ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl18b12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Can... 42 0.42
2gb|AC140023.13| Medicago truncatula clone mth2-32h4, complete se... 42 0.42
3gb|AC148238.4| Medicago truncatula clone mth2-4a11, complete seq... 42 0.42
4gb|AF076998.1|AF076998 HIV-1 isolate VI961 from Democratic Repub... 42 0.42
5ref|XM_847213.1| PREDICTED: Canis familiaris similar to sphingos... 40 1.6
6gb|AC139356.17| Medicago truncatula clone mth2-12c11, complete s... 40 1.6
7emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chr... 40 1.6
8emb|BX064339.1|CNS09LT3 Single read from an extremity of a full-... 40 1.6
9emb|BX032893.1|CNS08XJL Single read from an extremity of a full-... 40 1.6
10emb|BX030441.1|CNS08VNH Single read from an extremity of a full-... 40 1.6
11emb|BX020588.1|CNS08O1S Single read from an extremity of a full-... 40 1.6
12emb|BX012879.1|CNS08I3N Single read from an extremity of a full-... 40 1.6
13gb|AC093903.3| Homo sapiens BAC clone RP11-733C7 from 4, complet... 40 1.6
14gb|AC106878.3| Homo sapiens BAC clone RP11-648O9 from 4, complet... 40 1.6
15gb|AC151520.3| Medicago truncatula chromosome 2 BAC clone mte1-3... 40 1.6
16ref|XM_312784.2| Anopheles gambiae str. PEST ENSANGP00000020450 ... 40 1.6
17gb|AC005040.2|AC005040 Homo sapiens BAC clone RP11-519H15 from 2... 40 1.6
18emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-9... 40 1.6
19ref|XM_507907.1| PREDICTED: Pan troglodytes LOC450591 (LOC450591... 38 6.5
20gb|AC102150.10| Mus musculus chromosome 7, clone RP23-310N5, com... 38 6.5
21ref|XM_612993.2| PREDICTED: Bos taurus similar to sphingosine ki... 38 6.5
22gb|DQ062153.1| Spodoptera exigua chitin synthase A mRNA, complet... 38 6.5
23ref|XM_869354.1| PREDICTED: Bos taurus similar to Metabotropic g... 38 6.5
24gb|AC140355.3| Mus musculus BAC clone RP23-214D3 from chromosome... 38 6.5
25gb|U64840.1| Caenorhabditis elegans cosmid ZC317, complete sequence 38 6.5
26gb|AC163898.5| Mus musculus chromosome 7, clone RP24-108A5, comp... 38 6.5
27gb|AC115121.5| Mus musculus BAC clone RP23-204O13 from chromosom... 38 6.5
28gb|AY129024.1| Homo sapiens clone FP3361 unknown mRNA 38 6.5
29gb|AC121900.2| Mus musculus BAC clone RP24-167E15 from 7, comple... 38 6.5
30gb|AC005017.1| Homo sapiens BAC clone GS1-214N13 from 7, complet... 38 6.5
31emb|AL606537.10| Human DNA sequence from clone RP11-53A1 on chro... 38 6.5
32emb|BX572598.1| Rhodopseudomonas palustris CGA009 complete genom... 38 6.5
33emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, ... 38 6.5
34emb|AL035539.1|ATF22I13 Arabidopsis thaliana DNA chromosome 4, B... 38 6.5
35gb|AC103819.3| Homo sapiens chromosome 8, clone CTD-3056O22, com... 38 6.5
36emb|CR931811.1| Medicago truncatula chromosome 5 clone mte1-56a1... 38 6.5
37gb|AC021593.15| Homo sapiens chromosome 17, clone RP11-153A23, c... 38 6.5
38gb|AC020906.6| Homo sapiens chromosome 19 clone CTB-83J15, compl... 38 6.5
39dbj|AK127699.1| Homo sapiens cDNA FLJ45799 fis, clone NT2RI2023671 38 6.5
40dbj|AK125428.1| Homo sapiens cDNA FLJ43439 fis, clone OCBBF20303... 38 6.5
41dbj|AK092916.1| Homo sapiens cDNA FLJ35597 fis, clone SPLEN2008164 38 6.5
42gb|AC119416.15| Medicago truncatula clone mth2-31m16, complete s... 38 6.5
43gb|AC093300.3| Homo sapiens chromosome 5 clone RP11-560A7, compl... 38 6.5
