ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl19e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK070398.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 8e-92
2gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome... 168 1e-38
3gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 168 1e-38
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 168 1e-38
5emb|BX932832.1| Gallus gallus finished cDNA, clone ChEST276k16 50 0.007
6gb|AC182012.3| Otolemur garnettii clone CH256-376P14, complete s... 48 0.026
7dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
8dbj|AP005789.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
9dbj|AP005569.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.41
10gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome 42 1.6
11ref|NM_001004367.2| Mus musculus CXXC finger 4 (Cxxc4), mRNA 42 1.6
12gb|BC082332.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:... 42 1.6
13gb|BC067052.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:... 42 1.6
14ref|XM_415471.1| PREDICTED: Gallus gallus similar to chromosome ... 42 1.6
15gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 1.6
16gb|BC065149.1| Mus musculus CXXC finger 4, mRNA (cDNA clone IMAG... 42 1.6
17ref|XM_984932.1| PREDICTED: Mus musculus CXXC finger 4 (Cxxc4), ... 42 1.6
18ref|XM_541615.2| PREDICTED: Canis familiaris similar to Periaxin... 42 1.6
19emb|CR759881.16| Zebrafish DNA sequence from clone CH211-165K16 ... 42 1.6
20gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, com... 42 1.6
21emb|AL160060.11| Human DNA sequence from clone RP11-207K8 on chr... 42 1.6
22gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, com... 42 1.6
23gb|AE012355.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 1.6
24dbj|AK136882.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 1.6
25gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 1.6
26dbj|AK038550.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 42 1.6
27gb|AY757327.1| Oreochromis niloticus isolate B6a Hox protein gen... 42 1.6
28gb|AF272158.1|AF272158 Rattus norvegicus Dvl-binding protein Ida... 42 1.6
29ref|NM_053342.1| Rattus norvegicus CXXC finger 4 (Cxxc4), mRNA 42 1.6
30emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 42 1.6
31gb|U70053.1|XCU70053 Xanthomonas campestris gumN, gumO and gumP ... 42 1.6
32gb|AC166056.2| Mus musculus BAC clone RP23-462A15 from chromosom... 40 6.3
33gb|DQ215390.1| Taeniopygia guttata clone 0058P0059G11 chromosome... 40 6.3
34gb|DQ215389.1| Taeniopygia guttata clone 0061P0002H10 chromosome... 40 6.3
35gb|AC121363.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
36ref|NM_054080.1| Mus musculus aldo-keto reductase family 1, memb... 40 6.3
37gb|BT018654.1| Zea mays clone EL01N0506H01.d mRNA sequence 40 6.3
38gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, com... 40 6.3
39gb|AC164613.3| Mus musculus BAC clone RP23-324B8 from chromosome... 40 6.3
40gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete... 40 6.3
41ref|XM_591904.2| PREDICTED: Bos taurus similar to alpha-2-plasmi... 40 6.3
42gb|AY596618.1| Saccharum officinarum clone SCCCCL4009G04, comple... 40 6.3
43gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.3
44gb|BC062176.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cD... 40 6.3
45gb|AC146155.3| Pan troglodytes BAC clone RP43-37F3 from 7, compl... 40 6.3
46ref|XM_384357.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 40 6.3
47emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 i... 40 6.3
48emb|CR716878.2|CNS0GG3B Tetraodon nigroviridis full-length cDNA 40 6.3
49gb|BC055764.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cD... 40 6.3
50gb|AC005251.1| Homo sapiens BAC clone CTA-324D18 from 7, complet... 40 6.3
51gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.3
52emb|BX072038.1|CNS09RQY Single read from an extremity of a full-... 40 6.3
53emb|BX072037.1|CNS09RQX Single read from an extremity of a full-... 40 6.3
54emb|BX071074.1|CNS09R06 Single read from an extremity of a full-... 40 6.3
55emb|BX071073.1|CNS09R05 Single read from an extremity of a full-... 40 6.3
56emb|BX069043.1|CNS09PFR Single read from an extremity of a full-... 40 6.3
57emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-... 40 6.3
58emb|BX065976.1|CNS09N2K Single read from an extremity of a full-... 40 6.3
59emb|BX065975.1|CNS09N2J Single read from an extremity of a full-... 40 6.3
60emb|BX064684.1|CNS09M2O Single read from an extremity of a full-... 40 6.3
61emb|BX063673.1|CNS09LAL Single read from an extremity of a full-... 40 6.3
62emb|BX061993.1|CNS09JZX Single read from an extremity of a full-... 40 6.3
63emb|BX061992.1|CNS09JZW Single read from an extremity of a full-... 40 6.3
64emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-... 40 6.3
65emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-... 40 6.3
66emb|BX054844.1|CNS09EHC Single read from an extremity of a full-... 40 6.3
67emb|BX054383.1|CNS09E4J Single read from an extremity of a full-... 40 6.3
68emb|BX054382.1|CNS09E4I Single read from an extremity of a full-... 40 6.3
69emb|BX052598.1|CNS09CQY Single read from an extremity of a full-... 40 6.3
70emb|BX052597.1|CNS09CQX Single read from an extremity of a full-... 40 6.3
71emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-... 40 6.3
72emb|BX051766.1|CNS09C3U Single read from an extremity of a full-... 40 6.3
73emb|BX051765.1|CNS09C3T Single read from an extremity of a full-... 40 6.3
74emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-... 40 6.3
75emb|BX050825.1|CNS09BDP Single read from an extremity of a full-... 40 6.3
76emb|BX049822.1|CNS09ALU Single read from an extremity of a full-... 40 6.3
77emb|BX049821.1|CNS09ALT Single read from an extremity of a full-... 40 6.3
78emb|BX030920.1|CNS08W0S Single read from an extremity of a full-... 40 6.3
79emb|BX030919.1|CNS08W0R Single read from an extremity of a full-... 40 6.3
80emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-... 40 6.3
81emb|BX045807.1|CNS097IB Single read from an extremity of a full-... 40 6.3
82emb|BX045806.1|CNS097IA Single read from an extremity of a full-... 40 6.3
83emb|BX042049.1|CNS094LX Single read from an extremity of a full-... 40 6.3
84emb|BX042048.1|CNS094LW Single read from an extremity of a full-... 40 6.3
85emb|BX040221.1|CNS09375 Single read from an extremity of a full-... 40 6.3
86emb|BX040220.1|CNS09374 Single read from an extremity of a full-... 40 6.3
87emb|BX037502.1|CNS0913M Single read from an extremity of a full-... 40 6.3
88emb|BX037471.1|CNS0912R Single read from an extremity of a full-... 40 6.3
89emb|BX036960.1|CNS090OK Single read from an extremity of a full-... 40 6.3
90emb|BX036959.1|CNS090OJ Single read from an extremity of a full-... 40 6.3
91emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-... 40 6.3
92emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-... 40 6.3
93emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-... 40 6.3
94emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-... 40 6.3
95emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-... 40 6.3
96emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-... 40 6.3
97emb|BX034217.1|CNS08YKD Single read from an extremity of a full-... 40 6.3
98emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-... 40 6.3
99emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-... 40 6.3
100emb|BX033034.1|CNS08XNI Single read from an extremity of a full-... 40 6.3
101emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-... 40 6.3
102emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-... 40 6.3
103emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-... 40 6.3
104emb|BX028005.1|CNS08TRT Single read from an extremity of a full-... 40 6.3
105emb|BX028004.1|CNS08TRS Single read from an extremity of a full-... 40 6.3
106emb|BX027756.1|CNS08TKW Single read from an extremity of a full-... 40 6.3
107emb|BX024641.1|CNS08R6D Single read from an extremity of a full-... 40 6.3
108emb|BX024640.1|CNS08R6C Single read from an extremity of a full-... 40 6.3
109emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-... 40 6.3
110emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-... 40 6.3
111emb|BX022052.1|CNS08P6G Single read from an extremity of a full-... 40 6.3
112emb|BX022051.1|CNS08P6F Single read from an extremity of a full-... 40 6.3
113emb|BX019569.1|CNS08N9H Single read from an extremity of a full-... 40 6.3
114emb|BX019568.1|CNS08N9G Single read from an extremity of a full-... 40 6.3
115emb|BX020483.1|CNS08NYV Single read from an extremity of a full-... 40 6.3
116emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-... 40 6.3
117emb|BX019149.1|CNS08MXT Single read from an extremity of a full-... 40 6.3
118emb|BX018722.1|CNS08MLY Single read from an extremity of a full-... 40 6.3
119emb|BX018239.1|CNS08M8J Single read from an extremity of a full-... 40 6.3
120emb|BX018238.1|CNS08M8I Single read from an extremity of a full-... 40 6.3
121emb|BX017233.1|CNS08LGL Single read from an extremity of a full-... 40 6.3
122emb|BX017232.1|CNS08LGK Single read from an extremity of a full-... 40 6.3
123emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-... 40 6.3
124emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-... 40 6.3
125emb|BX016618.1|CNS08KZI Single read from an extremity of a full-... 40 6.3
126emb|BX016202.1|CNS08KNY Single read from an extremity of a full-... 40 6.3
127emb|BX016201.1|CNS08KNX Single read from an extremity of a full-... 40 6.3
128emb|BX016072.1|CNS08KKC Single read from an extremity of a full-... 40 6.3
129emb|BX016071.1|CNS08KKB Single read from an extremity of a full-... 40 6.3
130emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-... 40 6.3
131emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-... 40 6.3
132emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-... 40 6.3
133emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-... 40 6.3
134emb|BX014834.1|CNS08JLY Single read from an extremity of a full-... 40 6.3
135emb|BX014823.1|CNS08JLN Single read from an extremity of a full-... 40 6.3
136emb|BX012788.1|CNS08I14 Single read from an extremity of a full-... 40 6.3
137emb|BX011620.1|CNS08H4O Single read from an extremity of a full-... 40 6.3
138emb|BX009503.1|CNS08FHV Single read from an extremity of a full-... 40 6.3
139emb|BX009502.1|CNS08FHU Single read from an extremity of a full-... 40 6.3
140emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-... 40 6.3
141emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-... 40 6.3
142emb|BX007868.1|CNS08E8G Single read from an extremity of a full-... 40 6.3
143emb|BX007867.1|CNS08E8F Single read from an extremity of a full-... 40 6.3
144emb|BX007827.1|CNS08E7B Single read from an extremity of a full-... 40 6.3
145emb|BX007826.1|CNS08E7A Single read from an extremity of a full-... 40 6.3
146emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-... 40 6.3
147emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-... 40 6.3
148emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-... 40 6.3
149emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-... 40 6.3
150gb|CP000088.1| Thermobifida fusca YX, complete genome 40 6.3
151emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 40 6.3
152emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4,... 40 6.3
153gb|AF469109.1| Mus musculus SDS3 mRNA, complete cds 40 6.3
154dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 40 6.3
155ref|NM_134584.2| Drosophila melanogaster CG32512-RA (CG32512), mRNA 40 6.3
156dbj|AK138947.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 6.3
157dbj|AK150633.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 6.3
158gb|AY060370.1| Drosophila melanogaster LD23009 full length cDNA 40 6.3
159dbj|AK010274.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 6.3
160gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosom... 40 6.3
161dbj|AK045475.1| Mus musculus adult male corpora quadrigemina cDN... 40 6.3
162dbj|AK012162.1| Mus musculus 10 days embryo whole body cDNA, RIK... 40 6.3
163dbj|AK043652.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 6.3
164dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
165dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
166gb|AC016747.7| Homo sapiens BAC clone RP11-493E12 from 2, comple... 40 6.3
167ref|NM_178622.3| Mus musculus RIKEN cDNA 2400003N08 gene (240000... 40 6.3
168dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome 40 6.3
169dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.3
170dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 6.3
171dbj|AP007273.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
172dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 6.3
173dbj|AP005966.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.3
174ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147 ... 40 6.3
175ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323 ... 40 6.3
176dbj|AK103423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
177dbj|AK102042.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
178dbj|AK070184.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
179dbj|AK068789.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.3
180emb|CR925778.5| Zebrafish DNA sequence from clone DKEY-63L2 in l... 40 6.3
181gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 ... 40 6.3
182dbj|AP004243.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.3
183dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.3
184gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 6.3
185gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, comple... 40 6.3
186dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.3
187emb|AL683878.9| Mouse DNA sequence from clone RP23-201G13 on chr... 40 6.3
188emb|AL672056.4| Mouse DNA sequence from clone RP23-467O2 on chro... 40 6.3

