ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl17f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK101405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 315 7e-83
2dbj|AK101166.1| Oryza sativa (japonica cultivar-group) cDNA clon... 315 7e-83
3ref|XM_471058.1| Oryza sativa (japonica cultivar-group), predic... 303 3e-79
4gb|AY103807.1| Zea mays PCO130571 mRNA sequence 297 2e-77
5ref|XM_465992.1| Oryza sativa (japonica cultivar-group), mRNA 293 2e-76
6dbj|AK100313.1| Oryza sativa (japonica cultivar-group) cDNA clon... 293 2e-76
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 228 1e-56
8dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D... 228 1e-56
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 220 3e-54
10emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4,... 220 3e-54
11ref|NM_191153.1| Oryza sativa (japonica cultivar-group), predic... 212 7e-52
12dbj|AK063421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 7e-52
13dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
14dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
15gb|BT012802.1| Lycopersicon esculentum clone 113818R, mRNA sequence 137 3e-29
16ref|NM_179487.1| Arabidopsis thaliana LOS1; GTP binding / transl... 131 2e-27
17gb|BT000722.1| Arabidopsis thaliana clone RAFL07-10-D07 (R10647)... 131 2e-27
18gb|BT000661.1| Arabidopsis thaliana clone RAFL08-12-J19 (R11046)... 131 2e-27
19gb|AF367331.1| Arabidopsis thaliana At1g56070/T6H22_13 mRNA, com... 131 2e-27
20gb|AY054461.1| Arabidopsis thaliana elongation factor EF-2 (At1g... 131 2e-27
21gb|BT002714.1| Arabidopsis thaliana At1g56070/T6H22_13 gene, com... 131 2e-27
22emb|Z97178.1|BVRNAEF2 Beta vulgaris cDNA for elongation factor 2 119 8e-24
23dbj|AB026645.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 100 7e-18
24gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genom... 78 3e-11
25gb|AC146817.10| Medicago truncatula clone mth2-8c19, complete se... 76 1e-10
26gb|AF240824.1| Nipponopsalis abei elongation factor-2 mRNA, part... 76 1e-10
27emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, comple... 70 7e-09
28ref|NM_060056.3| Caenorhabditis elegans Elongation FacTor family... 70 7e-09
29gb|M86959.1|CELEFT2A Caenorhabditis elegans elongation factor (e... 70 7e-09
30gb|AY305496.1| Carcinoscorpius rotundicauda voucher Cro elongati... 68 3e-08
31gb|AF240821.1| Limulus polyphemus elongation factor-2 mRNA, part... 68 3e-08
32emb|AL122032.1|SPAC513 S.pombe chromosome I cosmid c513 66 1e-07
33emb|AL121859.1|SPCP31B10 S.pombe chromosome III p1 p31B10 66 1e-07
34ref|NM_001022856.1| Schizosaccharomyces pombe 972h- hypothetical... 66 1e-07
35ref|NM_001019401.1| Schizosaccharomyces pombe 972h- elongation f... 66 1e-07
36dbj|D83976.1| Schizosaccharomyces pombe DNA for elongation facto... 66 1e-07
37dbj|D83975.1| Schizosaccharomyces pombe DNA for elongation facto... 66 1e-07
38gb|AY305525.1| Trachyiulus nordquisti voucher Tnor elongation fa... 64 4e-07
39gb|AY064104.1| Aedes aegypti clone EF2Mc2 elongation factor 2 (E... 64 4e-07
40gb|AY064103.1| Aedes aegypti clone EF2Rc2 elongation factor 2 (E... 64 4e-07
41gb|AY040342.1| Aedes aegypti elongation factor 2 (Ef-2) mRNA, co... 64 4e-07
42gb|AF331798.1|AF331798 Aedes aegypti elongation factor 2 (Ef-2) ... 64 4e-07
43gb|AY737540.1| Toxoptera citricida putative translation elongati... 62 2e-06
44gb|AF240826.1| Polyxenus fasciculatus elongation factor-2 mRNA, ... 60 6e-06
45gb|M68064.1|CHLEF2 Chlorella kessleri elongation factor 2 mRNA, ... 60 6e-06
46ref|XM_792306.1| PREDICTED: Strongylocentrotus purpuratus simila... 58 3e-05
47dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
48dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
49dbj|AK102586.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
50dbj|AK073592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
51gb|AY613900.1| Mesenchytraeus solifugus clone A195 translation e... 56 1e-04
52gb|AC150552.1| Drosophila melanogaster clone BACR12I17, complete... 56 1e-04
53ref|XM_389750.1| Gibberella zeae PH-1 chromosome 4 EF2_NEUCR Elo... 56 1e-04
54emb|X15805.1|DMEF2 Drosophila DMEF2 gene for the translation elo... 56 1e-04
55ref|NM_165395.1| Drosophila melanogaster Elongation factor 2b CG... 56 1e-04
56ref|NM_165394.1| Drosophila melanogaster Elongation factor 2b CG... 56 1e-04
57ref|NM_080366.2| Drosophila melanogaster Elongation factor 2b CG... 56 1e-04
58gb|AY075481.1| Drosophila melanogaster RE38659 full length cDNA 56 1e-04
59gb|AC009254.8| Drosophila melanogaster, chromosome 2L, region 40... 56 1e-04
60gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80... 56 1e-04
61gb|AY305532.1| Richtersius coronifer voucher Rco elongation fact... 54 4e-04
62gb|AY305509.1| Lynceus sp. JCR-2003 elongation factor-2 mRNA, pa... 54 4e-04
63gb|AY305494.1| Ctenolepisma lineata voucher Cli elongation facto... 54 4e-04
64dbj|AK187829.1| Mus musculus cDNA, clone:Y0G0143C24, strand:minu... 54 4e-04
65gb|AY310280.1| Platydesmus sp. 'Pla' elongation factor 2 mRNA, p... 52 0.002
66gb|AF240834.1| Nereis virens elongation factor-2 mRNA, partial cds 52 0.002
67gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 52 0.002
68gb|AY144923.1| Saccharomyces castellii clone Contig2043 EFT gene... 52 0.002
69dbj|AK110167.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
70ref|NM_211043.1| Eremothecium gossypii AFR142Cp (AFR142C), mRNA 52 0.002
71ref|XM_970542.1| PREDICTED: Tribolium castaneum similar to Elong... 50 0.006
72gb|AF240835.1| Peripatus sp. 'Per2' elongation factor-2 mRNA, pa... 50 0.006
73gb|AF240816.1| Armadillidium vulgare elongation factor-2 mRNA, p... 50 0.006
74ref|XM_631629.1| Dictyostelium discoideum AX4 elongation factor ... 50 0.006
75dbj|AK215787.1| Mus musculus cDNA, clone:Y2G0136D03, strand:plus... 50 0.006
76dbj|AK110168.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
77gb|M26017.1|DDIEF2 D.discoideum elongation factor 2 mRNA, comple... 50 0.006
78ref|XM_363816.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.024
79gb|BC007152.1| Mus musculus eukaryotic translation elongation fa... 48 0.024
80ref|XM_454080.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E02926g ... 48 0.024
81gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, com... 48 0.024
82ref|XR_003342.1| PREDICTED: Mus musculus similar to Elongation f... 48 0.024
83ref|XM_444908.1| Candida glabrata CBS138 hypothetical protein (C... 48 0.024
84gb|BC060707.1| Mus musculus eukaryotic translation elongation fa... 48 0.024
85gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, com... 48 0.024
86gb|AY310270.1| Nemasoma varicorne voucher Nva elongation factor ... 48 0.024
87emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 48 0.024
88emb|CR380947.1| Candida glabrata strain CBS138 chromosome A comp... 48 0.024
89gb|AC155932.6| Mus musculus BAC clone RP23-85K13 from chromosome... 48 0.024
90emb|CR318632.9| Zebrafish DNA sequence from clone CH211-113N10 i... 48 0.024
91dbj|AK128976.1| Mus musculus cDNA fis, clone TRACH3016277, highl... 48 0.024
92dbj|AK145545.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
93dbj|AK145509.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
94dbj|AK134195.1| Mus musculus adult male thymus cDNA, RIKEN full-... 48 0.024
95dbj|AK151945.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
96dbj|AK153936.1| Mus musculus 2 days neonate thymus thymic cells ... 48 0.024
97dbj|AK151812.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
98dbj|AK150902.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
99dbj|AK146947.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 48 0.024
100dbj|AK144874.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 48 0.024
101dbj|AK159421.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.024
102dbj|AK149659.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
103dbj|AK152826.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
104dbj|AK159155.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.024
105dbj|AK146508.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 48 0.024
106dbj|AK152587.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
107dbj|AK152447.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
108dbj|AK151487.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
109dbj|AK166815.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
110dbj|AK166788.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
111dbj|AK166758.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
112dbj|AK166751.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
113dbj|AK166747.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
114dbj|AK166719.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
115dbj|AK155325.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 48 0.024
116dbj|AK152146.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
117dbj|AK150136.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
118dbj|AK168874.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 48 0.024
119dbj|AK168827.1| Mus musculus cDNA, RIKEN full-length enriched li... 48 0.024
120dbj|AK168794.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 48 0.024
121dbj|AK168659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 48 0.024
122dbj|AK168638.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 48 0.024
123dbj|AK168615.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 48 0.024
124dbj|AK166596.1| Mus musculus morula whole body morula cDNA, RIKE... 48 0.024
125dbj|AK166595.1| Mus musculus morula whole body morula cDNA, RIKE... 48 0.024
126dbj|AK153275.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.024
127dbj|AK163063.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 48 0.024
128dbj|AK159829.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.024
129dbj|AK159806.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.024
130dbj|AK168527.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 48 0.024
131dbj|AK167281.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
132dbj|AK167230.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
133ref|XM_692874.1| PREDICTED: Danio rerio wu:fj53d02 (wu:fj53d02),... 48 0.024
134dbj|AK159514.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.024
135dbj|AK167199.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
136dbj|AK167221.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
137dbj|AK167208.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
138dbj|AK167115.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
139dbj|AK167109.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
140dbj|AK167093.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
141dbj|AK167081.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
142dbj|AK166212.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 48 0.024