44gb|AC079825.15| Homo sapiens 12q BAC RP11-176J16 (Roswell Park C... 38 6.5
45gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 38 6.5
46gb|S65124.1| c-myc [human, BL60 cell, Genomic Mutant, 1289 nt] 38 6.5
47gb|AC157214.2| Mus musculus BAC clone RP23-35J2 from chromosome ... 38 6.5
48gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 38 6.5
49gb|AY232835.1| Macaca mulatta c-Myc gene, partial sequence 38 6.5
50gb|AY214166.1| Homo sapiens v-myc myelocytomatosis viral oncogen... 38 6.5
51gb|AC098698.3| Papio anubis clone RP41-177A23, complete sequence 38 6.5
52gb|AC069558.5|AC069558 Genomic Sequence For Arabidopsis thaliana... 38 6.5
53gb|AC011700.5|AC011700 Homo sapiens Chromosome 1 BAC RP11-478J18... 38 6.5
54gb|AE005133.1| Halobacterium sp. NRC-1 section 164 of 170 of the... 38 6.5
55gb|AC154658.2| Mus musculus BAC clone RP23-155K19 from 9, comple... 38 6.5
56emb|X00196.1|HSMYCE12 Homo sapiens partial MYC gene for myc onco... 38 6.5
57gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, com... 38 6.5
58dbj|AP000798.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 38 6.5
59gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, comple... 38 6.5
60emb|AL935265.4| Zebrafish DNA sequence from clone DKEY-66M24, co... 38 6.5
61gb|M13930.1|HUMMYCPOB Human c-myc-P64 mRNA, initiating from prom... 38 6.5
62gb|M14206.1|HUMMYCEA1A Human c-myc oncogene, exon 1 38 6.5
63gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome... 38 6.5
64gb|M38057.1|CHPCMYC Chimpanzee c-myc proto-oncogene, complete cds 38 6.5
65gb|AC165139.11| Mus musculus chromosome 5, clone RP23-424H17, co... 38 6.5
66gb|J03253.1|HUMMYCTR Human unrearranged myc allele of SKW-3 onco... 38 6.5
67gb|M20605.1|HUMMYCTM Human translocation-associated myc allele o... 38 6.5
68gb|L00057.1|HUMMYCG02 Human (GH) germline c-myc proto-oncogene, ... 38 6.5
69gb|K00559.1|HUMMYCF01 Human fetal liver c-myc proto-oncogene, ex... 38 6.5
70gb|M12026.1|HUMMYCBLN Human myc oncogene (t8;22), exon 1 38 6.5
71gb|M12027.1|HUMMYCBLK Human c-myc oncogene t(8;22), exon 1 38 6.5
72gb|K01708.1|HUMMYCBL02 Human translocated t(8;14) c-myc (MYC) on... 38 6.5
73gb|M16261.1|HUMMYCB1 Human c-myc protein (MYC) oncogene, exon 1 38 6.5
74emb|AL096808.1|CNS00YVF Homo sapiens genomic region containing h... 38 6.5
75emb|X00247.1|HSMYC2 Human translocated c-myc gene in Raji Burkit... 38 6.5
76emb|X00364.2|HSMYCC Homo sapiens MYC gene for c-myc proto-oncoge... 38 6.5
77gb|J04105.1|HUMTRANSB Human translocation t(8;14) DNA 38 6.5
78gb|M22633.1|HUMRCMYC1 Human rearranged plasma cell myeloma c-myc... 38 6.5
79gb|K02280.1|HUMMYCRN Human (Raji) c-myc proto-oncogene, exon 1 38 6.5
80gb|K01910.1|HUMMYCL Human lymphoblastoid cell (8392) c-myc proto... 38 6.5
81gb|K01909.1|HUMMYCJB Human (JBL2B) translocated t(2;8) c-myc onc... 38 6.5
82gb|K03015.1|HUMMYCAWT Human (AW-Ramos) translocated t(8;14) c-my... 38 6.5
83gb|M20013.1|HUMBURKA Human burkitt lymphoma DNA, exon 1 and flan... 38 6.5
84gb|M88115.1|GIBMYCG Hylobates lar Myc gene, complete cds 38 6.5
85gb|AF315312.2| Homo sapiens chromosome 8 clone RP1-80K22 map 8q2... 38 6.5
86dbj|D10493.1|HUMMYCKOB Homo sapiens c-myc gene for p67 and p64 m... 38 6.5 
>gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 180936

