ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl18g04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosom... 48 0.018
2emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chro... 48 0.018
3gb|AC032044.28| Homo sapiens chromosome 17, clone RP11-818O24, c... 48 0.018
4dbj|AK149150.1| Mus musculus 2 days neonate sympathetic ganglion... 48 0.018
5emb|AL772358.6| Mouse DNA sequence from clone RP23-397K2 on chro... 48 0.018
6gb|AC109271.10| Mus musculus chromosome 1, clone RP23-353I19, co... 46 0.073
7gb|AC122287.4| Mus musculus BAC clone RP23-253A15 from 1, comple... 46 0.073
8ref|XM_391452.1| Gibberella zeae PH-1 chromosome linkage group 1... 44 0.29
9emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BA... 44 0.29
10emb|AL669986.1|NCB7N14 Neurospora crassa DNA linkage group II BA... 44 0.29
11gb|AC153769.3| Loxodonta africana clone VMRC15-397D22, complete ... 44 0.29
12gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, c... 42 1.1
13gb|AC122775.15| Mus musculus chromosome 5, clone RP24-191K3, com... 42 1.1
14gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete... 42 1.1
15ref|NM_028476.2| Mus musculus RIKEN cDNA 2610110G12 gene (261011... 42 1.1
16gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome... 42 1.1
17gb|BC030669.1| Mus musculus RIKEN cDNA 2610110G12 gene, mRNA (cD... 42 1.1
18gb|BC028847.1| Mus musculus RIKEN cDNA 2610110G12 gene, mRNA (cD... 42 1.1
19emb|AL162719.18| Human DNA sequence from clone RP11-461D23 on ch... 42 1.1
20emb|BX883048.1| Rattus norvegicus chromosome 20, major histocomp... 42 1.1
21dbj|AK164071.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 42 1.1
22dbj|AK133694.1| Mus musculus adult male pituitary gland cDNA, RI... 42 1.1
23gb|AC156833.2| Mus musculus BAC clone RP24-161C10 from chromosom... 42 1.1
24dbj|AK042804.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 42 1.1
25dbj|AK049682.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 42 1.1
26dbj|AK034725.1| Mus musculus 12 days embryo embryonic body betwe... 42 1.1
27dbj|AK028297.1| Mus musculus 17 days embryo head cDNA, RIKEN ful... 42 1.1
28dbj|AK011838.1| Mus musculus 10 days embryo whole body cDNA, RIK... 42 1.1
29dbj|AK011750.2| Mus musculus 10 days embryo whole body cDNA, RIK... 42 1.1
30dbj|AK011350.1| Mus musculus 10 days embryo whole body cDNA, RIK... 42 1.1
31dbj|AK014265.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 42 1.1
32gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 ... 42 1.1
33ref|NM_212498.1| Rattus norvegicus similar to RIKEN cDNA 2610110... 42 1.1
34gb|AC140217.3| Mus musculus BAC clone RP23-279O5 from 8, complet... 42 1.1
35emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chr... 42 1.1
36emb|AL606934.12| Mouse DNA sequence from clone RP23-138L21 on ch... 42 1.1
37emb|AL731698.10| Mouse DNA sequence from clone RP23-161B3 on chr... 42 1.1
38gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, co... 40 4.5
39gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome ... 40 4.5
40ref|NM_020400.4| Homo sapiens G protein-coupled receptor 92 (GPR... 40 4.5
41gb|AC124580.5| Mus musculus BAC clone RP23-114G7 from chromosome... 40 4.5