143dbj|AK166968.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
144dbj|AK166851.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
145dbj|AK166829.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 48 0.024
146dbj|AK169013.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 48 0.024
147dbj|AK032997.1| Mus musculus 12 days embryo male wolffian duct i... 48 0.024
148dbj|AK077866.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN... 48 0.024
149dbj|AK040474.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 48 0.024
150dbj|AK087985.1| Mus musculus 2 days neonate thymus thymic cells ... 48 0.024
151dbj|AK028938.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 48 0.024
152gb|BC090153.1| Xenopus laevis cDNA clone MGC:98463 IMAGE:7198247... 48 0.024
153gb|AF107287.1|AF107287 Candida glabrata elongation factor 2 (EFT... 48 0.024
154dbj|AK214266.1| Mus musculus cDNA, clone:Y2G0131D22, strand:plus... 48 0.024
155dbj|AK213305.1| Mus musculus cDNA, clone:Y2G0127O13, strand:minu... 48 0.024
156dbj|AK211536.1| Mus musculus cDNA, clone:Y2G0122B11, strand:minu... 48 0.024
157dbj|AK212666.1| Mus musculus cDNA, clone:Y2G0125L14, strand:plus... 48 0.024
158dbj|AK211738.1| Mus musculus cDNA, clone:Y2G0122L09, strand:plus... 48 0.024
159dbj|AK209955.1| Mus musculus cDNA, clone:Y2G0116N17, strand:minu... 48 0.024
160dbj|AK204992.1| Mus musculus cDNA, clone:Y1G0150E22, strand:plus... 48 0.024
161dbj|AK202382.1| Mus musculus cDNA, clone:Y1G0141F10, strand:minu... 48 0.024
162dbj|AK197271.1| Mus musculus cDNA, clone:Y1G0124J03, strand:plus... 48 0.024
163dbj|AK195329.1| Mus musculus cDNA, clone:Y1G0118C13, strand:minu... 48 0.024
164dbj|AK194702.1| Mus musculus cDNA, clone:Y1G0116D02, strand:plus... 48 0.024
165dbj|AK193129.1| Mus musculus cDNA, clone:Y1G0111C16, strand:plus... 48 0.024
166dbj|AK193057.1| Mus musculus cDNA, clone:Y1G0110N20, strand:plus... 48 0.024
167dbj|AK185714.1| Mus musculus cDNA, clone:Y0G0134P20, strand:minu... 48 0.024
168dbj|AK181093.1| Mus musculus cDNA, clone:Y0G0116O15, strand:minu... 48 0.024
169dbj|AK179508.1| Mus musculus cDNA, clone:Y0G0110K21, strand:minu... 48 0.024
170dbj|AK178103.1| Mus musculus cDNA, clone:Y0G0105G24, strand:plus... 48 0.024
171dbj|AK177405.1| Mus musculus cDNA, clone:Y0G0102K05, strand:minu... 48 0.024
172dbj|AK177249.1| Mus musculus cDNA, clone:Y0G0102C15, strand:minu... 48 0.024
173gb|U89415.1|MMU89415 Mus musculus strain BALB/c elongation facto... 48 0.024
174gb|BC013263.1| Mus musculus eukaryotic translation elongation fa... 48 0.024
175ref|NM_007907.1| Mus musculus eukaryotic translation elongation ... 48 0.024
176gb|AF534908.2| Tetrahymena thermophila elongation factor 2 gene,... 46 0.096
177ref|NM_191821.1| Oryza sativa (japonica cultivar-group), predic... 46 0.096
178gb|BC044327.1| Xenopus laevis eukaryotic translation elongation ... 46 0.096
179gb|AC140034.14| Medicago truncatula clone mth2-17g19, complete s... 46 0.096
180gb|AY305517.1| Periplaneta americana voucher Pam elongation fact... 46 0.096
181gb|DQ295234.1| Spironucleus barkhanus translation elongation fac... 46 0.096
182gb|AC084640.1|CBRG45J08 Caenorhabditis briggsae cosmid G45J08, c... 46 0.096
183gb|AY144924.1| Saccharomyces castellii clone Contig1523 EFT gene... 46 0.096
184dbj|AK184688.1| Mus musculus cDNA, clone:Y0G0131C21, strand:minu... 46 0.096
185gb|U17362.1|CGU17362 Cricetulus griseus elongation factor 2 (EF2... 46 0.096
186gb|M13708.1|CRUEF2 Hamster elongation factor 2 mRNA, complete cds 46 0.096
187gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 44 0.38
188gb|AY078407.1| Spodoptera exigua translation elongation factor 2... 44 0.38
189ref|XM_765828.1| Giardia lamblia ATCC 50803 elongation factor 2 ... 44 0.38
190ref|XM_662910.1| Cryptosporidium hominis TU502 elongation factor... 44 0.38
191gb|AY305512.1| Neogonodactylus oerstedii voucher Neo elongation ... 44 0.38
192gb|AY305503.2| Metajapyx subterraneus voucher Jap elongation fac... 44 0.38
193gb|AY305487.1| Acanthocyclops vernalis voucher A369 elongation f... 44 0.38
194gb|AY310264.1| Ophyiulus pilosus voucher Jul elongation factor 2... 44 0.38
195gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 44 0.38
196gb|AF240823.1| Mastigoproctus giganteus elongation factor-2 mRNA... 44 0.38
197ref|XM_627193.1| Cryptosporidium parvum Iowa II Eft2p GTpase; tr... 44 0.38
198gb|DQ357217.1| Leishmania braziliensis elongation factor 2 (EF-2... 44 0.38
199dbj|AK195851.1| Mus musculus cDNA, clone:Y1G0119N10, strand:plus... 44 0.38
200dbj|AK189260.1| Mus musculus cDNA, clone:Y0G0148H14, strand:plus... 44 0.38
201dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.38
202gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 44 0.38
203gb|U21667.1|CPU21667 Cryptosporidium parvum elongation factor-2 ... 44 0.38
204ref|NM_122204.2| Arabidopsis thaliana SCPL47; catalytic/ serine ... 42 1.5
205gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 42 1.5
206gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance... 42 1.5
207gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 ma... 42 1.5
208gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 42 1.5
209ref|XM_658842.1| Aspergillus nidulans FGSC A4 elongation factor ... 42 1.5
210gb|U28373.1|YSCD9481 Saccharomyces cerevisiae chromosome IV cosm... 42 1.5
211gb|AC123541.3| Oryctolagus cuniculus clone LB1-184A7, complete s... 42 1.5
212emb|X94335.1|SC130KBXV S.cerevisiae 130kb DNA fragment from chro... 42 1.5
213emb|X90518.1|SCXVORFS S.cerevisiae DNA of 51 Kb from chromosome ... 42 1.5
214emb|X73154.1|DMTENM D.melanogaster ten(m) mRNA for tenascin-like... 42 1.5
215gb|AF240831.1| Tanystylum orbiculare elongation factor-2 mRNA, p... 42 1.5
216gb|AC009366.8| Drosophila melanogaster 3L BAC RP98-48E10 (Roswel... 42 1.5
217dbj|AB226013.1| Aspergillus oryzae cDNA, contig sequence: AoEST2869 42 1.5
218ref|NM_079491.2| Drosophila melanogaster Tenascin major CG5723-R... 42 1.5
219gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cance... 42 1.5
220gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 42 1.5
221gb|AY144817.1| Saccharomyces bayanus EFT2 gene, partial cds 42 1.5
222gb|AF107289.1|AF107289 Candida tropicalis elongation factor 2 (E... 42 1.5
223dbj|AK181471.1| Mus musculus cDNA, clone:Y0G0118E08, strand:minu... 42 1.5
224emb|Z75041.1|SCYOR133W S.cerevisiae chromosome XV reading frame ... 42 1.5
225gb|AE003597.4| Drosophila melanogaster chromosome 3L, section 78... 42 1.5
226gb|DQ332255.1| Synthetic construct Saccharomyces cerevisiae clon... 42 1.5
227gb|AF008227.1|DMODZ7 Drosophila melanogaster odd Oz product (odz... 42 1.5
228gb|AF008228.1|AF008228 Drosophila melanogaster odd Oz protein (o... 42 1.5
229gb|U32274.1|SCD9509 Saccharomyces cerevisiae chromosome IV cosmi... 42 1.5
230emb|BX928742.15| Zebrafish DNA sequence from clone CH211-261F3 i... 42 1.5
231gb|M59370.1|YSCEFT2 S.cerevisiae translation elongation factor 2... 42 1.5
232gb|M59369.1|YSCEFT1 S.cerevisiae translation elongation factor 2... 42 1.5
233ref|XM_631959.1| Dictyostelium discoideum elongation factor 2 (D... 40 5.9
234gb|CP000097.1| Synechococcus sp. CC9902, complete genome 40 5.9
235ref|NM_017245.2| Rattus norvegicus eukaryotic translation elonga... 40 5.9
236gb|AC162284.11| Mus musculus chromosome 8, clone RP23-256C11, co... 40 5.9
237ref|NM_025396.1| Mus musculus 6-phosphogluconolactonase (Pgls), ... 40 5.9
238gb|BC059523.1| Danio rerio wu:fj53d02, mRNA (cDNA clone IMAGE:42... 40 5.9
239emb|CR962126.1| Medicago truncatula chromosome 5 clone mth2-143k... 40 5.9
240gb|AC125339.4| Mus musculus BAC clone RP24-356P17 from chromosom... 40 5.9
241gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, compl... 40 5.9
242ref|XM_720710.1| Plasmodium yoelii yoelii str. 17XNL elongation ... 40 5.9
243gb|AE004124.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 5.9
244gb|AE004120.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 5.9
245ref|XM_736543.1| Plasmodium chabaudi chabaudi elongation factor ... 40 5.9
246ref|XM_667054.1| Plasmodium berghei strain ANKA hypothetical pro... 40 5.9
247ref|XM_673005.1| Plasmodium berghei strain ANKA elongation facto... 40 5.9
248gb|AC154449.2| Mus musculus BAC clone RP24-168F5 from chromosome... 40 5.9
249gb|AC137994.19| Medicago truncatula clone mth2-23f15, complete s... 40 5.9
250gb|AY305488.1| Abacion magnum voucher Ama2 elongation factor-2 m... 40 5.9
251gb|AY310292.1| Striaria columbiana voucher Str2 elongation facto... 40 5.9
252gb|AY310285.1| Scutigera coleoptrata voucher Scol elongation fac... 40 5.9
253gb|AY310268.1| Plesioproctus comans voucher Lop elongation facto... 40 5.9
254emb|Y07504.1|RNEF2R Rat mRNA for elongation factor 2 (EF-2) 40 5.9
255emb|AL663103.4| Mouse DNA sequence from clone RP23-267D13 on chr... 40 5.9
256gb|BC066661.1| Rattus norvegicus eukaryotic translation elongati... 40 5.9
257emb|CR558303.7| Zebrafish DNA sequence from clone CH211-183C15 i... 40 5.9
258gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.9
259gb|AY026074.1| Monosiga brevicollis elongation factor 2 mRNA, co... 40 5.9
260dbj|AK172066.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 5.9
261gb|AC138310.3| Mus musculus BAC clone RP23-205H21 from chromosom... 40 5.9
262dbj|AK036059.1| Mus musculus 16 days neonate cerebellum cDNA, RI... 40 5.9
263dbj|AK080749.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 5.9
264gb|BC103385.1| Bos taurus cDNA clone MGC:127305 IMAGE:7949634, c... 40 5.9
265dbj|AK054406.1| Mus musculus 2 days pregnant adult female ovary ... 40 5.9
266dbj|AK044914.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 40 5.9
267dbj|AK003985.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 40 5.9
268gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome ... 40 5.9
269gb|AC149207.3| Medicago truncatula chromosome 2 BAC clone mte1-6... 40 5.9
270gb|AY010231.1| Porphyra yezoensis elongation factor 2 (EF2) gene... 40 5.9
271gb|AF107291.1|AF107291 Candida parapsilosis elongation factor 2 ... 40 5.9
272gb|AC079949.45| Homo sapiens 12 BAC RP11-575F12 (Roswell Park Ca... 40 5.9
273dbj|AK218020.1| Mus musculus cDNA, clone:Y2G0143M02, strand:minu... 40 5.9
274dbj|AK188800.1| Mus musculus cDNA, clone:Y0G0146I03, strand:plus... 40 5.9
275gb|AC148345.3| Medicago truncatula chromosome 7 BAC clone mth2-1... 40 5.9
276gb|BT021869.1| Bos taurus N-acetylglucosamine-1-phosphotransfera... 40 5.9
277gb|AC120394.10| Mus musculus chromosome 9, clone RP24-325N9, com... 40 5.9
278emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 5.9
279gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster... 40 5.9
280emb|CT033769.2| Medicago truncatula chromosome 5 clone mte1-54l1... 40 5.9
281gb|AC162033.11| Mus musculus chromosome 8, clone RP23-162M13, co... 40 5.9
282gb|J03200.1|CIUEF2G Hamster elongation factor 2 gene, complete c... 40 5.9