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    ggatctccggcaggaggattt 96
             |||||||||||||||||||||
Sbjct: 57910 ggatctccggcaggaggattt 57930
to top
>gb|AC140023.13| Medicago truncatula clone mth2-32h4, complete sequence
          Length = 152468

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 99     tgctggttcttgctccatttt 119
              |||||||||||||||||||||
Sbjct: 143677 tgctggttcttgctccatttt 143657
to top
>gb|AC148238.4| Medicago truncatula clone mth2-4a11, complete sequence
          Length = 98424

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   tgctggttcttgctccatttt 119
            |||||||||||||||||||||
Sbjct: 8028 tgctggttcttgctccatttt 8008
to top
>gb|AF076998.1|AF076998 HIV-1 isolate VI961 from Democratic Republic of the Congo, complete
            genome
          Length = 8990

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 8    caaggatcttttttcttttcctgga 32
            |||||||||||| ||||||||||||
Sbjct: 8496 caaggatcttttgtcttttcctgga 8472
to top
>ref|XM_847213.1| PREDICTED: Canis familiaris similar to sphingosine kinase type
            1-interacting protein (LOC609866), mRNA
          Length = 4983

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  ttcttgctccattttgagcc 124
            ||||||||||||||||||||
Sbjct: 1521 ttcttgctccattttgagcc 1502
to top
>gb|AC139356.17| Medicago truncatula clone mth2-12c11, complete sequence
          Length = 120921

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      agcaaggatcttttttcttt 25
              ||||||||||||||||||||
Sbjct: 112397 agcaaggatcttttttcttt 112416
to top
>emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chromosome 1 Contains
              putative novel transcript, complete sequence
          Length = 174648

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     atcttttttcttttcctgga 32
              ||||||||||||||||||||
Sbjct: 153847 atcttttttcttttcctgga 153828
to top
>emb|BX064339.1|CNS09LT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 82  ccggcaggaggatttggtgctggt 105
           ||||||||||||| ||||||||||
Sbjct: 116 ccggcaggaggatgtggtgctggt 93
to top
>emb|BX032893.1|CNS08XJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 82  ccggcaggaggatttggtgctggt 105
           ||||||||||||| ||||||||||
Sbjct: 90  ccggcaggaggatgtggtgctggt 67
to top
>emb|BX030441.1|CNS08VNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 82  ccggcaggaggatttggtgctggt 105
           ||||||||||||| ||||||||||
Sbjct: 85  ccggcaggaggatgtggtgctggt 62
to top
>emb|BX020588.1|CNS08O1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 82  ccggcaggaggatttggtgctggt 105
           ||||||||||||| ||||||||||
Sbjct: 110 ccggcaggaggatgtggtgctggt 87
to top
>emb|BX012879.1|CNS08I3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 82  ccggcaggaggatttggtgctggt 105
           ||||||||||||| ||||||||||
Sbjct: 90  ccggcaggaggatgtggtgctggt 67
to top
>gb|AC093903.3| Homo sapiens BAC clone RP11-733C7 from 4, complete sequence
          Length = 161280

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     tcttttttcttttcctggat 33
              ||||||||||||||||||||
Sbjct: 140598 tcttttttcttttcctggat 140617
to top
>gb|AC106878.3| Homo sapiens BAC clone RP11-648O9 from 4, complete sequence
          Length = 135342

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    aggatcttttttcttttcct 29
             ||||||||||||||||||||
Sbjct: 50535 aggatcttttttcttttcct 50516
to top
>gb|AC151520.3| Medicago truncatula chromosome 2 BAC clone mte1-34o12, complete
            sequence
          Length = 105113

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 6    agcaaggatcttttttcttt 25
            ||||||||||||||||||||
Sbjct: 6773 agcaaggatcttttttcttt 6792
to top
>ref|XM_312784.2| Anopheles gambiae str. PEST ENSANGP00000020450 (ENSANGG00000017961),
            mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 82   ccggcaggaggatttggtgctggt 105
            ||||||||||||| ||||||||||
Sbjct: 1603 ccggcaggaggatgtggtgctggt 1626
to top
>gb|AC005040.2|AC005040 Homo sapiens BAC clone RP11-519H15 from 2, complete sequence
          Length = 189949

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ttttttcttttcctggattt 35
             ||||||||||||||||||||
Sbjct: 19310 ttttttcttttcctggattt 19291
to top
>emb|AL049869.6|CNS0000P Human chromosome 14 DNA sequence BAC R-973N13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195840