42gb|AC135892.1| Homo sapiens 12 BAC RP11-433J6 (Roswell Park Canc... 40 4.5
43gb|AC145864.2| Pan troglodytes BAC clone RP43-6L18 from 7, compl... 40 4.5
44gb|AC146264.3| Pan troglodytes BAC clone RP43-28O13 from 7, comp... 40 4.5
45gb|AC074389.8| Homo sapiens BAC clone RP11-510K8 from 7, complet... 40 4.5
46gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, co... 40 4.5
47emb|CR653950.2|CNS0F3K4 Tetraodon nigroviridis full-length cDNA 40 4.5
48gb|AC157380.6| Mus musculus chromosome 3, clone RP23-404C21, com... 40 4.5
49gb|AC109605.14| Mus musculus strain 129S6/SvEvTac clone rp22-470... 40 4.5
50emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chr... 40 4.5
51emb|AL133541.21| Human DNA sequence from clone RP1-126E20 on chr... 40 4.5
52emb|AL118510.6|HSJ858M22 Human DNA sequence from clone RP5-858M2... 40 4.5
53emb|AL050318.13|HSDJ977B1 Human DNA sequence from clone RP5-977B... 40 4.5
54emb|AL645802.11| Mouse DNA sequence from clone RP23-128D9 on chr... 40 4.5
55emb|AL645526.14| Mouse DNA sequence from clone RP23-60F20 on chr... 40 4.5
56gb|BC072394.1| Homo sapiens G protein-coupled receptor 92, mRNA ... 40 4.5
57emb|BX548005.11| Zebrafish DNA sequence from clone DKEY-105A17 i... 40 4.5
58gb|AC068763.11| Homo sapiens 3 BAC RP11-133K20 (Roswell Park Can... 40 4.5
59gb|AC093151.2| Homo sapiens chromosome 1 clone RP11-399E6, compl... 40 4.5
60gb|AC160981.2| Mus musculus BAC clone RP23-363D11 from chromosom... 40 4.5
61gb|AC092045.2| Homo sapiens chromosome 3 clone RP11-168J18, comp... 40 4.5
62dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
63dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
64dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
65gb|AC073263.5| Homo sapiens BAC clone RP11-287D1 from 2, complet... 40 4.5
66gb|AC096624.23| Mus musculus strain C57BL/6J chromosome 11 clone... 40 4.5
67dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
68dbj|AP003347.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
69gb|AC114489.2| Homo sapiens chromosome 1 clone RP11-114B7, compl... 40 4.5
70dbj|AP004039.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
71gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.5
72emb|AL731737.4|CNS08C7M Oryza sativa chromosome 12, . Partial se... 40 4.5
73emb|AL805955.26| Mouse DNA sequence from clone RP23-192A6 on chr... 40 4.5
74gb|AC151572.2| Mus musculus BAC clone RP23-388I22 from 1, comple... 40 4.5
75gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, comple... 40 4.5
76gb|AC145731.4| Mus musculus BAC clone RP24-499N24 from 9, comple... 40 4.5
77gb|AC004490.1|AC004490 Homo sapiens chromosome 19, cosmid R29381... 40 4.5
78emb|AL732615.15| Mouse DNA sequence from clone RP23-190O8 on chr... 40 4.5
79emb|AL672219.7| Mouse DNA sequence from clone RP23-456B9 on chro... 40 4.5
80gb|U04056.1|MMU04056 Mus musculus erythrocyte membrane protein b... 40 4.5
81gb|DQ063513.1| Crocodylus moreletii Chompy miniature inverted-re... 40 4.5
82gb|DQ063436.1| Crocodylus moreletii Chompy miniature inverted-re... 40 4.5 
>gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosome 1, complete sequence
          Length = 177793