>dbj|AK101405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037G17, full
           insert sequence
          Length = 3104

 Score =  315 bits (159), Expect = 7e-83
 Identities = 237/263 (90%)
 Strand = Plus / Plus

                                                                       
Query: 138 gccaagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 197
           ||||||||||||||||| || |  || ||||| ||| | |||||||||||||| ||||| 
Sbjct: 310 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 369

                                                                       
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcc 257
           ||||||||||||||||| ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 370 attcgtaacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcc 429

                                                                       
Query: 258 cttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgat 317
           ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 430 cttgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgat 489

                                                                       
Query: 318 acccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttc 377
           |||||||||||||| || |||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 490 acccgtgcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttc 549

                                  
Query: 378 tatcagatgactcctgaatcact 400
           ||  |||||| |  |||||||||
Sbjct: 550 tacgagatgagtgatgaatcact 572



to top

>dbj|AK101166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028E07, full
           insert sequence
          Length = 3081

 Score =  315 bits (159), Expect = 7e-83
 Identities = 237/263 (90%)
 Strand = Plus / Plus

                                                                       
Query: 138 gccaagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 197
           ||||||||||||||||| || |  || ||||| ||| | |||||||||||||| ||||| 
Sbjct: 310 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 369

                                                                       
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcc 257
           ||||||||||||||||| ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 370 attcgtaacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcc 429

                                                                       
Query: 258 cttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgat 317
           ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 430 cttgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgat 489

                                                                       
Query: 318 acccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttc 377
           |||||||||||||| || |||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 490 acccgtgcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttc 549

                                  
Query: 378 tatcagatgactcctgaatcact 400
           ||  |||||| |  |||||||||
Sbjct: 550 tacgagatgagtgatgaatcact 572



to top

>ref|XM_471058.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2532

 Score =  303 bits (153), Expect = 3e-79
 Identities = 231/257 (89%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           ||||||||||| || |  || ||||| ||| | |||||||||||||| ||||| ||||||
Sbjct: 1   atggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataacattcgt 60

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||||||||||||||| |||||||| |||||||| ||||||||||||
Sbjct: 61  aacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcccttgtg 120

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 121 gcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgatacccgt 180

                                                                       
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctatcag 383
           |||||||| || |||||||||||||||||||| ||||| || ||||||||||||||  ||
Sbjct: 181 gcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttctacgag 240

                            
Query: 384 atgactcctgaatcact 400
           |||| |  |||||||||
Sbjct: 241 atgagtgatgaatcact 257



to top

>gb|AY103807.1| Zea mays PCO130571 mRNA sequence
          Length = 2964

 Score =  297 bits (150), Expect = 2e-77
 Identities = 225/250 (90%)
 Strand = Plus / Plus

                                                                       
Query: 140 caagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 199
           ||||||||||||||| || || || ||||||||||  || |||||||| || || || ||
Sbjct: 146 caagatggtgaagttcacagctgaagagctccgcgctatcatggacaaaaagaacaacat 205

                                                                       
Query: 200 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
           ||||||||||||||| ||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 206 tcgtaacatgtctgtcattgctcatgtggaccatggcaagtctacgcttacagattccct 265