>dbj|AK070398.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048G06, full
           insert sequence
          Length = 3440

 Score =  345 bits (174), Expect = 8e-92
 Identities = 264/294 (89%)
 Strand = Plus / Plus

                                                                       
Query: 165 gtcggcctcgctgactggcatcagaaatacataggcaaagttaagcaggcagtttaccac 224
           ||||||||||| |||||||||||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 198 gtcggcctcgcggactggcatcagaagtacatcggcaaagtaaagcaggcagtctaccac 257

                                                                       
Query: 225 actcagaagagtgggaggaggcgtgttgtggtcttgacagaggaaaatgtgatcgcttct 284
           | |||||| ||||| ||||| ||||||||||| ||||||||||||||||| || ||||||
Sbjct: 258 agtcagaaaagtggaaggagacgtgttgtggtgttgacagaggaaaatgttattgcttct 317

                                                                       
Query: 285 cttgatcttcgttcaggagatatattttggcgacatgtcattgagaagaataaccccatt 344
           |||||||||||||||||||||||||||||| | || ||||||||||||||| | ||  | 
Sbjct: 318 cttgatcttcgttcaggagatatattttggaggcacgtcattgagaagaatgatcctgtg 377

                                                                       
Query: 345 gatcagcttagtctatcagctggaaaatatgttgttaccctttcttcgggaggtagtata 404
           ||| |||||||| |||||  ||||||||||||||| || |||||||||||||||||||||
Sbjct: 378 gatgagcttagtttatcacttggaaaatatgttgtaactctttcttcgggaggtagtata 437

                                                                 
Query: 405 ttgagggcatggaatcttcctgatggacagatggtctgggaaaccaatattcaa 458
           |||||||||||||||||||||||||| |||||| |||||||||| ||| |||||
Sbjct: 438 ttgagggcatggaatcttcctgatggccagatgatctgggaaactaatcttcaa 491



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                        
Query: 63  tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 107
           |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 93  tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 134



to top

>gb|AC145477.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1402B06,
              complete sequence
          Length = 134001

 Score =  168 bits (85), Expect = 1e-38
 Identities = 118/129 (91%)
 Strand = Plus / Plus

                                                                          
Query: 181    ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcagaagagtggga 240
              |||||||||| ||||| |||||||| ||||||||||| ||||||| |||||| ||||| |
Sbjct: 106597 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 106656

                                                                          
Query: 241    ggaggcgtgttgtggtcttgacagaggaaaatgtgatcgcttctcttgatcttcgttcag 300
              |||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 106657 ggagacgtgttgtggtgttgacagaggaaaatgttattgcttctcttgatcttcgttcag 106716

                       
Query: 301    gagatatat 309
              |||||||||
Sbjct: 106717 gagatatat 106725



 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Plus

                                                                          
Query: 373    atgttgttaccctttcttcgggaggtagtatattgagggcatggaatcttcctgatggac 432
              ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 107909 atgttgtaactctttcttcgggaggtagtatattgagggcatggaatcttcctgatggcc 107968

                                        
Query: 433    agatggtctgggaaaccaatattcaa 458
              ||||| |||||||||| ||| |||||
Sbjct: 107969 agatgatctgggaaactaatcttcaa 107994



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                           
Query: 63     tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 107
              |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 104426 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 104467



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score =  168 bits (85), Expect = 1e-38
 Identities = 118/129 (91%)
 Strand = Plus / Plus

                                                                         
Query: 181   ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcagaagagtggga 240
             |||||||||| ||||| |||||||| ||||||||||| ||||||| |||||| ||||| |
Sbjct: 13786 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 13845

                                                                         
Query: 241   ggaggcgtgttgtggtcttgacagaggaaaatgtgatcgcttctcttgatcttcgttcag 300
             |||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 13846 ggagacgtgttgtggtgttgacagaggaaaatgttattgcttctcttgatcttcgttcag 13905

                      
Query: 301   gagatatat 309
             |||||||||
Sbjct: 13906 gagatatat 13914



 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Plus

                                                                         
Query: 373   atgttgttaccctttcttcgggaggtagtatattgagggcatggaatcttcctgatggac 432
             ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 15098 atgttgtaactctttcttcgggaggtagtatattgagggcatggaatcttcctgatggcc 15157

                                       
Query: 433   agatggtctgggaaaccaatattcaa 458
             ||||| |||||||||| ||| |||||
Sbjct: 15158 agatgatctgggaaactaatcttcaa 15183



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                          
Query: 63    tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 107
             |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 11615 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 11656



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  168 bits (85), Expect = 1e-38
 Identities = 118/129 (91%)
 Strand = Plus / Plus

                                                                           
Query: 181     ggcatcagaaatacataggcaaagttaagcaggcagtttaccacactcagaagagtggga 240
               |||||||||| ||||| |||||||| ||||||||||| ||||||| |||||| ||||| |
Sbjct: 7829011 ggcatcagaagtacatcggcaaagtaaagcaggcagtctaccacagtcagaaaagtggaa 7829070

                                                                           
Query: 241     ggaggcgtgttgtggtcttgacagaggaaaatgtgatcgcttctcttgatcttcgttcag 300
               |||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 7829071 ggagacgtgttgtggtgttgacagaggaaaatgttattgcttctcttgatcttcgttcag 7829130

