ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl20a08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC131748.3| Mus musculus BAC clone RP23-42A17 from 12, comple... 40 6.9
2gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.9
3gb|AC152059.4| Mus musculus BAC clone RP24-283B23 from chromosom... 40 6.9
4gb|DQ091784.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (... 40 6.9
5gb|DQ091783.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (... 40 6.9
6gb|DQ091782.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (... 40 6.9
7dbj|AB249784.1| Xenopus tropicalis DNA for bitter taste receptor... 40 6.9
8emb|AL583892.13| Mouse DNA sequence from clone RP23-32G7 on chro... 40 6.9

>gb|AC131748.3| Mus musculus BAC clone RP23-42A17 from 12, complete sequence
          Length = 215972

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 405   acatggcagcagccaaggct 424
             ||||||||||||||||||||
Sbjct: 50488 acatggcagcagccaaggct 50469



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 422     gctgcaaagcggcgtgcacc 441
               ||||||||||||||||||||
Sbjct: 2179436 gctgcaaagcggcgtgcacc 2179417



to top

>gb|AC152059.4| Mus musculus BAC clone RP24-283B23 from chromosome 12, complete sequence
          Length = 180085

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    acatggcagcagccaaggct 424
              ||||||||||||||||||||
Sbjct: 173168 acatggcagcagccaaggct 173149



to top

>gb|DQ091784.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (Onmy-UHA) gene,
           Onmy-UHA*0102 allele, exon 2 and partial cds
          Length = 236

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 249 acatggccactgcaagagat 268
           ||||||||||||||||||||
Sbjct: 203 acatggccactgcaagagat 222



to top

>gb|DQ091783.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (Onmy-UHA) gene,
           Onmy-UHA*0101 allele, exon 2 and partial cds
          Length = 236

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 249 acatggccactgcaagagat 268
           ||||||||||||||||||||
Sbjct: 203 acatggccactgcaagagat 222



to top

>gb|DQ091782.1| Oncorhynchus mykiss MHC class I alpha 1 antigen (Onmy-UHA) gene,
           Onmy-UHA*0103 allele, exon 2 and partial cds
          Length = 236

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 249 acatggccactgcaagagat 268
           ||||||||||||||||||||
Sbjct: 203 acatggccactgcaagagat 222



to top

>dbj|AB249784.1| Xenopus tropicalis DNA for bitter taste receptor, complete cds,
           clone: Xetr-T2R16
          Length = 966

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 439 accaccagccaagctgctat 458
           ||||||||||||||||||||
Sbjct: 608 accaccagccaagctgctat 589



to top

>emb|AL583892.13| Mouse DNA sequence from clone RP23-32G7 on chromosome 15, complete
              sequence
          Length = 216733

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 405    acatggcagcagccaaggct 424
              ||||||||||||||||||||
Sbjct: 141159 acatggcagcagccaaggct 141178


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,665,104
Number of Sequences: 3902068
Number of extensions: 2665104
Number of successful extensions: 67174
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67148
Number of HSP's gapped (non-prelim): 26
length of query: 509
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 487
effective length of database: 17,147,199,772
effective search space: 8350686288964
effective search space used: 8350686288964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top