                                                                       
Query: 260 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 319
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 266 tgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgatac 325

                                                                       
Query: 320 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttcta 379
            || |||||||| ||||||||||| |||||||||||||| || ||||||||||||| |||
Sbjct: 326 tcgggcagatgaagcagagcgtggcattacaatcaaatctactggtatctctctttacta 385

                     
Query: 380 tcagatgact 389
           | ||||||||
Sbjct: 386 tgagatgact 395



to top

>ref|XM_465992.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2924

 Score =  293 bits (148), Expect = 2e-76
 Identities = 253/288 (87%)
 Strand = Plus / Plus

                                                                       
Query: 140 caagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 199
           ||||||||||||||| || |  || ||||||||| | || ||||||||||| ||||| ||
Sbjct: 156 caagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacat 215

                                                                       
Query: 200 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
            ||||| ||||| || ||||||||||| |||||||| |||||||| ||||||||||| ||
Sbjct: 216 ccgtaatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattctct 275

                                                                       
Query: 260 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 319
           |||||| |||||||| ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 276 tgtggcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactgatac 335

                                                                       
Query: 320 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttcta 379
           |||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 336 ccgtgcagatgaagctgagcgtggtattacaatcaaatccactggtatctctcttttcta 395

                                                           
Query: 380 tcagatgactcctgaatcacttgagatgtacaagggtgacagggatgg 427
           | |||||| |  |||||||||  || ||||||||||||| || |||||
Sbjct: 396 tgagatgagtgatgaatcactcaagttgtacaagggtgagagagatgg 443



to top

>dbj|AK100313.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078M04, full
           insert sequence
          Length = 2923

 Score =  293 bits (148), Expect = 2e-76
 Identities = 253/288 (87%)
 Strand = Plus / Plus

                                                                       
Query: 140 caagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 199
           ||||||||||||||| || |  || ||||||||| | || ||||||||||| ||||| ||
Sbjct: 155 caagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacat 214

                                                                       
Query: 200 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
            ||||| ||||| || ||||||||||| |||||||| |||||||| ||||||||||| ||
Sbjct: 215 ccgtaatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattctct 274

                                                                       
Query: 260 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 319
           |||||| |||||||| ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 275 tgtggcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactgatac 334

                                                                       
Query: 320 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttcta 379
           |||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 335 ccgtgcagatgaagctgagcgtggtattacaatcaaatccactggtatctctcttttcta 394

                                                           
Query: 380 tcagatgactcctgaatcacttgagatgtacaagggtgacagggatgg 427
           | |||||| |  |||||||||  || ||||||||||||| || |||||
Sbjct: 395 tgagatgagtgatgaatcactcaagttgtacaagggtgagagagatgg 442



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  228 bits (115), Expect = 1e-56
 Identities = 172/191 (90%)
 Strand = Plus / Plus

                                                                            
Query: 237      aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 296
                |||||||| ||||||||||| |||||||| |||||||| ||||| |||||||||||||| 
Sbjct: 18938507 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 18938566

                                                                            
Query: 297      ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 356
                || |||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 18938567 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 18938626

                                                                            
Query: 357      tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 416
                ||||| |||||||||||||||||| |||||| |  |||||||||  || |||||||||||
Sbjct: 18938627 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 18938686

                           
Query: 417      gacagggatgg 427
                || || |||||
Sbjct: 18938687 gagagagatgg 18938697



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                            
Query: 140      caagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 199
                ||||||||||||||| || |  || ||||||||| | || ||||||||||| ||||| ||
Sbjct: 18937770 caagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacat 18937829

                                                    
Query: 200      tcgtaacatgtctgttattgctcatgtcgaccacgg 235
                 ||||| ||||| || ||||||||||| ||||||||
Sbjct: 18937830 ccgtaatatgtccgtcattgctcatgtggaccacgg 18937865



to top

>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461D06
          Length = 112895

 Score =  228 bits (115), Expect = 1e-56
 Identities = 172/191 (90%)
 Strand = Plus / Plus

                                                                          
Query: 237    aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 296
              |||||||| ||||||||||| |||||||| |||||||| ||||| |||||||||||||| 
Sbjct: 102040 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 102099

                                                                          
Query: 297    ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 356
              || |||||||||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 102100 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 102159

                                                                          
Query: 357    tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 416
              ||||| |||||||||||||||||| |||||| |  |||||||||  || |||||||||||
Sbjct: 102160 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 102219

                         
Query: 417    gacagggatgg 427
              || || |||||
Sbjct: 102220 gagagagatgg 102230



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                          
Query: 140    caagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 199
              ||||||||||||||| || |  || ||||||||| | || ||||||||||| ||||| ||
Sbjct: 101303 caagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacat 101362

                                                  
Query: 200    tcgtaacatgtctgttattgctcatgtcgaccacgg 235
               ||||| ||||| || ||||||||||| ||||||||
Sbjct: 101363 ccgtaatatgtccgtcattgctcatgtggaccacgg 101398



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score =  220 bits (111), Expect = 3e-54
 Identities = 153/167 (91%)
 Strand = Plus / Plus

                                                                           
Query: 234     ggcaagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagtt 293
               |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1083036 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 1083095

                                                                           
Query: 294     gctggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatc 353
               ||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 1083096 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 1083155

                                                              
Query: 354     aaatccacgggtatctctcttttctatcagatgactcctgaatcact 400
               || ||||| || ||||||||||||||  |||||| |  |||||||||
Sbjct: 1083156 aagtccactggcatctctcttttctacgagatgagtgatgaatcact 1083202



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                           
Query: 138     gccaagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 197
               ||||||||||||||||| || |  || ||||| ||| | |||||||||||||| ||||| 
Sbjct: 1082071 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 1082130

                                                  
Query: 198     attcgtaacatgtctgttattgctcatgtcgacca 232
               ||||||||||||||||| |||||||||||||||||
Sbjct: 1082131 attcgtaacatgtctgtcattgctcatgtcgacca 1082165



to top

>emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0020P07,
             complete sequence
          Length = 167895

 Score =  220 bits (111), Expect = 3e-54
 Identities = 153/167 (91%)
 Strand = Plus / Plus

                                                                         
Query: 234   ggcaagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagtt 293
             |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 25405 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 25464

                                                                         
Query: 294   gctggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatc 353
             ||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 25465 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 25524

                                                            
Query: 354   aaatccacgggtatctctcttttctatcagatgactcctgaatcact 400
             || ||||| || ||||||||||||||  |||||| |  |||||||||
Sbjct: 25525 aagtccactggcatctctcttttctacgagatgagtgatgaatcact 25571



 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                         
Query: 138   gccaagatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 197
             ||||||||||||||||| || |  || ||||| ||| | |||||||||||||| ||||| 
Sbjct: 24440 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 24499

                                                
Query: 198   attcgtaacatgtctgttattgctcatgtcgacca 232
             ||||||||||||||||| |||||||||||||||||
Sbjct: 24500 attcgtaacatgtctgtcattgctcatgtcgacca 24534



to top

>ref|NM_191153.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2388

 Score =  212 bits (107), Expect = 7e-52
 Identities = 224/263 (85%)
 Strand = Plus / Plus

                                                                       
Query: 177 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 236
           ||||||||||||||  |||| || ||||||||||||||| | |||||||| ||||| || 
Sbjct: 34  attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 93

                                                                       
Query: 237 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 296
           || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 94  aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 153

                                                                       
Query: 297 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 356
           || |||||||| ||||||||||  ||| ||||||| ||||| |||||||||||||| |||
Sbjct: 154 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 213

                                                                       
Query: 357 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 416
           || || ||||||||||||| |||| |||||| |  ||| |||||  | |  |||||||||
Sbjct: 214 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 273

                                  
Query: 417 gacagggatggggatgaatacct 439
           ||||| |||||  ||||||||||
Sbjct: 274 gacagagatggaaatgaatacct 296



to top

>dbj|AK063421.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-C05, full
           insert sequence
          Length = 2856

 Score =  212 bits (107), Expect = 7e-52
 Identities = 224/263 (85%)
 Strand = Plus / Plus

                                                                       
Query: 177 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 236
           ||||||||||||||  |||| || ||||||||||||||| | |||||||| ||||| || 
Sbjct: 185 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 244

                                                                       
Query: 237 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 296
           || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 245 aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 304

                                                                       
Query: 297 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 356
           || |||||||| ||||||||||  ||| ||||||| ||||| |||||||||||||| |||
Sbjct: 305 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 364

                                                                       
Query: 357 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 416
           || || ||||||||||||| |||| |||||| |  ||| |||||  | |  |||||||||
Sbjct: 365 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 424

                                  
Query: 417 gacagggatggggatgaatacct 439
           ||||| |||||  ||||||||||
Sbjct: 425 gacagagatggaaatgaatacct 447