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 193   cctctgggctgggctgggctgcct 216
             ||||||||||||||||||||||||
Sbjct: 83534 cctctgggctgggctgggctgcct 83511
to top
>emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chromosome 1 Contains part
             of the EPHB2 gene for EphB2 and a novel gene, complete
             sequence
          Length = 126589

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 190   gtccctctgggctgggctgggctg 213
             ||||||||||||||||||||||||
Sbjct: 99318 gtccctctgggctgggctgggctg 99295
to top
>gb|AC032044.28| Homo sapiens chromosome 17, clone RP11-818O24, complete sequence
          Length = 199656

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 190    gtccctctgggctgggctgggctg 213
              ||||||||||||||||||||||||
Sbjct: 169909 gtccctctgggctgggctgggctg 169886
to top
>dbj|AK149150.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120489C20
            product:phosphodiesterase 4B, cAMP specific, full insert
            sequence
          Length = 2349

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 196  ctgggctgggctgggctgcctcca 219
            ||||||||||||||||||||||||
Sbjct: 1715 ctgggctgggctgggctgcctcca 1738
to top
>emb|AL772358.6| Mouse DNA sequence from clone RP23-397K2 on chromosome 4, complete
              sequence
          Length = 173518

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 196    ctgggctgggctgggctgcctcca 219
              ||||||||||||||||||||||||
Sbjct: 132126 ctgggctgggctgggctgcctcca 132149
to top
>gb|AC109271.10| Mus musculus chromosome 1, clone RP23-353I19, complete sequence
          Length = 221001

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 191    tccctctgggctgggctgggctg 213
              |||||||||||||||||||||||
Sbjct: 180523 tccctctgggctgggctgggctg 180545
to top
>gb|AC122287.4| Mus musculus BAC clone RP23-253A15 from 1, complete sequence
          Length = 226926

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 191    tccctctgggctgggctgggctg 213
              |||||||||||||||||||||||
Sbjct: 199751 tccctctgggctgggctgggctg 199729
to top
>ref|XM_391452.1| Gibberella zeae PH-1 chromosome linkage group 14 hypothetical
           protein (FG11276.1) partial mRNA
          Length = 1905

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 88  accagacttcccctccatcatctacc 113
           |||||||||||| |||||||||||||
Sbjct: 965 accagacttcccgtccatcatctacc 990
to top
>emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BAC contig B23I4
          Length = 71047

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 196   ctgggctgggctgggctgcctc 217
             ||||||||||||||||||||||
Sbjct: 64816 ctgggctgggctgggctgcctc 64795
to top
>emb|AL669986.1|NCB7N14 Neurospora crassa DNA linkage group II BAC clone B7N14
          Length = 107947

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 196 ctgggctgggctgggctgcctc 217
           ||||||||||||||||||||||
Sbjct: 353 ctgggctgggctgggctgcctc 332
to top
>gb|AC153769.3| Loxodonta africana clone VMRC15-397D22, complete sequence
          Length = 129001

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 101    tccatcatctacctccagtccc 122
              ||||||||||||||||||||||
Sbjct: 122864 tccatcatctacctccagtccc 122843
to top
>gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, complete sequence
          Length = 172747

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 195    tctgggctgggctgggctgcctcca 219
              |||| ||||||||||||||||||||
Sbjct: 148442 tctgcgctgggctgggctgcctcca 148418
to top
>gb|AC122775.15| Mus musculus chromosome 5, clone RP24-191K3, complete sequence
          Length = 158766

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 193   cctctgggctgggctgggctg 213
             |||||||||||||||||||||
Sbjct: 82763 cctctgggctgggctgggctg 82743
to top
>gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete sequence
          Length = 174404

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 196   ctgggctgggctgggctgcctccac 220
             ||||||||||||| |||||||||||
Sbjct: 65278 ctgggctgggctgtgctgcctccac 65254
to top
>ref|NM_028476.2| Mus musculus RIKEN cDNA 2610110G12 gene (2610110G12Rik), mRNA
          Length = 1932

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 902 tctgcgctgggctgggctgcctcca 878
to top
>gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome 8, complete sequence
          Length = 209383

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 193   cctctgggctgggctgggctg 213
             |||||||||||||||||||||
Sbjct: 36265 cctctgggctgggctgggctg 36285
to top
>gb|BC030669.1| Mus musculus RIKEN cDNA 2610110G12 gene, mRNA (cDNA clone MGC:41232
           IMAGE:1246856), complete cds
          Length = 1361

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 902 tctgcgctgggctgggctgcctcca 878
to top
>gb|BC028847.1| Mus musculus RIKEN cDNA 2610110G12 gene, mRNA (cDNA clone MGC:25587
           IMAGE:4007862), complete cds
          Length = 1484

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 972 tctgcgctgggctgggctgcctcca 948
to top
>emb|AL162719.18| Human DNA sequence from clone RP11-461D23 on chromosome 6 Contains
            part of a putative novel transcript, complete sequence
          Length = 91219

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 311  ttgggtggaagggggaggagg 331
            |||||||||||||||||||||
Sbjct: 5001 ttgggtggaagggggaggagg 4981
to top
>emb|BX883048.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 7/11
          Length = 349943

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 195    tctgggctgggctgggctgcctcca 219
              |||| ||||||||||||||||||||
Sbjct: 120189 tctgcgctgggctgggctgcctcca 120213
to top
>dbj|AK164071.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430047P20 product:hypothetical
            protein, full insert sequence
          Length = 5775

