ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl19f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
2dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.026
3dbj|AK065468.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.026
4gb|AC012404.9| Homo sapiens, clone RP11-39M21, complete sequence 44 0.41
5dbj|AP002748.4| Homo sapiens genomic DNA, chromosome 11 clone:CT... 44 0.41
6dbj|AP001157.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 44 0.41
7gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome ... 42 1.6
8gb|DQ127755.1| Emiliania huxleyi virus 163 clone new112.seq part... 42 1.6
9emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genom... 42 1.6
10emb|AJ890364.1| Emiliania huxleyi virus 86 isolate EhV86 42 1.6
11gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome... 40 6.4
12gb|AC122848.3| Mus musculus BAC clone RP23-166K13 from chromosom... 40 6.4
13gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome... 40 6.4
14gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome 40 6.4
15emb|AL359815.26| Human DNA sequence from clone RP11-63N8 on chro... 40 6.4
16gb|AF453339.1| Chamaerops humilis phosphoribulokinase-like prote... 40 6.4
17gb|AF453332.1| Ammandra decasperma phosphoribulokinase-like prot... 40 6.4
18gb|BC092530.1| Mus musculus potassium channel tetramerisation do... 40 6.4
19ref|NM_177791.2| Mus musculus potassium channel tetramerisation ... 40 6.4
20gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R... 40 6.4
21dbj|AK076644.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 6.4
22ref|XM_226403.3| PREDICTED: Rattus norvegicus similar to hypothe... 40 6.4
23gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.4
24dbj|AK202410.1| Mus musculus cDNA, clone:Y1G0141G20, strand:unsp... 40 6.4
25gb|AY348908.1| Areca rheophytica voucher WB1143 phosphoribulokin... 40 6.4
26gb|AC108826.9| Mus musculus chromosome 16, clone RP23-109P11, co... 40 6.4
27gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 6.4
28emb|AJ831361.1| Phytelephas aequatorialis partial prk gene for p... 40 6.4
29emb|AJ831359.1| Oraniopsis appendiculata partial prk gene for ph... 40 6.4
30emb|AJ831357.1| Nypa fruticans partial prk gene for phosphoribul... 40 6.4
31emb|AJ831349.1| Ceroxylon quindiuense partial prk gene for phosp... 40 6.4
32gb|AC151573.2| Mus musculus BAC clone RP23-410B24 from 8, comple... 40 6.4

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 377      ttcaagcctgccgacagctacctggttgactg 408
                |||||||||||||||| ||||||||| |||||
Sbjct: 13141306 ttcaagcctgccgacaactacctggtggactg 13141337



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 240      gaatgcccgccgcggggcgctccggtggac 269
                |||||||||||||| |||||||||| ||||
Sbjct: 13140160 gaatgcccgccgcgcggcgctccggcggac 13140189



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0012F14
          Length = 168629

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 377   ttcaagcctgccgacagctacctggttgactg 408
             |||||||||||||||| ||||||||| |||||
Sbjct: 58494 ttcaagcctgccgacaactacctggtggactg 58525



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 240   gaatgcccgccgcggggcgctccggtggac 269
             |||||||||||||| |||||||||| ||||
Sbjct: 57348 gaatgcccgccgcgcggcgctccggcggac 57377



to top

>dbj|AK065468.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013020G14, full
           insert sequence
          Length = 3151

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 377 ttcaagcctgccgacagctacctggttgactg 408
           |||||||||||||||| ||||||||| |||||
Sbjct: 424 ttcaagcctgccgacaactacctggtggactg 455



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 240 gaatgcccgccgcggggcgctccggtggac 269
           |||||||||||||| |||||||||| ||||
Sbjct: 278 gaatgcccgccgcgcggcgctccggcggac 307



to top

>gb|AC012404.9| Homo sapiens, clone RP11-39M21, complete sequence
          Length = 198857

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 407    tgtgggtctgccaagggcacca 428
              ||||||||||||||||||||||
Sbjct: 134168 tgtgggtctgccaagggcacca 134147



to top

>dbj|AP002748.4| Homo sapiens genomic DNA, chromosome 11 clone:CTD-3074O7, complete
              sequence
          Length = 176017

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 27     gctgaaaactgctccaggtccaagaaaaaagcca 60
              ||||||||||||||| ||||||||| ||| ||||
Sbjct: 168524 gctgaaaactgctccgggtccaagagaaaggcca 168491



to top

>dbj|AP001157.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-658F2, complete
             sequence
          Length = 200458

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 27    gctgaaaactgctccaggtccaagaaaaaagcca 60
             ||||||||||||||| ||||||||| ||| ||||
Sbjct: 14532 gctgaaaactgctccgggtccaagagaaaggcca 14499



to top

>gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome 13, complete sequence
          Length = 214085

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 177   ggaccccggaggctgtgggag 197
             |||||||||||||||||||||
Sbjct: 78453 ggaccccggaggctgtgggag 78473



to top

>gb|DQ127755.1| Emiliania huxleyi virus 163 clone new112.seq partial sequence
          Length = 365

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 97  gacggcggtgacggtggtggg 117
           |||||||||||||||||||||
Sbjct: 344 gacggcggtgacggtggtggg 324



to top

>emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genome; segment 5/16
          Length = 349737

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 223   ctcggccggatctcggcgaat 243
             |||||||||||||||||||||
Sbjct: 46071 ctcggccggatctcggcgaat 46091



to top

>emb|AJ890364.1| Emiliania huxleyi virus 86 isolate EhV86
          Length = 407339