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    ggatcttttttcttttcctg 30
             ||||||||||||||||||||
Sbjct: 67781 ggatcttttttcttttcctg 67800
to top
>ref|XM_507907.1| PREDICTED: Pan troglodytes LOC450591 (LOC450591), mRNA
          Length = 1321

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 65  tggcggcggctggatctccggcaggag 91
           |||| ||||||||| ||||||||||||
Sbjct: 295 tggctgcggctggagctccggcaggag 321
to top
>gb|AC102150.10| Mus musculus chromosome 7, clone RP23-310N5, complete sequence
          Length = 182393

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     tttttcttttcctggattt 35
              |||||||||||||||||||
Sbjct: 160728 tttttcttttcctggattt 160746
to top
>ref|XM_612993.2| PREDICTED: Bos taurus similar to sphingosine kinase type
            1-interacting protein (LOC540759), partial mRNA
          Length = 4457

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 103  ggttcttgctccattttga 121
            |||||||||||||||||||
Sbjct: 1568 ggttcttgctccattttga 1550
to top
>gb|DQ062153.1| Spodoptera exigua chitin synthase A mRNA, complete cds
          Length = 5207

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 44   tctgtctggaaaatcttgg 62
            |||||||||||||||||||
Sbjct: 1065 tctgtctggaaaatcttgg 1083
to top
>ref|XM_869354.1| PREDICTED: Bos taurus similar to Metabotropic glutamate receptor 5
           precursor (mGluR5) (LOC617153), mRNA
          Length = 1026

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  ggcggcggctggatctccg 84
           |||||||||||||||||||
Sbjct: 599 ggcggcggctggatctccg 581
to top
>gb|AC140355.3| Mus musculus BAC clone RP23-214D3 from chromosome 9, complete sequence
          Length = 221753

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 15     cttttttcttttcctggat 33
              |||||||||||||||||||
Sbjct: 120661 cttttttcttttcctggat 120679
to top
>gb|U64840.1| Caenorhabditis elegans cosmid ZC317, complete sequence
          Length = 26291

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 8    caaggatcttttttctttt 26
            |||||||||||||||||||
Sbjct: 1171 caaggatcttttttctttt 1189
to top
>gb|AC163898.5| Mus musculus chromosome 7, clone RP24-108A5, complete sequence
          Length = 143726

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 15     cttttttcttttcctggat 33
              |||||||||||||||||||
Sbjct: 128637 cttttttcttttcctggat 128655
to top
>gb|AC115121.5| Mus musculus BAC clone RP23-204O13 from chromosome 19, complete
             sequence
          Length = 227154

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    tttttcttttcctggattt 35
             |||||||||||||||||||
Sbjct: 44679 tttttcttttcctggattt 44697
to top
>gb|AY129024.1| Homo sapiens clone FP3361 unknown mRNA
          Length = 3046

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    aagcaaggatcttttttct 23
            |||||||||||||||||||
Sbjct: 2211 aagcaaggatcttttttct 2193
to top
>gb|AC121900.2| Mus musculus BAC clone RP24-167E15 from 7, complete sequence
          Length = 170266

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    tttttcttttcctggattt 35
             |||||||||||||||||||
Sbjct: 63939 tttttcttttcctggattt 63957
to top
>gb|AC005017.1| Homo sapiens BAC clone GS1-214N13 from 7, complete sequence
          Length = 137176

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     tcttttttcttttcctgga 32
              |||||||||||||||||||
Sbjct: 100701 tcttttttcttttcctgga 100719
to top
>emb|AL606537.10| Human DNA sequence from clone RP11-53A1 on chromosome 1 Contains the 3'
             end of the PROX1 gene for prospero-related homeobox
             protein 1, complete sequence
          Length = 116821

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 11    ggatcttttttcttttcct 29
             |||||||||||||||||||
Sbjct: 37804 ggatcttttttcttttcct 37786
to top
>emb|BX572598.1| Rhodopseudomonas palustris CGA009 complete genome; segment 6/16
          Length = 346879

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    cggcggctggatctccggc 86
             |||||||||||||||||||
Sbjct: 76258 cggcggctggatctccggc 76276
to top
>emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 89
          Length = 199789