                        
Query: 301     gagatatat 309
               |||||||||
Sbjct: 7829131 gagatatat 7829139



 Score =  123 bits (62), Expect = 5e-25
 Identities = 80/86 (93%)
 Strand = Plus / Plus

                                                                           
Query: 373     atgttgttaccctttcttcgggaggtagtatattgagggcatggaatcttcctgatggac 432
               ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 7830323 atgttgtaactctttcttcgggaggtagtatattgagggcatggaatcttcctgatggcc 7830382

                                         
Query: 433     agatggtctgggaaaccaatattcaa 458
               ||||| |||||||||| ||| |||||
Sbjct: 7830383 agatgatctgggaaactaatcttcaa 7830408



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 40/45 (88%), Gaps = 3/45 (6%)
 Strand = Plus / Plus

                                                            
Query: 63      tcggcgatggcgctgccgccgcgccaactcctcctcgtcctcctc 107
               |||||||||||   |||||||||||| ||||||||| ||||||||
Sbjct: 7826840 tcggcgatggc---gccgccgcgccatctcctcctcctcctcctc 7826881



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 85       gccaactcctcctcgtcctcctcg 108
                |||||||||||||| |||||||||
Sbjct: 16783637 gccaactcctcctcctcctcctcg 16783614



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 89       actcctcctcgtcctcctcg 108
                ||||||||||||||||||||
Sbjct: 12858725 actcctcctcgtcctcctcg 12858744



to top

>emb|BX932832.1| Gallus gallus finished cDNA, clone ChEST276k16
          Length = 570

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 91  tcctcctcgtcctcctcgggttcct 115
           |||||||||||||||||||||||||
Sbjct: 84  tcctcctcgtcctcctcgggttcct 60



to top

>gb|AC182012.3| Otolemur garnettii clone CH256-376P14, complete sequence
          Length = 224337

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 436    tggtctgggaaaccaatattcaaacttcctca 467
              |||||||| ||||||||||| |||||||||||
Sbjct: 221438 tggtctggaaaaccaatattaaaacttcctca 221407



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 310     tttggcgacatgtcattgagaagaat 335
               ||||| ||||||||||||||||||||
Sbjct: 1215767 tttggtgacatgtcattgagaagaat 1215792



to top

>dbj|AP005789.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0563F09
          Length = 174905

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 310   tttggcgacatgtcattgagaagaat 335
             ||||| ||||||||||||||||||||
Sbjct: 46641 tttggtgacatgtcattgagaagaat 46666



to top

>dbj|AP005569.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1310_F05
          Length = 107916

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 310    tttggcgacatgtcattgagaagaat 335
              ||||| ||||||||||||||||||||
Sbjct: 104361 tttggtgacatgtcattgagaagaat 104386



to top

>gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome
          Length = 150715

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    ctcctcctcgtcctcctcggg 110
             |||||||||||||||||||||
Sbjct: 79400 ctcctcctcgtcctcctcggg 79420



to top

>ref|NM_001004367.2| Mus musculus CXXC finger 4 (Cxxc4), mRNA
          Length = 4852

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 597 ctcctcctcgtcctcctcggg 617



to top

>gb|BC082332.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:90862
           IMAGE:30537505), complete cds
          Length = 4852

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 597 ctcctcctcgtcctcctcggg 617



to top

>gb|BC067052.1| Mus musculus CXXC finger 4, mRNA (cDNA clone MGC:86040
           IMAGE:30619087), complete cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 910 ctcctcctcgtcctcctcggg 930



to top

>ref|XM_415471.1| PREDICTED: Gallus gallus similar to chromosome 9 open reading frame
           78; hepatocellular carcinoma-associated antigen 59
           (LOC417189), mRNA
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 91  tcctcctcgtcctcctcgggttcct 115
           |||||||| ||||||||||||||||
Sbjct: 83  tcctcctcatcctcctcgggttcct 59



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 64      cggcgatggcgctgccgccgc 84
               |||||||||||||||||||||
Sbjct: 5148443 cggcgatggcgctgccgccgc 5148423



to top

>gb|BC065149.1| Mus musculus CXXC finger 4, mRNA (cDNA clone IMAGE:6853043), partial
            cds
          Length = 5216

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 90   ctcctcctcgtcctcctcggg 110
            |||||||||||||||||||||
Sbjct: 1066 ctcctcctcgtcctcctcggg 1086



to top

>ref|XM_984932.1| PREDICTED: Mus musculus CXXC finger 4 (Cxxc4), mRNA
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 360 ctcctcctcgtcctcctcggg 380



to top

>ref|XM_541615.2| PREDICTED: Canis familiaris similar to Periaxin (LOC484501), mRNA
          Length = 4410

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 90   ctcctcctcgtcctcctcggg 110
            |||||||||||||||||||||
Sbjct: 4107 ctcctcctcgtcctcctcggg 4087



to top

>emb|CR759881.16| Zebrafish DNA sequence from clone CH211-165K16 in linkage group 18,
             complete sequence
          Length = 123400

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 94    tcctcgtcctcctcgggttcc 114
             |||||||||||||||||||||
Sbjct: 57566 tcctcgtcctcctcgggttcc 57586



to top

>gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, complete sequence
          Length = 202604

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    ctcctcctcgtcctcctcggg 110
             |||||||||||||||||||||
Sbjct: 45679 ctcctcctcgtcctcctcggg 45699



to top

>emb|AL160060.11| Human DNA sequence from clone RP11-207K8 on chromosome 10 Contains part
             of the SVIL gene for supervillin (archvillin), complete
             sequence
          Length = 171800

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 414   tggaatcttcctgatggacagatgg 438
             ||||||||||||||||| |||||||
Sbjct: 79247 tggaatcttcctgatgggcagatgg 79223



to top

>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence
          Length = 206159

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 90   ctcctcctcgtcctcctcggg 110
            |||||||||||||||||||||
Sbjct: 7161 ctcctcctcgtcctcctcggg 7181



to top

>gb|AE012355.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 263
            of 460 of the complete genome
          Length = 10666