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 248  tcttcttctttagctggtagc 268
            |||||||||||||||||||||
Sbjct: 2429 tcttcttctttagctggtagc 2449
to top
>dbj|AK133694.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330440H06 product:Hypothetical
           acyl-CoA N-acyltransferases homolog [Mus musculus], full
           insert sequence
          Length = 2036

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 970 tctgcgctgggctgggctgcctcca 946
to top
>gb|AC156833.2| Mus musculus BAC clone RP24-161C10 from chromosome 9, complete sequence
          Length = 166954

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 94    cttcccctccatcatctacctccagtccc 122
             ||||||||||||| ||| |||||||||||
Sbjct: 93257 cttcccctccatcttctccctccagtccc 93229
to top
>dbj|AK042804.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730025O12 product:similar to
           CDNA FLJ13158 FIS, CLONE NT2RP3003552 [Homo sapiens],
           full insert sequence
          Length = 1468

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 420 tctgcgctgggctgggctgcctcca 396
to top
>dbj|AK049682.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530024K23 product:hypothetical
           NAD(P)-binding Rossmann-fold domains structure
           containing protein, full insert sequence
          Length = 1903

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 874 tctgcgctgggctgggctgcctcca 850
to top
>dbj|AK034725.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430029B13 product:hypothetical Acyl-CoA
           N-acyltransferases (Nat) structure containing protein,
           full insert sequence
          Length = 1932

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 902 tctgcgctgggctgggctgcctcca 878
to top
>dbj|AK028297.1| Mus musculus 17 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3300002K08 product:hypothetical Acyl-CoA
           N-acyltransferases (Nat) structure containing protein,
           full insert sequence
          Length = 1389

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 983 tctgcgctgggctgggctgcctcca 959
to top
>dbj|AK011838.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610110G12 product:hypothetical
           protein, full insert sequence
          Length = 1431

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 982 tctgcgctgggctgggctgcctcca 958
to top
>dbj|AK011750.2| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610042N08 product:hypothetical
           Acyl-CoA N-acyltransferases (Nat) structure containing
           protein, full insert sequence
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 969 tctgcgctgggctgggctgcctcca 945
to top
>dbj|AK011350.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610008K08 product:hypothetical
           protein, full insert sequence
          Length = 1290

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 898 tctgcgctgggctgggctgcctcca 874
to top
>dbj|AK014265.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3110080J08 product:hypothetical Acyl-CoA
           N-acyltransferases (Nat) structure containing protein,
           full insert sequence
          Length = 2005

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 967 tctgcgctgggctgggctgcctcca 943
to top
>gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 of 74 of the complete
              sequence
          Length = 297236

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 196    ctgggctgggctgggctgcctccac 220
              ||||||||||||| |||||||||||
Sbjct: 239953 ctgggctgggctgtgctgcctccac 239929
to top
>ref|NM_212498.1| Rattus norvegicus similar to RIKEN cDNA 2610110G12 (RGD1303066),
           mRNA
          Length = 1424

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 195 tctgggctgggctgggctgcctcca 219
           |||| ||||||||||||||||||||
Sbjct: 972 tctgcgctgggctgggctgcctcca 948
to top
>gb|AC140217.3| Mus musculus BAC clone RP23-279O5 from 8, complete sequence
          Length = 224205

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 193    cctctgggctgggctgggctg 213
              |||||||||||||||||||||
Sbjct: 131205 cctctgggctgggctgggctg 131225
to top
>emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chromosome 17, complete
              sequence
          Length = 188873

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 195    tctgggctgggctgggctgcctcca 219
              |||| ||||||||||||||||||||
Sbjct: 125771 tctgcgctgggctgggctgcctcca 125795
to top
>emb|AL606934.12| Mouse DNA sequence from clone RP23-138L21 on chromosome 4, complete
             sequence
          Length = 211580

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 196   ctgggctgggctgggctgcct 216
             |||||||||||||||||||||
Sbjct: 51597 ctgggctgggctgggctgcct 51577
to top
>emb|AL731698.10| Mouse DNA sequence from clone RP23-161B3 on chromosome 2, complete
             sequence
          Length = 61072

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 196   ctgggctgggctgggctgcct 216
             |||||||||||||||||||||
Sbjct: 47231 ctgggctgggctgggctgcct 47211
to top
>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence
          Length = 190298