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    gatcttttttcttttcctg 30
             |||||||||||||||||||
Sbjct: 82292 gatcttttttcttttcctg 82274
to top
>emb|AL035539.1|ATF22I13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F22I13 (ESSA project)
          Length = 93760

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    gatcttttttcttttcctg 30
             |||||||||||||||||||
Sbjct: 41335 gatcttttttcttttcctg 41317
to top
>gb|AC103819.3| Homo sapiens chromosome 8, clone CTD-3056O22, complete sequence
          Length = 148021

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    aggatcttttttcttttcc 28
             |||||||||||||||||||
Sbjct: 87596 aggatcttttttcttttcc 87578
to top
>emb|CR931811.1| Medicago truncatula chromosome 5 clone mte1-56a16, COMPLETE SEQUENCE
          Length = 88536

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 14    tcttttttcttttcctggatttg 36
             |||||||||||||| ||||||||
Sbjct: 48338 tcttttttcttttcttggatttg 48316
to top
>gb|AC021593.15| Homo sapiens chromosome 17, clone RP11-153A23, complete sequence
          Length = 177738

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aagcaaggatcttttttct 23
             |||||||||||||||||||
Sbjct: 78470 aagcaaggatcttttttct 78452
to top
>gb|AC020906.6| Homo sapiens chromosome 19 clone CTB-83J15, complete sequence
          Length = 110184

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     aaggatcttttttcttttc 27
             |||||||||||||||||||
Sbjct: 73160 aaggatcttttttcttttc 73178
to top
>dbj|AK127699.1| Homo sapiens cDNA FLJ45799 fis, clone NT2RI2023671
          Length = 2240

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    aagcaaggatcttttttct 23
            |||||||||||||||||||
Sbjct: 1702 aagcaaggatcttttttct 1684
to top
>dbj|AK125428.1| Homo sapiens cDNA FLJ43439 fis, clone OCBBF2030354, highly  similar
           to Mus musculus pantothenate kinase 1 beta (panK1beta)
           mRNA
          Length = 2780

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 65  tggcggcggctggatctccggcaggag 91
           |||| ||||||||| ||||||||||||
Sbjct: 473 tggctgcggctggagctccggcaggag 447
to top
>dbj|AK092916.1| Homo sapiens cDNA FLJ35597 fis, clone SPLEN2008164
          Length = 2264

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    aagcaaggatcttttttct 23
            |||||||||||||||||||
Sbjct: 1524 aagcaaggatcttttttct 1506
to top
>gb|AC119416.15| Medicago truncatula clone mth2-31m16, complete sequence
          Length = 120889

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 87    aggaggatttggtgctggt 105
             |||||||||||||||||||
Sbjct: 60318 aggaggatttggtgctggt 60336
to top
>gb|AC093300.3| Homo sapiens chromosome 5 clone RP11-560A7, complete sequence
          Length = 127140

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 16    ttttttcttttcctggatt 34
             |||||||||||||||||||
Sbjct: 38562 ttttttcttttcctggatt 38544
to top
>gb|AC079825.15| Homo sapiens 12q BAC RP11-176J16 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 36875

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 1    tcccaagcaaggatcttttttcttttc 27
            |||||||||||| ||||||||| ||||
Sbjct: 9010 tcccaagcaaggctcttttttcctttc 9036
to top
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 41     ggttctgtctggaaaatct 59
              |||||||||||||||||||
Sbjct: 592297 ggttctgtctggaaaatct 592279
to top
>gb|S65124.1| c-myc [human, BL60 cell, Genomic Mutant, 1289 nt]
          Length = 1289

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 aggatcttttttcttttcc 28
          |||||||||||||||||||
Sbjct: 47 aggatcttttttcttttcc 29
to top
>gb|AC157214.2| Mus musculus BAC clone RP23-35J2 from chromosome 19, complete sequence
          Length = 207625

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     tttttcttttcctggattt 35
              |||||||||||||||||||
Sbjct: 141311 tttttcttttcctggattt 141329
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 68      cggcggctggatctccggc 86
               |||||||||||||||||||
Sbjct: 4457071 cggcggctggatctccggc 4457053
to top
>gb|AY232835.1| Macaca mulatta c-Myc gene, partial sequence
          Length = 1353

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 144 aggatcttttttcttttcc 126
to top
>gb|AY214166.1| Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian)
            (MYC) gene, complete cds
          Length = 8617

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 1815 aggatcttttttcttttcc 1797
to top
>gb|AC098698.3| Papio anubis clone RP41-177A23, complete sequence
          Length = 165334