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 63   tcggcgatggcgctgccgccg 83
            |||||||||||||||||||||
Sbjct: 5459 tcggcgatggcgctgccgccg 5439



to top

>dbj|AK136882.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330164G18
           product:unclassifiable, full insert sequence
          Length = 4243

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 129 ctcctcctcgtcctcctcggg 109



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 63      tcggcgatggcgctgccgccg 83
               |||||||||||||||||||||
Sbjct: 2010193 tcggcgatggcgctgccgccg 2010213



to top

>dbj|AK038550.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230035L11 product:inhibitor of
           the Dvl and Axin complex, full insert sequence
          Length = 4296

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 24  ctcctcctcgtcctcctcggg 4



to top

>gb|AY757327.1| Oreochromis niloticus isolate B6a Hox protein gene, partial cds
          Length = 225

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 87  caactcctcctcgtcctcctc 107
           |||||||||||||||||||||
Sbjct: 153 caactcctcctcgtcctcctc 173



to top

>gb|AF272158.1|AF272158 Rattus norvegicus Dvl-binding protein Idax mRNA, complete cds
          Length = 761

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 366 ctcctcctcgtcctcctcggg 386



to top

>ref|NM_053342.1| Rattus norvegicus CXXC finger 4 (Cxxc4), mRNA
          Length = 761

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 90  ctcctcctcgtcctcctcggg 110
           |||||||||||||||||||||
Sbjct: 366 ctcctcctcgtcctcctcggg 386



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 110     gttccttgtcgctgtctctct 130
               |||||||||||||||||||||
Sbjct: 1722061 gttccttgtcgctgtctctct 1722081



to top

>gb|U70053.1|XCU70053 Xanthomonas campestris gumN, gumO and gumP genes, complete cds
          Length = 4028

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 63   tcggcgatggcgctgccgccg 83
            |||||||||||||||||||||
Sbjct: 2350 tcggcgatggcgctgccgccg 2370



to top

>gb|AC166056.2| Mus musculus BAC clone RP23-462A15 from chromosome 13, complete
             sequence
          Length = 198814

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 226   ctcagaagagtgggaggagg 245
             ||||||||||||||||||||
Sbjct: 48593 ctcagaagagtgggaggagg 48612



to top

>gb|DQ215390.1| Taeniopygia guttata clone 0058P0059G11 chromosome 10 open reading
           frame 104-like mRNA, complete sequence
          Length = 606

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 99  ctcctcctcgtcctcctcgg 118



to top

>gb|DQ215389.1| Taeniopygia guttata clone 0061P0002H10 chromosome 10 open reading
           frame 104-like mRNA, complete sequence
          Length = 1027

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 63  ctcctcctcgtcctcctcgg 82



to top

>gb|AC121363.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0036C12,
              complete sequence
          Length = 145517

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 85     gccaactcctcctcgtcctcctcg 108
              |||||||||||||| |||||||||
Sbjct: 107747 gccaactcctcctcctcctcctcg 107724



to top

>ref|NM_054080.1| Mus musculus aldo-keto reductase family 1, member C20 (Akr1c20), mRNA
          Length = 1306

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 226  ctcagaagagtgggaggagg 245
            ||||||||||||||||||||
Sbjct: 1103 ctcagaagagtgggaggagg 1122



to top

>gb|BT018654.1| Zea mays clone EL01N0506H01.d mRNA sequence
          Length = 1428

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 356 tctatcagctggaaaatatg 375
           ||||||||||||||||||||
Sbjct: 214 tctatcagctggaaaatatg 195



to top

>gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, complete sequence
          Length = 185353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    ccaactcctcctcgtcctcc 105
             ||||||||||||||||||||
Sbjct: 72337 ccaactcctcctcgtcctcc 72318



to top

>gb|AC164613.3| Mus musculus BAC clone RP23-324B8 from chromosome 13, complete sequence
          Length = 197469

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 226    ctcagaagagtgggaggagg 245
              ||||||||||||||||||||
Sbjct: 165575 ctcagaagagtgggaggagg 165594



to top

>gb|AC104631.2| Drosophila melanogaster clone BACR35D19, complete sequence
          Length = 166908

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    ctcctcctcgtcctcctcgg 109
             ||||||||||||||||||||
Sbjct: 49055 ctcctcctcgtcctcctcgg 49036



to top

>ref|XM_591904.2| PREDICTED: Bos taurus similar to alpha-2-plasmin inhibitor
            (LOC514104), mRNA
          Length = 6896

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 90   ctcctcctcgtcctcctcgg 109
            ||||||||||||||||||||
Sbjct: 3483 ctcctcctcgtcctcctcgg 3464



to top

>gb|AY596618.1| Saccharum officinarum clone SCCCCL4009G04, complete sequence
          Length = 811

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 110 ctcctcctcgtcctcctcgg 129



to top

>gb|AC130726.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0508G08,
             complete sequence
          Length = 141383

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    actcctcctcgtcctcctcg 108
             ||||||||||||||||||||
Sbjct: 19271 actcctcctcgtcctcctcg 19290



to top

>gb|BC062176.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cDNA clone MGC:70133
           IMAGE:6514171), complete cds
          Length = 1480

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 138 ccaactcctcctcgtcctcc 119



to top

>gb|AC146155.3| Pan troglodytes BAC clone RP43-37F3 from 7, complete sequence
          Length = 159409

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 327   gagaagaataaccccattga 346
             ||||||||||||||||||||
Sbjct: 57944 gagaagaataaccccattga 57925



to top

>ref|XM_384357.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
            (FG04181.1) partial mRNA
          Length = 3138

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 90   ctcctcctcgtcctcctcgg 109
            ||||||||||||||||||||
Sbjct: 1299 ctcctcctcgtcctcctcgg 1280



to top

>emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 in linkage group 11,
             complete sequence
          Length = 140484