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 13609 ctgggctgggctgggctgcc 13628
to top
>gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome 8, complete sequence
          Length = 212711

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 101982 ctgggctgggctgggctgcc 101963
to top
>ref|NM_020400.4| Homo sapiens G protein-coupled receptor 92 (GPR92), mRNA
          Length = 2907

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 ctctgggctgggctgggctg 213
           ||||||||||||||||||||
Sbjct: 166 ctctgggctgggctgggctg 147
to top
>gb|AC124580.5| Mus musculus BAC clone RP23-114G7 from chromosome 12, complete sequence
          Length = 176245

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 312    tgggtggaagggggaggagg 331
              ||||||||||||||||||||
Sbjct: 116036 tgggtggaagggggaggagg 116017
to top
>gb|AC135892.1| Homo sapiens 12 BAC RP11-433J6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 56520

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 36039 ctctgggctgggctgggctg 36058
to top
>gb|AC145864.2| Pan troglodytes BAC clone RP43-6L18 from 7, complete sequence
          Length = 206128

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 153    ctcaccgctcagcctcctcacaag 176
              ||||||||| ||||||||||||||
Sbjct: 187009 ctcaccgctgagcctcctcacaag 186986
to top
>gb|AC146264.3| Pan troglodytes BAC clone RP43-28O13 from 7, complete sequence
          Length = 163276

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 153   ctcaccgctcagcctcctcacaag 176
             ||||||||| ||||||||||||||
Sbjct: 69339 ctcaccgctgagcctcctcacaag 69316
to top
>gb|AC074389.8| Homo sapiens BAC clone RP11-510K8 from 7, complete sequence
          Length = 195782

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 61321 ctgggctgggctgggctgcc 61340
to top
>gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, complete sequence
          Length = 211926

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 196    ctgggctgggctgggctgcctcca 219
              |||||||||||||||||| |||||
Sbjct: 130862 ctgggctgggctgggctggctcca 130839
to top
>emb|CR653950.2|CNS0F3K4 Tetraodon nigroviridis full-length cDNA
          Length = 1117

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 10  ctcacagctcttccagtccc 29
           ||||||||||||||||||||
Sbjct: 381 ctcacagctcttccagtccc 362
to top
>gb|AC157380.6| Mus musculus chromosome 3, clone RP23-404C21, complete sequence
          Length = 196528

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    tcatagaggagaggagcagc 55
             ||||||||||||||||||||
Sbjct: 82400 tcatagaggagaggagcagc 82381
to top
>gb|AC109605.14| Mus musculus strain 129S6/SvEvTac clone rp22-470o15 map 11, complete
              sequence
          Length = 170397

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 148249 ctgggctgggctgggctgcc 148268
to top
>emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chromosome 1 Contains the
             gene for a novel protein (FLJ90702, FLJ14997 and
             FLJ35904), a ribosomal protein S2 (RPS2) pseudogene and
             two CpG islands, complete sequence
          Length = 115043

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 13138 ctctgggctgggctgggctg 13119
to top
>emb|AL133541.21| Human DNA sequence from clone RP1-126E20 on chromosome 6 Contains the
             3' end of the BMP6 gene for bone morphogenetic protein 6,
             the gene for a novel protein similar to protein disulfide
             isomerases and a CpG island, complete sequence
          Length = 117952

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    agaggagcagcaaaacagga 64
             ||||||||||||||||||||
Sbjct: 28591 agaggagcagcaaaacagga 28610
to top
>emb|AL118510.6|HSJ858M22 Human DNA sequence from clone RP5-858M22 on chromosome 20 Contains
            part of the C20orf133 gene for chromosome 20 open reading
            frame 133 and the RPS10P2 gene for ribosomal protein S10
            pseudogene 2, complete sequence
          Length = 124114

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 40   agaggagaggagcagcaaaa 59
            ||||||||||||||||||||
Sbjct: 9238 agaggagaggagcagcaaaa 9257
to top
>emb|AL050318.13|HSDJ977B1 Human DNA sequence from clone RP5-977B1 on chromosome 20 Contains the
            3' end of the SLA2 gene for Src-like-adaptor 2, the
            HNRPA3P gene for heterogeneous nuclear ribonucleoprotein
            A3 pseudogene, the C20orf24 gene for chromosome 24 open
            reading frame 24 (putative RAB5-interacting protein), the
            TGIF2 gene for TGF(beta)-induced transcription factor 2,
            the MYRL2 gene for myosin regulatory light chain 2
            (smooth muscle variant), the 3' end of a novel gene
            (KIAA0964), a novel gene, and three CpG islands, complete
            sequence
          Length = 145068