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    tcttttttcttttcctgga 32
             |||||||||||||||||||
Sbjct: 79092 tcttttttcttttcctgga 79110
to top
>gb|AC069558.5|AC069558 Genomic Sequence For Arabidopsis thaliana Clone T5G13 From Chromosome
             IV, complete sequence
          Length = 107740

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    gatcttttttcttttcctg 30
             |||||||||||||||||||
Sbjct: 83233 gatcttttttcttttcctg 83251
to top
>gb|AC011700.5|AC011700 Homo sapiens Chromosome 1 BAC RP11-478J18 (Roswell Park Cancer
             Institute Human BAC Library) complete sequence
          Length = 154732

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    ggatcttttttcttttcct 29
             |||||||||||||||||||
Sbjct: 45228 ggatcttttttcttttcct 45246
to top
>gb|AE005133.1| Halobacterium sp. NRC-1 section 164 of 170 of the complete genome
          Length = 12130

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 71   cggctggatctccggcagg 89
            |||||||||||||||||||
Sbjct: 3852 cggctggatctccggcagg 3870
to top
>gb|AC154658.2| Mus musculus BAC clone RP23-155K19 from 9, complete sequence
          Length = 205427

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    cttttttcttttcctggat 33
             |||||||||||||||||||
Sbjct: 28143 cttttttcttttcctggat 28161
to top
>emb|X00196.1|HSMYCE12 Homo sapiens partial MYC gene for myc oncogene, exons 1-2 and
           joined CDS
          Length = 3324

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 312 aggatcttttttcttttcc 294
to top
>gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, complete sequence
          Length = 253504

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                             
Query: 27     cctggatttggcccggttctgtctggaaaat 57
              ||||||| || |||||||||||| |||||||
Sbjct: 152012 cctggatctgccccggttctgtcaggaaaat 151982
to top
>dbj|AP000798.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-43E2, complete
             sequences
          Length = 113054

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    tcttttttcttttcctgga 32
             |||||||||||||||||||
Sbjct: 30451 tcttttttcttttcctgga 30433
to top
>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence
          Length = 204848

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     tcttttttcttttcctgga 32
              |||||||||||||||||||
Sbjct: 165084 tcttttttcttttcctgga 165102
to top
>emb|AL935265.4| Zebrafish DNA sequence from clone DKEY-66M24, complete sequence
          Length = 197137

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    gatcttttttcttttcctggatt 34
             ||||||||||||||| |||||||
Sbjct: 73474 gatcttttttctttttctggatt 73452
to top
>gb|M13930.1|HUMMYCPOB Human c-myc-P64 mRNA, initiating from promoter P0, (HLmyc3.1)
           partial cds
          Length = 2041

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 578 aggatcttttttcttttcc 560
to top
>gb|M14206.1|HUMMYCEA1A Human c-myc oncogene, exon 1
          Length = 712

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 aggatcttttttcttttcc 28
          |||||||||||||||||||
Sbjct: 47 aggatcttttttcttttcc 29
to top
>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    tcttttttcttttcctgga 32
             |||||||||||||||||||
Sbjct: 15041 tcttttttcttttcctgga 15059
to top
>gb|M38057.1|CHPCMYC Chimpanzee c-myc proto-oncogene, complete cds
          Length = 6911

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 1099 aggatcttttttcttttcc 1081
to top
>gb|AC165139.11| Mus musculus chromosome 5, clone RP23-424H17, complete sequence
          Length = 176075

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    cttttttcttttcctggat 33
             |||||||||||||||||||
Sbjct: 12427 cttttttcttttcctggat 12445
to top
>gb|J03253.1|HUMMYCTR Human unrearranged myc allele of SKW-3 oncogene, complete cds
          Length = 2220

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 1540 aggatcttttttcttttcc 1522
to top
>gb|M20605.1|HUMMYCTM Human translocation-associated myc allele of SKW-3 oncogene, complete
            cds
          Length = 2222

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 1542 aggatcttttttcttttcc 1524
to top
>gb|L00057.1|HUMMYCG02 Human (GH) germline c-myc proto-oncogene, 5' flank through exon 2
          Length = 3605

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 591 aggatcttttttcttttcc 573
to top
>gb|K00559.1|HUMMYCF01 Human fetal liver c-myc proto-oncogene, exon 1 and flanks
          Length = 1365