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 358   tatcagctggaaaatatgtt 377
             ||||||||||||||||||||
Sbjct: 42125 tatcagctggaaaatatgtt 42144



to top

>emb|CR716878.2|CNS0GG3B Tetraodon nigroviridis full-length cDNA
          Length = 576

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  ccctcctctcagatcagagg 46
           ||||||||||||||||||||
Sbjct: 335 ccctcctctcagatcagagg 316



to top

>gb|BC055764.1| Mus musculus RIKEN cDNA 2400003N08 gene, mRNA (cDNA clone
           IMAGE:6402735), partial cds
          Length = 2389

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 224 ccaactcctcctcgtcctcc 205



to top

>gb|AC005251.1| Homo sapiens BAC clone CTA-324D18 from 7, complete sequence
          Length = 92636

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 327   gagaagaataaccccattga 346
             ||||||||||||||||||||
Sbjct: 68549 gagaagaataaccccattga 68568



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     gcgatggcgctgccgccgcg 85
              ||||||||||||||||||||
Sbjct: 350637 gcgatggcgctgccgccgcg 350656



to top

>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 681 ctcctcctcgtcctcctcgg 700



to top

>emb|BX072037.1|CNS09RQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532



to top

>emb|BX071074.1|CNS09R06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 688 ctcctcctcgtcctcctcgg 707



to top

>emb|BX071073.1|CNS09R05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 554 ctcctcctcgtcctcctcgg 535



to top

>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 222 ctcctcctcgtcctcctcgg 241



to top

>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 731 ctcctcctcgtcctcctcgg 712



to top

>emb|BX065976.1|CNS09N2K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 676 ctcctcctcgtcctcctcgg 695



to top

>emb|BX065975.1|CNS09N2J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 513 ctcctcctcgtcctcctcgg 494



to top

>emb|BX064684.1|CNS09M2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 526 ctcctcctcgtcctcctcgg 507



to top

>emb|BX063673.1|CNS09LAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 499 ctcctcctcgtcctcctcgg 480



to top

>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 703 ctcctcctcgtcctcctcgg 722



to top

>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 552 ctcctcctcgtcctcctcgg 533



to top

>emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 684 ctcctcctcgtcctcctcgg 703



to top

>emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 539 ctcctcctcgtcctcctcgg 520



to top

>emb|BX054844.1|CNS09EHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 454

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 356 ctcctcctcgtcctcctcgg 337



to top

>emb|BX054383.1|CNS09E4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 120 ctcctcctcgtcctcctcgg 139



to top

>emb|BX054382.1|CNS09E4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 478 ctcctcctcgtcctcctcgg 459



to top

>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713



to top

>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 213 ctcctcctcgtcctcctcgg 194



to top

>emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 570 ctcctcctcgtcctcctcgg 551



to top

>emb|BX051766.1|CNS09C3U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 686 ctcctcctcgtcctcctcgg 705



to top

>emb|BX051765.1|CNS09C3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532



to top

>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 686 ctcctcctcgtcctcctcgg 705



to top

>emb|BX050825.1|CNS09BDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 544 ctcctcctcgtcctcctcgg 525



to top

>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713



to top

>emb|BX049821.1|CNS09ALT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 548 ctcctcctcgtcctcctcgg 529



to top

>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 702 ctcctcctcgtcctcctcgg 721



to top

>emb|BX030919.1|CNS08W0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 593 ctcctcctcgtcctcctcgg 574



to top

>emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 571 ctcctcctcgtcctcctcgg 552



to top

>emb|BX045807.1|CNS097IB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 691 ctcctcctcgtcctcctcgg 710



to top

>emb|BX045806.1|CNS097IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 547 ctcctcctcgtcctcctcgg 528



to top

>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 689 ctcctcctcgtcctcctcgg 708



to top

>emb|BX042048.1|CNS094LW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 543 ctcctcctcgtcctcctcgg 524



to top

>emb|BX040221.1|CNS09375 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 688 ctcctcctcgtcctcctcgg 707



to top

>emb|BX040220.1|CNS09374 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 513 ctcctcctcgtcctcctcgg 494



to top

>emb|BX037502.1|CNS0913M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 239 ctcctcctcgtcctcctcgg 258



to top

>emb|BX037471.1|CNS0912R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 561 ctcctcctcgtcctcctcgg 542



to top

>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 701 ctcctcctcgtcctcctcgg 720



to top

>emb|BX036959.1|CNS090OJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 573 ctcctcctcgtcctcctcgg 554



to top

>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 698 ctcctcctcgtcctcctcgg 717



to top

>emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 564 ctcctcctcgtcctcctcgg 545



to top

>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 694 ctcctcctcgtcctcctcgg 713



to top

>emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 565 ctcctcctcgtcctcctcgg 546



to top

>emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 684 ctcctcctcgtcctcctcgg 703



to top

>emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 550 ctcctcctcgtcctcctcgg 531



to top

>emb|BX034217.1|CNS08YKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 589 ctcctcctcgtcctcctcgg 570



to top

>emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 551 ctcctcctcgtcctcctcgg 532



to top

>emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 210 ctcctcctcgtcctcctcgg 229



to top

>emb|BX033034.1|CNS08XNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 564



to top

>emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541



to top

>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 581 ctcctcctcgtcctcctcgg 600



to top

>emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 575 ctcctcctcgtcctcctcgg 556



to top

>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 703 ctcctcctcgtcctcctcgg 722



to top

>emb|BX028004.1|CNS08TRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541



to top

>emb|BX027756.1|CNS08TKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 218 ctcctcctcgtcctcctcgg 237



to top

>emb|BX024641.1|CNS08R6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 604



to top

>emb|BX024640.1|CNS08R6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 539 ctcctcctcgtcctcctcgg 520



to top

>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544



to top

>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 555 ctcctcctcgtcctcctcgg 536



to top

>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 602



to top

>emb|BX022051.1|CNS08P6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 562 ctcctcctcgtcctcctcgg 543