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  167 bits (84), Expect = 4e-38
 Identities = 171/200 (85%)
 Strand = Plus / Plus

                                                                            
Query: 240      tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 299
                ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 30987830 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 30987889

                                                                            
Query: 300      gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 359
                |||||||| ||||||||||  ||| ||||||| ||||| |||||||||||||| ||||| 
Sbjct: 30987890 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 30987949

                                                                            
Query: 360      acgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggtgac 419
                || ||||||||||||| |||| |||||| |  ||| |||||  | |  ||||||||||||
Sbjct: 30987950 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 30988009

                                    
Query: 420      agggatggggatgaatacct 439
                || |||||  ||||||||||
Sbjct: 30988010 agagatggaaatgaatacct 30988029



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                     
Query: 138      gccaagatggtgaagtttaccgcggaggagctccgcg 174
                ||||||||||||| |||||| ||||||||||||||||
Sbjct: 30139918 gccaagatggtgaggtttacggcggaggagctccgcg 30139882



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                        
Query: 177      attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgacca 232
                ||||||||||||||  |||| || ||||||||||||||| | |||||||| |||||
Sbjct: 30987220 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggacca 30987275



to top

>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0439E07
          Length = 176486

 Score =  167 bits (84), Expect = 4e-38
 Identities = 171/200 (85%)
 Strand = Plus / Plus

                                                                         
Query: 240   tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 299
             ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 44809 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 44868

                                                                         
Query: 300   gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 359
             |||||||| ||||||||||  ||| ||||||| ||||| |||||||||||||| ||||| 
Sbjct: 44869 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 44928

                                                                         
Query: 360   acgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggtgac 419
             || ||||||||||||| |||| |||||| |  ||| |||||  | |  ||||||||||||
Sbjct: 44929 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 44988

                                 
Query: 420   agggatggggatgaatacct 439
             || |||||  ||||||||||
Sbjct: 44989 agagatggaaatgaatacct 45008



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 177   attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgacca 232
             ||||||||||||||  |||| || ||||||||||||||| | |||||||| |||||
Sbjct: 44199 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggacca 44254



to top

>gb|BT012802.1| Lycopersicon esculentum clone 113818R, mRNA sequence
          Length = 2816

 Score =  137 bits (69), Expect = 3e-29
 Identities = 165/197 (83%)
 Strand = Plus / Plus

                                                                       
Query: 193 ataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacgg 252
           |||| |||||||| |||||||||||||||||||| ||||| || || ||||| ||||| |
Sbjct: 122 ataacattcgtaatatgtctgttattgctcatgtggaccatggaaaatctacccttactg 181

                                                                       
Query: 253 attcccttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatga 312
           |||| || ||||| |||||||| || || || ||||||||||| || |||||  | ||||
Sbjct: 182 attctctggtggcggctgctggtatcattgctcaggaagttgcaggtgatgtcagaatga 241

                                                                       
Query: 313 ctgatacccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctc 372
           | ||||| |||||||||||||| ||||||||||| || ||||| ||||| ||||| || |
Sbjct: 242 cagatacacgtgcagatgaggctgagcgtggtatcaccatcaagtccactggtatttcac 301

                            
Query: 373 ttttctatcagatgact 389
           ||| |||  ||||||||
Sbjct: 302 tttactacgagatgact 318



to top

>ref|NM_179487.1| Arabidopsis thaliana LOS1; GTP binding / translation elongation
           factor/ translation factor, nucleic acid binding
           AT1G56070 (LOS1) mRNA, complete cds
          Length = 2958

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 112 atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 171

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 172 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 231

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 232 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 291

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 292 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 341



to top

>gb|BT000722.1| Arabidopsis thaliana clone RAFL07-10-D07 (R10647) putative
           elongation factor (At1g56075) mRNA, complete cds
          Length = 2858

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305



to top

>gb|BT000661.1| Arabidopsis thaliana clone RAFL08-12-J19 (R11046) putative
           elongation factor (At1g56075) mRNA, complete cds
          Length = 2875

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 112 atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 171

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 172 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 231

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 232 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 291

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 292 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 341



to top

>gb|AF367331.1| Arabidopsis thaliana At1g56070/T6H22_13 mRNA, complete cds
          Length = 2756

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305



to top

>gb|AY054461.1| Arabidopsis thaliana elongation factor EF-2 (At1g56070; T6H22.13)
           mRNA, complete cds
          Length = 2719

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305



to top

>gb|BT002714.1| Arabidopsis thaliana At1g56070/T6H22_13 gene, complete cds
          Length = 2532

 Score =  131 bits (66), Expect = 2e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 144 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 203
           |||||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||
Sbjct: 1   atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 60

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           || ||||||||||||||||||||||||||||| || || || ||||| |||||  | || 
Sbjct: 61  aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 120

                                                                       
Query: 264 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 323
           || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | 
Sbjct: 121 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 180

                                                             
Query: 324 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
           || |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 181 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 230



to top

>emb|Z97178.1|BVRNAEF2 Beta vulgaris cDNA for elongation factor 2
          Length = 3001

 Score =  119 bits (60), Expect = 8e-24
 Identities = 156/188 (82%)
 Strand = Plus / Plus

                                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccctt 260
           ||||||||||||||||| || ||||| || ||||| || || ||||| || |||||  | 
Sbjct: 180 cgtaacatgtctgttatagcccatgtggatcacgggaaatcaacgctcacagattctttg 239

                                                                       
Query: 261 gtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacc 320
           ||||| |||||||| || || |||||||| || ||||| ||||| || ||||||||||||
Sbjct: 240 gtggctgctgctggtatcattgcccaggaggtggctggcgatgtacggatgactgatacc 299

                                                                       
Query: 321 cgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctat 380
           ||||| ||||| || || ||||||||||| ||||| ||||| || || ||||| | ||||
Sbjct: 300 cgtgccgatgaagctgaacgtggtattaccatcaagtccactggaatttctctctactat 359

                   
Query: 381 cagatgac 388
           ||||||||
Sbjct: 360 cagatgac 367



to top

>dbj|AB026645.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6
          Length = 81020

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 125/150 (83%)
 Strand = Plus / Plus

                                                                        
Query: 240  tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 299
            ||||| ||||||||||| ||||| || |||||||| || || || || |||  ||| || 
Sbjct: 3664 tctacacttacggattcacttgttgctgctgctggtatcattgctcaagaaactgcgggt 3723

                                                                        
Query: 300  gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 359
            ||||| || ||||||||||| ||||| ||||||||||| |||||||| || ||||| |||
Sbjct: 3724 gatgtgcgtatgactgatactcgtgctgatgaggcagaacgtggtatcaccatcaagtcc 3783

                                          
Query: 360  acgggtatctctcttttctatcagatgact 389
            || ||||||||||| | |||| ||||||||
Sbjct: 3784 actggtatctctctctactatgagatgact 3813



to top

>gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete
             sequence
          Length = 96489

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                         
Query: 267   gctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgtgca 326
             |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | || 
Sbjct: 59122 gctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccagagct 59181

                                                            
Query: 327   gatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 373
             |||||||| || |||||||| || ||||| ||||| ||||| |||||
Sbjct: 59182 gatgaggctgaacgtggtatcactatcaagtccactggtatttctct 59228



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                         
Query: 146   ggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgtaa 205
             |||||||||||| || || ||||| ||  | ||||||||| | ||| | || || |||||
Sbjct: 58780 ggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgtaa 58839

                                           
Query: 206   catgtctgttattgctcatgtcgaccacgg 235
              |||||||||||||||||||||||||||||
Sbjct: 58840 tatgtctgttattgctcatgtcgaccacgg 58869



to top

>gb|AC146817.10| Medicago truncatula clone mth2-8c19, complete sequence
          Length = 114343

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   gattcccttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatg 311
             ||||||||||| || || ||||| ||||| || || || |||||||| |||||  | |||
Sbjct: 57757 gattcccttgttgctgccgctggaattatagcacaagaggttgctggagatgtcagaatg 57816

                                                                         
Query: 312   actgatacccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctct 371
             || ||||||||||| ||||| || || |||||||| || ||||| ||||| |||||||||
Sbjct: 57817 acagatacccgtgctgatgaagctgaacgtggtatcactatcaagtccactggtatctct 57876

               
Query: 372   ct 373
             ||
Sbjct: 57877 ct 57878



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                   
Query: 198   attcgtaacatgtctgttattgctcatgtcgaccacgg 235
             ||||| || |||||||||||||||||||||||||||||
Sbjct: 62505 attcggaatatgtctgttattgctcatgtcgaccacgg 62542



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 177   attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 226
             ||||||||| | ||| | || |||||||| ||||||||||||||||||||
Sbjct: 56713 attatggactacaaacacaacattcgtaatatgtctgttattgctcatgt 56762



to top

>gb|AF240824.1| Nipponopsalis abei elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgct 247
           |||||||| |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 35  attcgtaatatgtctgttattgctcatgtggaccacggaaagtctacgct 84



to top

>emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, complete sequence
          Length = 38692

