Clone Name | bastl18b10 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome | 36 | 4.0 | 2 | emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... | 36 | 4.0 | 3 | gb|AE015451.1| Pseudomonas putida KT2440 complete genome | 36 | 4.0 |
---|
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 36.2 bits (18), Expect = 4.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 6 ctcggccatggctaagacgaag 27 |||||||||||| ||||||||| Sbjct: 1409974 ctcggccatggcgaagacgaag 1409995
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 19 aagacgaagccgatggca 36 |||||||||||||||||| Sbjct: 1759288 aagacgaagccgatggca 1759271
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 36.2 bits (18), Expect = 4.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 19 aagacgaagccgatggca 36 |||||||||||||||||| Sbjct: 2263299 aagacgaagccgatggca 2263282 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 147,448 Number of Sequences: 3902068 Number of extensions: 147448 Number of successful extensions: 33978 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33741 Number of HSP's gapped (non-prelim): 237 length of query: 38 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 18 effective length of database: 17,155,003,908 effective search space: 308790070344 effective search space used: 308790070344 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)