to top

>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 700 ctcctcctcgtcctcctcgg 719



to top

>emb|BX019568.1|CNS08N9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 574 ctcctcctcgtcctcctcgg 555



to top

>emb|BX020483.1|CNS08NYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 569 ctcctcctcgtcctcctcgg 550



to top

>emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541



to top

>emb|BX019149.1|CNS08MXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 261

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 104 ctcctcctcgtcctcctcgg 85



to top

>emb|BX018722.1|CNS08MLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 571 ctcctcctcgtcctcctcgg 552



to top

>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 687 ctcctcctcgtcctcctcgg 706



to top

>emb|BX018238.1|CNS08M8I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 584 ctcctcctcgtcctcctcgg 565



to top

>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 696 ctcctcctcgtcctcctcgg 715



to top

>emb|BX017232.1|CNS08LGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 566



to top

>emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 216 ctcctcctcgtcctcctcgg 235



to top

>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 711 ctcctcctcgtcctcctcgg 730



to top

>emb|BX016618.1|CNS08KZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 577 ctcctcctcgtcctcctcgg 558



to top

>emb|BX016202.1|CNS08KNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 679 ctcctcctcgtcctcctcgg 698



to top

>emb|BX016201.1|CNS08KNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 548 ctcctcctcgtcctcctcgg 529



to top

>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 536 ctcctcctcgtcctcctcgg 555



to top

>emb|BX016071.1|CNS08KKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 295 ctcctcctcgtcctcctcgg 276



to top

>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 692 ctcctcctcgtcctcctcgg 711



to top

>emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 547 ctcctcctcgtcctcctcgg 528



to top

>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 689 ctcctcctcgtcctcctcgg 708



to top

>emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 669 ctcctcctcgtcctcctcgg 688



to top

>emb|BX014834.1|CNS08JLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 556 ctcctcctcgtcctcctcgg 537



to top

>emb|BX014823.1|CNS08JLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 583 ctcctcctcgtcctcctcgg 564



to top

>emb|BX012788.1|CNS08I14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 509 ctcctcctcgtcctcctcgg 490



to top

>emb|BX011620.1|CNS08H4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 565 ctcctcctcgtcctcctcgg 546



to top

>emb|BX009503.1|CNS08FHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 699 ctcctcctcgtcctcctcgg 718



to top

>emb|BX009502.1|CNS08FHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 560 ctcctcctcgtcctcctcgg 541



to top

>emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 679 ctcctcctcgtcctcctcgg 698



to top

>emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 563 ctcctcctcgtcctcctcgg 544



to top

>emb|BX007868.1|CNS08E8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 657 ctcctcctcgtcctcctcgg 676



to top

>emb|BX007867.1|CNS08E8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 480 ctcctcctcgtcctcctcgg 461



to top

>emb|BX007827.1|CNS08E7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 704 ctcctcctcgtcctcctcgg 723



to top

>emb|BX007826.1|CNS08E7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 554 ctcctcctcgtcctcctcgg 535



to top

>emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 699 ctcctcctcgtcctcctcgg 718



to top

>emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 585 ctcctcctcgtcctcctcgg 566



to top

>emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 690 ctcctcctcgtcctcctcgg 709



to top

>emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 563 ctcctcctcgtcctcctcgg 544



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 90      ctcctcctcgtcctcctcgg 109
               ||||||||||||||||||||
Sbjct: 3328076 ctcctcctcgtcctcctcgg 3328095



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     tcagaaatacataggcaaag 204
               ||||||||||||||||||||
Sbjct: 2715041 tcagaaatacataggcaaag 2715022



to top

>emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0003B01,
              complete sequence
          Length = 153643

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     ctcctcctcgtcctcctcgg 109
              ||||||||||||||||||||
Sbjct: 105299 ctcctcctcgtcctcctcgg 105318



to top

>gb|AF469109.1| Mus musculus SDS3 mRNA, complete cds
          Length = 2373

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 211 ccaactcctcctcgtcctcc 192



to top

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 241    ggaggcgtgttgtggtcttg 260
              ||||||||||||||||||||
Sbjct: 142340 ggaggcgtgttgtggtcttg 142321



to top

>ref|NM_134584.2| Drosophila melanogaster CG32512-RA (CG32512), mRNA
          Length = 2197

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544



to top

>dbj|AK138947.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
           enriched library, clone:A530026J10 product:SDS3, full
           insert sequence
          Length = 2369

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 222 ccaactcctcctcgtcctcc 203



to top

>dbj|AK150633.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830012P03 product:SDS3, full
           insert sequence
          Length = 2356

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 209 ccaactcctcctcgtcctcc 190



to top

>gb|AY060370.1| Drosophila melanogaster LD23009 full length cDNA
          Length = 3563

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 525 ctcctcctcgtcctcctcgg 544



to top

>dbj|AK010274.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400003N08 product:weakly similar to CG14220
           PROTEIN [Drosophila melanogaster], full insert sequence
          Length = 1568

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 174 ccaactcctcctcgtcctcc 155



to top

>gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosome 6, complete sequence
          Length = 171057

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 36    cagatcagaggtcgaatccaaacc 59
             ||||||||||||| ||||||||||
Sbjct: 82273 cagatcagaggtccaatccaaacc 82296



to top

>dbj|AK045475.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230206B20
           product:hypothetical protein, full insert sequence
          Length = 2369

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 225 ccaactcctcctcgtcctcc 206



to top

>dbj|AK012162.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:2610528B18 product:hydroxysteroid
            17-beta dehydrogenase 1, full insert sequence
          Length = 1306

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 226  ctcagaagagtgggaggagg 245
            ||||||||||||||||||||
Sbjct: 1103 ctcagaagagtgggaggagg 1122



to top

>dbj|AK043652.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830015I06 product:FLJ00052
           PROTEIN (FRAGMENT) homolog [Homo sapiens], full insert
           sequence
          Length = 1607

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 214 ccaactcctcctcgtcctcc 195