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 196  ctgggctgggctgggctgcc 215
            ||||||||||||||||||||
Sbjct: 4391 ctgggctgggctgggctgcc 4372
to top
>emb|AL645802.11| Mouse DNA sequence from clone RP23-128D9 on chromosome 11 Contains the
             gene for olfactory receptor MOR275-2,  an olfactory
             receptor (MOR275-3) pseudogene, the gene for olfactory
             receptor MOR275-5, a novel gene (2210407C18Rik), the gene
             olfactory receptor MOR107-1, a novel gene (LOC216781), a
             novel olfactory receptor protein, a novel gene similar to
             olfactory receptor MOR285-1 (LOC216783),  a novel gene
             similar to olfactory receptor MOR285-2 (LOC216784), a
             novel gene similar to olfactory receptor MOR285-1
             (LOC194664), the gene for olfactory receptor MOR256-47 and
             a novel gene similar to olfactory receptor MOR285-1
             (LOC193147), complete sequence
          Length = 226520

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 88514 ctgggctgggctgggctgcc 88495
to top
>emb|AL645526.14| Mouse DNA sequence from clone RP23-60F20 on chromosome 11 Contains the 5'
              end of the Pemt gene for phosphatidylethanolamine
              N-methyltransferase, the 5' end of the Rai1 gene for
              retinoic acid induced 1, a novel gene (4930412M03Rik) and
              three CpG islands, complete sequence
          Length = 143708

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 113804 ctgggctgggctgggctgcc 113785
to top
>gb|BC072394.1| Homo sapiens G protein-coupled receptor 92, mRNA (cDNA clone
           MGC:87779 IMAGE:5751923), complete cds
          Length = 2907

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 ctctgggctgggctgggctg 213
           ||||||||||||||||||||
Sbjct: 166 ctctgggctgggctgggctg 147
to top
>emb|BX548005.11| Zebrafish DNA sequence from clone DKEY-105A17 in linkage group 6,
             complete sequence
          Length = 218236

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   gcttggtttggttcgctttg 289
             ||||||||||||||||||||
Sbjct: 49776 gcttggtttggttcgctttg 49757
to top
>gb|AC068763.11| Homo sapiens 3 BAC RP11-133K20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 180638

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 309   tcttgggtggaagggggagg 328
             ||||||||||||||||||||
Sbjct: 82927 tcttgggtggaagggggagg 82946
to top
>gb|AC093151.2| Homo sapiens chromosome 1 clone RP11-399E6, complete sequence
          Length = 188276

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 18134 ctgggctgggctgggctgcc 18153
to top
>gb|AC160981.2| Mus musculus BAC clone RP23-363D11 from chromosome 9, complete sequence
          Length = 175606

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 43854 ctctgggctgggctgggctg 43873
to top
>gb|AC092045.2| Homo sapiens chromosome 3 clone RP11-168J18, complete sequence
          Length = 171343

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 88755 ctgggctgggctgggctgcc 88736
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 194      ctctgggctgggctgggctg 213
                ||||||||||||||||||||
Sbjct: 20124951 ctctgggctgggctgggctg 20124932
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 313     gggtggaagggggaggaggc 332
               ||||||||||||||||||||
Sbjct: 6383818 gggtggaagggggaggaggc 6383837
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 195      tctgggctgggctgggctgc 214
                ||||||||||||||||||||
Sbjct: 28165763 tctgggctgggctgggctgc 28165782
to top
>gb|AC073263.5| Homo sapiens BAC clone RP11-287D1 from 2, complete sequence
          Length = 183279

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 20911 ctctgggctgggctgggctg 20930
to top
>gb|AC096624.23| Mus musculus strain C57BL/6J chromosome 11 clone rp23-326m22, complete
              sequence
          Length = 227682

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 160820 ctgggctgggctgggctgcc 160839
to top
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
           PAC clone:P0478H03
          Length = 167560