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 97     gacggcggtgacggtggtggg 117
              |||||||||||||||||||||
Sbjct: 310190 gacggcggtgacggtggtggg 310170



to top

>gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome 8, complete sequence
          Length = 190381

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   aggaagctgcatgtggtgac 318
             ||||||||||||||||||||
Sbjct: 44024 aggaagctgcatgtggtgac 44043



to top

>gb|AC122848.3| Mus musculus BAC clone RP23-166K13 from chromosome 18, complete sequence
          Length = 204254

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 340    gtcatctgctggggtctgca 359
              ||||||||||||||||||||
Sbjct: 161955 gtcatctgctggggtctgca 161974



to top

>gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome 8, complete
            sequence
          Length = 193083

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 5648 aggaagctgcatgtggtgac 5667



to top

>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 94      ccggacggcggtgacggtgg 113
               ||||||||||||||||||||
Sbjct: 1424081 ccggacggcggtgacggtgg 1424062



to top

>emb|AL359815.26| Human DNA sequence from clone RP11-63N8 on chromosome 1 Contains the 3'
             end of the ALPL gene for alkaline phosphatase,
             liver/bone/kidney, the RAP1GA1 gene for RAP1, GTPase
             activating protein 1, a novel gene, the 3' end of the
             USP31 gene for ubiquitin specific protease 31 and a CpG
             island, complete sequence
          Length = 149651

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gctggcccggctcggggctg 173
             ||||||||||||||||||||
Sbjct: 45499 gctggcccggctcggggctg 45518



to top

>gb|AF453339.1| Chamaerops humilis phosphoribulokinase-like protein 2 (PRK) gene,
           exons 4, 5 and partial cds
          Length = 655

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 491 ctgtgggtctgccaagggca 472



to top

>gb|AF453332.1| Ammandra decasperma phosphoribulokinase-like protein 2 (PRK) gene,
           exons 4, 5 and partial cds
          Length = 707

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 543 ctgtgggtctgccaagggca 524



to top

>gb|BC092530.1| Mus musculus potassium channel tetramerisation domain containing 19,
            mRNA (cDNA clone MGC:107186 IMAGE:6744085), complete cds
          Length = 3007

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 1574 aggaagctgcatgtggtgac 1593



to top

>ref|NM_177791.2| Mus musculus potassium channel tetramerisation domain containing 19
            (Kctd19), mRNA
          Length = 3035

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 1635 aggaagctgcatgtggtgac 1654



to top

>gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-248L18, Complete
              Sequence, complete sequence
          Length = 231039

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 299    aggaagctgcatgtggtgac 318
              ||||||||||||||||||||
Sbjct: 106893 aggaagctgcatgtggtgac 106912



to top

>dbj|AK076644.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4922504H04 product:hypothetical K+ channel
            tetramerisation domain containing protein, full insert
            sequence
          Length = 3035

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 1635 aggaagctgcatgtggtgac 1654



to top

>ref|XM_226403.3| PREDICTED: Rattus norvegicus similar to hypothetical protein
            4922504H04 (LOC291965), mRNA
          Length = 3206

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 1807 aggaagctgcatgtggtgac 1826



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 99      cggcggtgacggtggtgggc 118
               ||||||||||||||||||||
Sbjct: 2741480 cggcggtgacggtggtgggc 2741461



to top

>dbj|AK202410.1| Mus musculus cDNA, clone:Y1G0141G20, strand:unspecified
          Length = 174

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 338 tggtcatctgctggggtctg 357
           ||||||||||||||||||||
Sbjct: 7   tggtcatctgctggggtctg 26



to top

>gb|AY348908.1| Areca rheophytica voucher WB1143 phosphoribulokinase-like protein 2
           (PRK) gene, exons 4, 5 and partial cds
          Length = 622

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 461 ctgtgggtctgccaagggca 442



to top

>gb|AC108826.9| Mus musculus chromosome 16, clone RP23-109P11, complete sequence
          Length = 191894

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    aacagtggatttcaagcctg 386
              ||||||||||||||||||||
Sbjct: 108125 aacagtggatttcaagcctg 108144



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   ccggagcatttgctggcccg 162
             ||||||||||||||||||||
Sbjct: 80214 ccggagcatttgctggcccg 80195



to top

>emb|AJ831361.1| Phytelephas aequatorialis partial prk gene for phosphoribulokinase,
           exons 4-5
          Length = 980

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 857 ctgtgggtctgccaagggca 838



to top

>emb|AJ831359.1| Oraniopsis appendiculata partial prk gene for phosphoribulokinase,
           exons 4-5
          Length = 600

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 449 ctgtgggtctgccaagggca 430



to top

>emb|AJ831357.1| Nypa fruticans partial prk gene for phosphoribulokinase, exons 4-5
          Length = 393

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 242 ctgtgggtctgccaagggca 223



to top

>emb|AJ831349.1| Ceroxylon quindiuense partial prk gene for phosphoribulokinase,
           exons 4-5
          Length = 600

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 ctgtgggtctgccaagggca 425
           ||||||||||||||||||||
Sbjct: 449 ctgtgggtctgccaagggca 430



to top

>gb|AC151573.2| Mus musculus BAC clone RP23-410B24 from 8, complete sequence
          Length = 202731

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 299  aggaagctgcatgtggtgac 318
            ||||||||||||||||||||
Sbjct: 5169 aggaagctgcatgtggtgac 5150


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,887,916
Number of Sequences: 3902068
Number of extensions: 3887916
Number of successful extensions: 76081
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75855
Number of HSP's gapped (non-prelim): 226
length of query: 476
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 454
effective length of database: 17,147,199,772
effective search space: 7784828696488
effective search space used: 7784828696488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top