of Sequences: 3902068
Number of extensions: 2765232
Number of successful extensions: 52734
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52674
Number of HSP's gapped (non-prelim): 60
length of query: 459
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 437
effective length of database: 17,147,199,772
effective search space: 7493326300364
effective search space used: 7493326300364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top