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 198  attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
            |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 9122 attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 9180



to top

>ref|NM_060056.3| Caenorhabditis elegans Elongation FacTor family member (eft-2)
           (eft-2) mRNA, complete cds
          Length = 2669

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 136 attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 194



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 336 gagcgtggtattacaatcaaatccacgggtatctctcttttct 378
           |||||| ||||||| |||||||| || | ||||||||||||||
Sbjct: 274 gagcgttgtattaccatcaaatctactgctatctctcttttct 316



to top

>gb|M86959.1|CELEFT2A Caenorhabditis elegans elongation factor (eft-2) mRNA, complete cds
          Length = 2701

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 85  attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 143



 Score = 46.1 bits (23), Expect = 0.096
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 336 gagcgtggtattacaatcaaatccacgggtatctctcttttct 378
           |||||| ||||||| |||||||| || | ||||||||||||||
Sbjct: 223 gagcgttgtattaccatcaaatctactgctatctctcttttct 265



to top

>gb|AY305496.1| Carcinoscorpius rotundicauda voucher Cro elongation factor-2 mRNA,
           partial cds
          Length = 1975

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 184 acaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||||| ||||| |||||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 21  acaagaaaaagaatatccgtaacatgtctgtcattgcccatgtagaccacggaaagtc 78



to top

>gb|AF240821.1| Limulus polyphemus elongation factor-2 mRNA, partial cds
          Length = 1975

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 184 acaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||||| || || |||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 21  acaagaaaaaaaacatccgtaacatgtctgttattgcccatgtagaccacggaaagtc 78



to top

>emb|AL122032.1|SPAC513 S.pombe chromosome I cosmid c513
          Length = 13204

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
           |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 133 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 89



to top

>emb|AL121859.1|SPCP31B10 S.pombe chromosome III p1 p31B10
          Length = 21649

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                          
Query: 201   cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
             |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 12724 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 12768



to top

>ref|NM_001022856.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPCP31B10.07), partial mRNA
          Length = 2529

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
           |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 58  cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102



to top

>ref|NM_001019401.1| Schizosaccharomyces pombe 972h- elongation factor 2 (SPAC513.01c),
           partial mRNA
          Length = 2529

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
           |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 58  cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102



to top

>dbj|D83976.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds
          Length = 3276

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
           |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 268 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 312



to top

>dbj|D83975.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds
          Length = 3222

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 245
           |||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 325 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 369



to top

>gb|AY305525.1| Trachyiulus nordquisti voucher Tnor elongation factor-2 mRNA,
           partial cds
          Length = 2185

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 239
           ||||||||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtgatagcccacgtcgatcacggcaag 76

                               
Query: 240 tctacgcttacggattccct 259
           || ||||| |||||||||||
Sbjct: 77  tccacgctgacggattccct 96



to top

>gb|AY064104.1| Aedes aegypti clone EF2Mc2 elongation factor 2 (Ef-2) mRNA,
           complete cds
          Length = 2658

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           ||||||||||| || ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 115 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170



to top

>gb|AY064103.1| Aedes aegypti clone EF2Rc2 elongation factor 2 (Ef-2) mRNA,
           complete cds
          Length = 2658

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           ||||||||||| || ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 115 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170



to top

>gb|AY040342.1| Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds
          Length = 2681

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           ||||||||||| || ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 138 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193



to top

>gb|AF331798.1|AF331798 Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds
          Length = 2681

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 256
           ||||||||||| || ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 138 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193



to top

>gb|AY737540.1| Toxoptera citricida putative translation elongation factor 2 mRNA,
           complete cds
          Length = 2535

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 226
           ||||||||||| || |||||||||||||||||||| || ||||||||
Sbjct: 37  atggacaagaagaagaatattcgtaacatgtctgtcatcgctcatgt 83



to top

>gb|AF240826.1| Polyxenus fasciculatus elongation factor-2 mRNA, partial cds
          Length = 1981

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 178 ttatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggca 237
           ||||||||||||| || |||||||| |||||||| || || || || ||||| |||||||
Sbjct: 15  ttatggacaagaagaagaatattcgaaacatgtccgtaatagcccacgtcgatcacggca 74

                                 
Query: 238 agtctacgcttacggattccct 259
           | ||||| || ||||| |||||
Sbjct: 75  aatctaccctgacggactccct 96



to top

>gb|M68064.1|CHLEF2 Chlorella kessleri elongation factor 2 mRNA, complete cds
          Length = 2931

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccctt 260
           ||||||||||| || ||||| ||||| ||||||||||||||||| || || || ||||| 
Sbjct: 157 cgtaacatgtccgtgattgcccatgtggaccacggcaagtctaccctcaccgactccctg 216

                         
Query: 261 gtggcagctgctgg 274
           ||||| || |||||
Sbjct: 217 gtggcggccgctgg 230



to top

>ref|XM_792306.1| PREDICTED: Strongylocentrotus purpuratus similar to eukaryotic
           translation elongation factor 2, like (LOC592801), mRNA
          Length = 3748

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 190 aacatgtctgtcatcgctcatgtcgaccatggcaagtctac 230



to top

>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0022F10
          Length = 150498

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                  
Query: 138   gccaagatggtgaagtttaccgcggaggagctccgcg 174
             ||||||||||||| |||||| ||||||||||||||||
Sbjct: 44740 gccaagatggtgaggtttacggcggaggagctccgcg 44704



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0690B02
          Length = 153116

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 138    gccaagatggtgaagtttaccgcggaggagctccgcg 174
              ||||||||||||| |||||| ||||||||||||||||
Sbjct: 135908 gccaagatggtgaggtttacggcggaggagctccgcg 135872



to top

>dbj|AK102586.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033098E24, full
           insert sequence
          Length = 2849

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 138 gccaagatggtgaagtttaccgcggaggagctccgcg 174
           ||||||||||||| |||||| ||||||||||||||||
Sbjct: 63  gccaagatggtgaggtttacggcggaggagctccgcg 99



to top

>dbj|AK073592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048F11, full
           insert sequence
          Length = 2865

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 138 gccaagatggtgaagtttaccgcggaggagctccgcg 174
           ||||||||||||| |||||| ||||||||||||||||
Sbjct: 63  gccaagatggtgaggtttacggcggaggagctccgcg 99



to top

>gb|AY613900.1| Mesenchytraeus solifugus clone A195 translation elongation factor
           2-like mRNA, partial sequence
          Length = 935

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||||||||||| ||| || ||||||||||||||||| |||||
Sbjct: 116 attcgtaacatgtgtgtcatcgctcatgtcgaccacggaaagtc 159



to top

>gb|AC150552.1| Drosophila melanogaster clone BACR12I17, complete sequence
          Length = 174573

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 204    aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
              ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 117638 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 117579



to top

>ref|XM_389750.1| Gibberella zeae PH-1 chromosome 4 EF2_NEUCR Elongation factor 2
           (EF-2) (Colonial temperature-sensitive 3) (FG09574.1)
           partial mRNA
          Length = 2499

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 22  cgtaacatgtccgttattgcccacgtcgatcacggcaagtctac 65



to top

>emb|X15805.1|DMEF2 Drosophila DMEF2 gene for the translation elongation factor 2
          Length = 2821

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 133 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 192



to top

>ref|NM_165395.1| Drosophila melanogaster Elongation factor 2b CG2238-RC, transcript
           variant C (Ef2b), mRNA
          Length = 2768

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 80  aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 139



to top

>ref|NM_165394.1| Drosophila melanogaster Elongation factor 2b CG2238-RB, transcript
           variant B (Ef2b), mRNA
          Length = 2794

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 106 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 165



to top

>ref|NM_080366.2| Drosophila melanogaster Elongation factor 2b CG2238-RA, transcript
           variant A (Ef2b), mRNA
          Length = 2858

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 170 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 229



to top

>gb|AY075481.1| Drosophila melanogaster RE38659 full length cDNA
          Length = 2823

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 172 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 231



to top

>gb|AC009254.8| Drosophila melanogaster, chromosome 2L, region 40A-40C, BAC clone
             BACR42E05, complete sequence
          Length = 175179

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 204   aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
             ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 67131 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 67072



to top

>gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80 of 83 of the complete
              sequence
          Length = 323775