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 195 tctgggctgggctgggctgc 214
           ||||||||||||||||||||
Sbjct: 270 tctgggctgggctgggctgc 289
to top
>dbj|AP003347.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0445E10
          Length = 145912

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   tctgggctgggctgggctgc 214
             ||||||||||||||||||||
Sbjct: 49757 tctgggctgggctgggctgc 49776
to top
>gb|AC114489.2| Homo sapiens chromosome 1 clone RP11-114B7, complete sequence
          Length = 172876

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 80167 ctgggctgggctgggctgcc 80186
to top
>dbj|AP004039.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1006_D05
          Length = 128178

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   gggtggaagggggaggaggc 332
             ||||||||||||||||||||
Sbjct: 25811 gggtggaagggggaggaggc 25830
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 194      ctctgggctgggctgggctg 213
                ||||||||||||||||||||
Sbjct: 20051165 ctctgggctgggctgggctg 20051146
to top
>emb|AL731737.4|CNS08C7M Oryza sativa chromosome 12, . Partial sequence from BAC OSJNBa0054A12
             of library OSJNBa from chromosome 12 of cultivar
             Nipponbare of ssp. japonica of Oryza sativa (rice),
             complete sequence
          Length = 20149

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 12822 ctctgggctgggctgggctg 12841
to top
>emb|AL805955.26| Mouse DNA sequence from clone RP23-192A6 on chromosome 2, complete
             sequence
          Length = 182439

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   tcctccctgcattcttgggt 316
             ||||||||||||||||||||
Sbjct: 32691 tcctccctgcattcttgggt 32672
to top
>gb|AC151572.2| Mus musculus BAC clone RP23-388I22 from 1, complete sequence
          Length = 187409

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   tgggtggaagggggaggagg 331
             ||||||||||||||||||||
Sbjct: 46715 tgggtggaagggggaggagg 46696
to top
>gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, complete sequence
          Length = 158740

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 142769 ctgggctgggctgggctgcc 142750
to top
>gb|AC145731.4| Mus musculus BAC clone RP24-499N24 from 9, complete sequence
          Length = 211847

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   ctctgggctgggctgggctg 213
             ||||||||||||||||||||
Sbjct: 16191 ctctgggctgggctgggctg 16172
to top
>gb|AC004490.1|AC004490 Homo sapiens chromosome 19, cosmid R29381, complete sequence
          Length = 39143

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 196  ctgggctgggctgggctgcc 215
            ||||||||||||||||||||
Sbjct: 9249 ctgggctgggctgggctgcc 9268
to top
>emb|AL732615.15| Mouse DNA sequence from clone RP23-190O8 on chromosome 4, complete
              sequence
          Length = 189819

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    ctgggctgggctgggctgcc 215
              ||||||||||||||||||||
Sbjct: 136778 ctgggctgggctgggctgcc 136759
to top
>emb|AL672219.7| Mouse DNA sequence from clone RP23-456B9 on chromosome 9, complete
             sequence
          Length = 206125

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   ctgggctgggctgggctgcc 215
             ||||||||||||||||||||
Sbjct: 23423 ctgggctgggctgggctgcc 23442
to top
>gb|U04056.1|MMU04056 Mus musculus erythrocyte membrane protein band 4.2 (mur42) gene,
             complete cds
          Length = 21718

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     catcctcacagctcttccag 25
             ||||||||||||||||||||
Sbjct: 12096 catcctcacagctcttccag 12077
to top
>gb|DQ063513.1| Crocodylus moreletii Chompy miniature inverted-repeat transposable
           element, partial sequence
          Length = 566

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 ctctgggctgggctgggctg 213
           ||||||||||||||||||||
Sbjct: 372 ctctgggctgggctgggctg 391
to top
>gb|DQ063436.1| Crocodylus moreletii Chompy miniature inverted-repeat transposable
           element, partial sequence
          Length = 785

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 ctctgggctgggctgggctg 213
           ||||||||||||||||||||
Sbjct: 284 ctctgggctgggctgggctg 303


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,947,701
Number of Sequences: 3902068
Number of extensions: 4947701
Number of successful extensions: 95060
Number of sequences better than 10.0: 82
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94659
Number of HSP's gapped (non-prelim): 400
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top