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 125 aggatcttttttcttttcc 107
to top
>gb|M12026.1|HUMMYCBLN Human myc oncogene (t8;22), exon 1
          Length = 1189

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 293 aggatcttttttcttttcc 275
to top
>gb|M12027.1|HUMMYCBLK Human c-myc oncogene t(8;22), exon 1
          Length = 1162

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 290 aggatcttttttcttttcc 272
to top
>gb|K01708.1|HUMMYCBL02 Human translocated t(8;14) c-myc (MYC) oncogene, 5' flank and exon
           1
          Length = 910

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 191 aggatcttttttcttttcc 173
to top
>gb|M16261.1|HUMMYCB1 Human c-myc protein (MYC) oncogene, exon 1
          Length = 2891

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 1624 aggatcttttttcttttcc 1606
to top
>emb|AL096808.1|CNS00YVF Homo sapiens genomic region containing hypervariable minisatellites
             chromosome 17[17q25] of Homo sapiens
          Length = 37026

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aagcaaggatcttttttct 23
             |||||||||||||||||||
Sbjct: 34272 aagcaaggatcttttttct 34254
to top
>emb|X00247.1|HSMYC2 Human translocated c-myc gene in Raji Burkitt lymphoma cells
          Length = 3922

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 346 aggatcttttttcttttcc 328
to top
>emb|X00364.2|HSMYCC Homo sapiens MYC gene for c-myc proto-oncogene and ORF1
          Length = 10996

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 2270 aggatcttttttcttttcc 2252
to top
>gb|J04105.1|HUMTRANSB Human translocation t(8;14) DNA
          Length = 1586

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 592 aggatcttttttcttttcc 574
to top
>gb|M22633.1|HUMRCMYC1 Human rearranged plasma cell myeloma c-myc gene, exon 1
          Length = 1098

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 275 aggatcttttttcttttcc 257
to top
>gb|K02280.1|HUMMYCRN Human (Raji) c-myc proto-oncogene, exon 1
          Length = 480

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 aggatcttttttcttttcc 28
          |||||||||||||||||||
Sbjct: 83 aggatcttttttcttttcc 65
to top
>gb|K01910.1|HUMMYCL Human lymphoblastoid cell (8392) c-myc proto-oncogene, 5' flank
          Length = 2500

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 2233 aggatcttttttcttttcc 2215
to top
>gb|K01909.1|HUMMYCJB Human (JBL2B) translocated t(2;8) c-myc oncogene, exon 1
          Length = 1631

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 887 aggatcttttttcttttcc 869



 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 aggatcttttttcttttcc 28
          |||||||||||||||||||
Sbjct: 47 aggatcttttttcttttcc 29
to top
>gb|K03015.1|HUMMYCAWT Human (AW-Ramos) translocated t(8;14) c-myc oncogene, exon 1
          Length = 1013

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 336 aggatcttttttcttttcc 318
to top
>gb|M20013.1|HUMBURKA Human burkitt lymphoma DNA, exon 1 and flanking regions
          Length = 1222

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 10 aggatcttttttcttttcc 28
          |||||||||||||||||||
Sbjct: 22 aggatcttttttcttttcc 4
to top
>gb|M88115.1|GIBMYCG Hylobates lar Myc gene, complete cds
          Length = 6593

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 10  aggatcttttttcttttcc 28
           |||||||||||||||||||
Sbjct: 775 aggatcttttttcttttcc 757
to top
>gb|AF315312.2| Homo sapiens chromosome 8 clone RP1-80K22 map 8q24.3, complete sequence
          Length = 149172

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    aggatcttttttcttttcc 28
             |||||||||||||||||||
Sbjct: 67352 aggatcttttttcttttcc 67370
to top
>dbj|D10493.1|HUMMYCKOB Homo sapiens c-myc gene for p67 and p64 myc proteins, partial and
            complete cds
          Length = 8056

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   aggatcttttttcttttcc 28
            |||||||||||||||||||
Sbjct: 2268 aggatcttttttcttttcc 2250


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,625,275
Number of Sequences: 3902068
Number of extensions: 2625275
Number of successful extensions: 253881
Number of sequences better than 10.0: 86
Number of HSP's better than 10.0 without gapping: 86
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 253611
Number of HSP's gapped (non-prelim): 270
length of query: 137
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 116
effective length of database: 17,151,101,840
effective search space: 1989527813440
effective search space used: 1989527813440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top