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 204    aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
              ||||||||||| ||||| || || |||||||||||||| || || || ||||||||||||
Sbjct: 138578 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 138519



to top

>gb|AY305532.1| Richtersius coronifer voucher Rco elongation factor-2 mRNA, partial
           cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaa 238
           ||||||||||| | ||| || || |||||||| ||||||||||| || |||||||||||
Sbjct: 17  atggacaagaagactaacatccgaaacatgtccgttattgctcacgtggaccacggcaa 75



to top

>gb|AY305509.1| Lynceus sp. JCR-2003 elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 226
           ||||||||||| || || |||||||||||||| || |||||||||||
Sbjct: 17  atggacaagaagaagaacattcgtaacatgtccgtcattgctcatgt 63



to top

>gb|AY305494.1| Ctenolepisma lineata voucher Cli elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||| || |||||||| || ||||||||||||||||| ||||||||
Sbjct: 32  aatatccgcaacatgtccgtcattgctcatgtcgaccatggcaagtc 78



to top

>dbj|AK187829.1| Mus musculus cDNA, clone:Y0G0143C24, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63

              
Query: 264 gca 266
           |||
Sbjct: 64  gca 66



to top

>gb|AY310280.1| Platydesmus sp. 'Pla' elongation factor 2 mRNA, partial cds
          Length = 2185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| || || || ||||||||||| || ||||||||||||||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtcattgctcatgtcga 66



to top

>gb|AF240834.1| Nereis virens elongation factor-2 mRNA, partial cds
          Length = 1969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 177 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 236
           |||||||||  |||||| || || |||||||||||||| || ||||| || || ||||||
Sbjct: 14  attatggaccggaaaaagaacatccgtaacatgtctgtgatcgctcacgttgatcacggc 73

                                     
Query: 237 aagtctacgcttacggattcccttgt 262
           || ||||| || || || ||||||||
Sbjct: 74  aaatctacactgactgactcccttgt 99



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 201    cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttac 250
              ||||||||||| || ||||| || ||||||||||| ||||| ||||||||
Sbjct: 697928 cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 697879



to top

>gb|AY144923.1| Saccharomyces castellii clone Contig2043 EFT gene, complete cds
          Length = 2529

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 199 ttcgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||||| ||||||||||| ||||| || || ||||||||
Sbjct: 56  ttcgtaacatgtccgttattgctcacgtcgatcatggtaagtctac 101



to top

>dbj|AK110167.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-F12, full
           insert sequence
          Length = 2770

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||| |||||||| || |||||||||||||||||
Sbjct: 127 aacatgtcggttattgcccacgtcgaccacggcaagtc 164



to top

>ref|NM_211043.1| Eremothecium gossypii AFR142Cp (AFR142C), mRNA
          Length = 2529

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttac 250
           ||||||||||| || ||||| || ||||||||||| ||||| ||||||||
Sbjct: 58  cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 107



to top

>ref|XM_970542.1| PREDICTED: Tribolium castaneum similar to Elongation factor 2
           (EF-2) (LOC664546), mRNA
          Length = 2927

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                       
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 254
           ||||| ||||||||||| || |||||||| || ||||||||||| || || || || || 
Sbjct: 120 aatatccgtaacatgtccgtcattgctcacgtggaccacggcaaatcaactctgaccgac 179

                    
Query: 255 tcccttgtg 263
           |||||||||
Sbjct: 180 tcccttgtg 188



to top

>gb|AF240835.1| Peripatus sp. 'Per2' elongation factor-2 mRNA, partial cds
          Length = 2182

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgc 220
           |||||||||||| | ||||| |||||||||||||| |||||
Sbjct: 17  atggacaagaaacagaatatccgtaacatgtctgtgattgc 57



to top

>gb|AF240816.1| Armadillidium vulgare elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacgg 235
           ||||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 32  aatattcgtaatatgtccgtcattgctcatgtagaccacgg 72



to top

>ref|XM_631629.1| Dictyostelium discoideum AX4 elongation factor 2 (DDB0191363),
           partial mRNA
          Length = 2520

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 207 atgtctgttattgctcatgtcgaccacgg 235
           ||||||||||||||||||||||| |||||
Sbjct: 64  atgtctgttattgctcatgtcgatcacgg 92



to top

>dbj|AK215787.1| Mus musculus cDNA, clone:Y2G0136D03, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 389

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgantcccttgtg 63



to top

>dbj|AK110168.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-G01, full
           insert sequence
          Length = 2997

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 254
           ||||| ||||||||||  ||||||||||| ||||| ||||| ||||| || ||||| || 
Sbjct: 211 aatatccgtaacatgttcgttattgctcacgtcgatcacggaaagtccacccttaccgac 270

                
Query: 255 tccct 259
           |||||
Sbjct: 271 tccct 275



to top

>gb|M26017.1|DDIEF2 D.discoideum elongation factor 2 mRNA, complete cds
          Length = 2755

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 207 atgtctgttattgctcatgtcgaccacgg 235
           ||||||||||||||||||||||| |||||
Sbjct: 292 atgtctgttattgctcatgtcgatcacgg 320



to top

>ref|XM_363816.1| Magnaporthe grisea 70-15 hypothetical protein (MG01742.4) partial
           mRNA
          Length = 2610

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
           |||||||| || ||||| || ||||||||||||||||| || || || ||||||||
Sbjct: 40  aacatgtccgtcattgcccacgtcgaccacggcaagtcgaccctcaccgattccct 95



to top

>gb|BC007152.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA
           clone MGC:6761 IMAGE:3600352), complete cds
          Length = 3111

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200



to top

>ref|XM_454080.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E02926g predicted mRNA
          Length = 2529

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||| |||||||| || ||||| ||||| ||||||||
Sbjct: 58  cgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 101



to top

>gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, complete sequence
          Length = 168805

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 204   aacatgtctgttattgctcatgtcgaccacggcaagtcta 243
             |||||||| || ||||||||||| ||||| ||||||||||
Sbjct: 82970 aacatgtcagtcattgctcatgtggaccatggcaagtcta 83009



to top

>ref|XR_003342.1| PREDICTED: Mus musculus similar to Elongation factor 2 (EF-2)
           (LOC435640), mRNA
          Length = 2545

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtcta 243
           |||||||| || ||||||||||| ||||| ||||||||||
Sbjct: 173 aacatgtcagtcattgctcatgtggaccatggcaagtcta 212



to top

>ref|XM_444908.1| Candida glabrata CBS138 hypothetical protein (CAGL0A03234g) partial
           mRNA
          Length = 2529

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 58  cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 101



to top

>gb|BC060707.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA
           clone IMAGE:6810450), partial cds
          Length = 2972

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 18  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 77



to top

>gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, complete sequence
          Length = 239053

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 204   aacatgtctgttattgctcatgtcgaccacggcaagtcta 243
             |||||||| || ||||||||||| ||||| ||||||||||
Sbjct: 21935 aacatgtcagtcattgctcatgtggaccatggcaagtcta 21896



to top

>gb|AY310270.1| Nemasoma varicorne voucher Nva elongation factor 2 mRNA, partial
           cds
          Length = 643

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacgg 235
           ||||||||||| || || ||||| ||||||||||| ||||| ||||| || |||||
Sbjct: 17  atggacaagaagaagaacattcgcaacatgtctgtgattgcccatgtggatcacgg 72



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 201    cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
              ||||||||||| |||||||| || ||||| ||||| ||||||||
Sbjct: 274152 cgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 274195



to top

>emb|CR380947.1| Candida glabrata strain CBS138 chromosome A complete sequence
          Length = 485192

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 201    cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
              ||||||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 323942 cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 323985



to top

>gb|AC155932.6| Mus musculus BAC clone RP23-85K13 from chromosome 10, complete sequence
          Length = 239525

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                          
Query: 204    aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
              |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 137328 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 137387



to top

>emb|CR318632.9| Zebrafish DNA sequence from clone CH211-113N10 in linkage group 5,
              complete sequence
          Length = 143278

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                      
Query: 204    aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
              ||||||||||| ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 107527 aacatgtctgtgattgcccatgtggaccacggcaaatccactctcaccgattccct 107472



to top

>dbj|AK128976.1| Mus musculus cDNA fis, clone TRACH3016277, highly similar to
           Elongation factor 2
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 142 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 201



to top

>dbj|AK145545.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0013E23 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK145509.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0008O17 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 2932

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK134195.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
           library, clone:5830470E07 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK151945.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830043K06 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK153936.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430007P07
           product:eukaryotic translation elongation factor 2, full
           insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK151812.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830038A06 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3022

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 93  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 152



to top

>dbj|AK150902.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830018A09 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK146947.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920078K07 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK144874.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730046C15 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 145 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 204



to top

>dbj|AK159421.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420019L24 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3084

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK149659.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:G530008F18 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 2475

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK152826.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830086O05 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK159155.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420005L02 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK146508.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920016H22 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK152587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830080H09 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK152447.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830072H23 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK151487.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030N18 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166815.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0015D24 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166788.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0013F05 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166758.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0009D22 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166751.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0008M05 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3070

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200



to top

>dbj|AK166747.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0008K21 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166719.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0007E11 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK155325.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630220G13
           product:eukaryotic translation elongation factor 2, full
           insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK152146.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830050C12 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK150136.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:G530135N13 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3075