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 90       ctcctcctcgtcctcctcgg 109
                ||||||||||||||||||||
Sbjct: 32586565 ctcctcctcgtcctcctcgg 32586584



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 84       cgccaactcctcctcgtcctcctc 107
                ||||| ||||||||||||||||||
Sbjct: 22605216 cgccacctcctcctcgtcctcctc 22605239



to top

>gb|AC016747.7| Homo sapiens BAC clone RP11-493E12 from 2, complete sequence
          Length = 152345

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 185    tcagaaatacataggcaaag 204
              ||||||||||||||||||||
Sbjct: 144173 tcagaaatacataggcaaag 144154



to top

>ref|NM_178622.3| Mus musculus RIKEN cDNA 2400003N08 gene (2400003N08Rik), mRNA
          Length = 2373

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  ccaactcctcctcgtcctcc 105
           ||||||||||||||||||||
Sbjct: 211 ccaactcctcctcgtcctcc 192



to top

>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome
          Length = 4202352

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 333     aataaccccattgatcagct 352
               ||||||||||||||||||||
Sbjct: 2226424 aataaccccattgatcagct 2226405



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 67      cgatggcgctgccgccgcgc 86
               ||||||||||||||||||||
Sbjct: 3765538 cgatggcgctgccgccgcgc 3765519



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 61      cgtcggcgatggcgctgccg 80
               ||||||||||||||||||||
Sbjct: 3012813 cgtcggcgatggcgctgccg 3012832



to top

>dbj|AP007273.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0035K09
          Length = 124866

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    cgccaactcctcctcgtcctcctc 107
             ||||| ||||||||||||||||||
Sbjct: 89168 cgccacctcctcctcgtcctcctc 89191



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 68      gatggcgctgccgccgcgcc 87
               ||||||||||||||||||||
Sbjct: 3346872 gatggcgctgccgccgcgcc 3346853



to top

>dbj|AP005966.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1047H05
          Length = 187273

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    cgccaactcctcctcgtcctcctc 107
             ||||| ||||||||||||||||||
Sbjct: 70625 cgccacctcctcctcgtcctcctc 70648



to top

>ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147
           (ENSANGG00000017834), partial mRNA
          Length = 619

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 520 ctcctcctcgtcctcctcgg 501



to top

>ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323
           (ENSANGG00000017834), partial mRNA
          Length = 694

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 556 ctcctcctcgtcctcctcgg 537



to top

>dbj|AK103423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128K14, full
           insert sequence
          Length = 3531

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 90  ctcctcctcgtcctcctcgg 109
           ||||||||||||||||||||
Sbjct: 114 ctcctcctcgtcctcctcgg 133



to top

>dbj|AK102042.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033081J05, full
           insert sequence
          Length = 2213

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 85  gccaactcctcctcgtcctcctcg 108
           |||||||||||||| |||||||||
Sbjct: 181 gccaactcctcctcctcctcctcg 158



to top

>dbj|AK070184.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023044E03, full
           insert sequence
          Length = 1210

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 90  ctcctcctcgtcctcctcgggttc 113
           ||||||||| ||||||||||||||
Sbjct: 216 ctcctcctcctcctcctcgggttc 239



to top

>dbj|AK068789.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013166J08, full
           insert sequence
          Length = 2426

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 89  actcctcctcgtcctcctcg 108
           ||||||||||||||||||||
Sbjct: 297 actcctcctcgtcctcctcg 278



to top

>emb|CR925778.5| Zebrafish DNA sequence from clone DKEY-63L2 in linkage group 10,
             complete sequence
          Length = 211740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 91    tcctcctcgtcctcctcgggttcc 114
             ||||||||||||||||||| ||||
Sbjct: 61642 tcctcctcgtcctcctcggcttcc 61619



to top

>gb|AE003569.4| Drosophila melanogaster chromosome X, section 70 of 74 of the complete
              sequence
          Length = 283558

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     ctcctcctcgtcctcctcgg 109
              ||||||||||||||||||||
Sbjct: 145287 ctcctcctcgtcctcctcgg 145268



to top

>dbj|AP004243.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-312N17, complete
             sequences
          Length = 167368

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    cctccctcctctcagatcag 43
             ||||||||||||||||||||
Sbjct: 36171 cctccctcctctcagatcag 36152



to top

>dbj|AP003965.2| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-31O9, complete
             sequence
          Length = 121852

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    aactcctcctcgtcctcctc 107
             ||||||||||||||||||||
Sbjct: 16733 aactcctcctcgtcctcctc 16714



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 90     ctcctcctcgtcctcctcgg 109
              ||||||||||||||||||||
Sbjct: 584069 ctcctcctcgtcctcctcgg 584050



to top

>gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, complete sequence
          Length = 187115

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 36     cagatcagaggtcgaatccaaacc 59
              ||||||||||||| ||||||||||
Sbjct: 185032 cagatcagaggtccaatccaaacc 185055



to top

>dbj|AP005233.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-211G23, complete
             sequence
          Length = 157200

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    aactcctcctcgtcctcctc 107
             ||||||||||||||||||||
Sbjct: 39696 aactcctcctcgtcctcctc 39677



to top

>emb|AL683878.9| Mouse DNA sequence from clone RP23-201G13 on chromosome 2, complete
             sequence
          Length = 195221

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 84    cgccaactcctcctcgtcctcctc 107
             ||||||||||||||| ||||||||
Sbjct: 25438 cgccaactcctcctcctcctcctc 25461



to top

>emb|AL672056.4| Mouse DNA sequence from clone RP23-467O2 on chromosome X, complete
              sequence
          Length = 150695

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 320    tgtcattgagaagaataacc 339
              ||||||||||||||||||||
Sbjct: 122565 tgtcattgagaagaataacc 122584


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,232,691
Number of Sequences: 3902068
Number of extensions: 4232691
Number of successful extensions: 100554
Number of sequences better than 10.0: 188
Number of HSP's better than 10.0 without gapping: 190
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99494
Number of HSP's gapped (non-prelim): 1060
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top