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168874.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920062C16 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3065

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 136 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 195



to top

>dbj|AK168827.1| Mus musculus cDNA, RIKEN full-length enriched library,
           clone:I920058H11 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168794.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920055J08 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920042H11 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168638.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920040J20 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168615.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920038K05 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166596.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
           enriched library, clone:I0C0032K22 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3075

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166595.1| Mus musculus morula whole body morula cDNA, RIKEN full-length
           enriched library, clone:I0C0032K13 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK153275.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830134C02 product:eukaryotic
           translation elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK163063.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A430110F17 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK159829.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420032E20 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK159806.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420031K23 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK168527.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920029L03 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3069

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167281.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0050C01 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 142 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 201



to top

>dbj|AK167230.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0043E10 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>ref|XM_692874.1| PREDICTED: Danio rerio wu:fj53d02 (wu:fj53d02), mRNA
          Length = 3323

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
           ||||||||||| ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 155 aacatgtctgtgattgcccatgtggaccacggcaaatccactctcaccgattccct 210



to top

>dbj|AK159514.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420022I05 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167199.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0038L22 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 2931

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167221.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0041O03 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167208.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0040H15 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3070

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200



to top

>dbj|AK167115.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0031N20 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3079

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167109.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0031H23 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167093.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0030K01 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK167081.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0029P06 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166212.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830016F02
           product:eukaryotic translation elongation factor 2, full
           insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK166968.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0025N20 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtcaacgctgaccgactcccttgtg 202



to top

>dbj|AK166851.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0017E19 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3070

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200



to top

>dbj|AK166829.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0015K24 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3073

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK169013.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920074H24 product:eukaryotic translation
           elongation factor 2, full insert sequence
          Length = 3082

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK032997.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720487K10 product:ELONGATION FACTOR 2 (EF-2)
           homolog [Mus musculus], full insert sequence
          Length = 3072

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK077866.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length
           enriched library, clone:5930429P17 product:ELONGATION
           FACTOR 2 (EF-2) homolog [Rattus norvegicus], full insert
           sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK040474.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A430101N03 product:ELONGATION FACTOR 2
           (EF-2) homolog [Rattus norvegicus], full insert sequence
          Length = 3074

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK087985.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430001M15
           product:ELONGATION FACTOR 2 (EF-2) homolog [Rattus
           norvegicus], full insert sequence
          Length = 3068

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202



to top

>dbj|AK028938.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:4732472F11 product:ELONGATION FACTOR 2
           (EF-2) homolog [Mus musculus], full insert sequence
          Length = 3065

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 136 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 195



to top

>gb|BC090153.1| Xenopus laevis cDNA clone MGC:98463 IMAGE:7198247, complete cds
          Length = 3035

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 78  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 137



to top

>gb|AF107287.1|AF107287 Candida glabrata elongation factor 2 (EFT2) gene, partial cds
          Length = 2444

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           ||||||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 16  cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 59



to top

>dbj|AK214266.1| Mus musculus cDNA, clone:Y2G0131D22, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 395

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 68  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127



to top

>dbj|AK213305.1| Mus musculus cDNA, clone:Y2G0127O13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 159

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK211536.1| Mus musculus cDNA, clone:Y2G0122B11, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK212666.1| Mus musculus cDNA, clone:Y2G0125L14, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 336

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK211738.1| Mus musculus cDNA, clone:Y2G0122L09, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 402

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK209955.1| Mus musculus cDNA, clone:Y2G0116N17, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 81

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK204992.1| Mus musculus cDNA, clone:Y1G0150E22, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK202382.1| Mus musculus cDNA, clone:Y1G0141F10, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 227

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 68  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127



to top

>dbj|AK197271.1| Mus musculus cDNA, clone:Y1G0124J03, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 164

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK195329.1| Mus musculus cDNA, clone:Y1G0118C13, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK194702.1| Mus musculus cDNA, clone:Y1G0116D02, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK193129.1| Mus musculus cDNA, clone:Y1G0111C16, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 227

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 68  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127



to top

>dbj|AK193057.1| Mus musculus cDNA, clone:Y1G0110N20, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 385

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK185714.1| Mus musculus cDNA, clone:Y0G0134P20, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK181093.1| Mus musculus cDNA, clone:Y0G0116O15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 142

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK179508.1| Mus musculus cDNA, clone:Y0G0110K21, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK178103.1| Mus musculus cDNA, clone:Y0G0105G24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 227

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 68  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127



to top

>dbj|AK177405.1| Mus musculus cDNA, clone:Y0G0102K05, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK177249.1| Mus musculus cDNA, clone:Y0G0102C15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>gb|U89415.1|MMU89415 Mus musculus strain BALB/c elongation factor 2 mRNA, partial cds
          Length = 779

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 38  aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 97



to top

>gb|BC013263.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA
           clone IMAGE:3595704)
          Length = 3097

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 129 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 188



to top

>ref|NM_007907.1| Mus musculus eukaryotic translation elongation factor 2 (Eef2),
           mRNA
          Length = 3111

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200



to top

>gb|AF534908.2| Tetrahymena thermophila elongation factor 2 gene, complete cds
          Length = 2609

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 254
           ||||| ||||| ||||| ||||||||||| ||||| ||||| || || || ||||| |||
Sbjct: 52  aatatccgtaatatgtcagttattgctcacgtcgatcacggtaaatccacccttaccgat 111

              
Query: 255 tcc 257
           |||
Sbjct: 112 tcc 114



to top

>ref|NM_191821.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2562

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 144 atggtgaagtttaccgcggaggagctccgcg 174
           ||||||| |||||| ||||||||||||||||
Sbjct: 1   atggtgaggtttacggcggaggagctccgcg 31



to top

>gb|BC044327.1| Xenopus laevis eukaryotic translation elongation factor 2, mRNA
           (cDNA clone MGC:53560 IMAGE:4681560), complete cds
          Length = 2946

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 198 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 244
           |||||||| ||||| || ||||| ||||| ||||||||||| |||||
Sbjct: 117 attcgtaatatgtcggtcattgcccatgtggaccacggcaaatctac 163



to top

>gb|AC140034.14| Medicago truncatula clone mth2-17g19, complete sequence
          Length = 83825

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 216   attgctcatgtcgaccacggcaa 238
             |||||||||||||||||||||||
Sbjct: 67069 attgctcatgtcgaccacggcaa 67091



to top

>gb|AY305517.1| Periplaneta americana voucher Pam elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||| ||||| |||||||| || || |||||||| |||||||||||
Sbjct: 32  aatatccgtaatatgtctgtgatcgcccatgtcgatcacggcaagtc 78



to top

>gb|DQ295234.1| Spironucleus barkhanus translation elongation factor 2 (EF-2) mRNA,
           partial cds
          Length = 2529

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 207 atgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtggca 266
           |||||||||||||| ||||| || || || ||||| || ||||| ||||| ||| | || 
Sbjct: 38  atgtctgttattgcacatgtagatcatggtaagtcaactcttactgattctcttatcgcc 97

                          
Query: 267 gctgctgggattatc 281
           |||||||| ||||||
Sbjct: 98  gctgctggtattatc 112



to top

>gb|AC084640.1|CBRG45J08 Caenorhabditis briggsae cosmid G45J08, complete sequence
          Length = 42710

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 204  aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgt 262
            ||||||||||| || ||||||||||| ||||| ||||| || || || ||||| |||||
Sbjct: 9064 aacatgtctgtcatcgctcatgtcgatcacggaaagtccaccctcaccgattctcttgt 9006



to top

>gb|AY144924.1| Saccharomyces castellii clone Contig1523 EFT gene, complete cds
          Length = 1368

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 199 ttcgtaacatgtctgttattgctcatgtcga 229
           ||||||||||||| ||||||||||| |||||
Sbjct: 56  ttcgtaacatgtccgttattgctcacgtcga 86



to top

>dbj|AK184688.1| Mus musculus cDNA, clone:Y0G0131C21, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 205 acatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||||| || || || ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 5   acatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>gb|U17362.1|CGU17362 Cricetulus griseus elongation factor 2 (EF2) mRNA, complete cds
          Length = 2629

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 177 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 236
           |||||||||||||||   || || || |||||||| || || ||||| || |||||||||
Sbjct: 53  attatggacaagaaagccaacatccggaacatgtcagtcatcgctcacgtggaccacggc 112

                                  
Query: 237 aagtctacgcttacggattccct 259
           ||||| || || ||||| |||||
Sbjct: 113 aagtccacactgacggactccct 135



to top

>gb|M13708.1|CRUEF2 Hamster elongation factor 2 mRNA, complete cds
          Length = 2933

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 177 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 236
           |||||||||||||||   || || || |||||||| || || ||||| || |||||||||
Sbjct: 111 attatggacaagaaagccaacatccggaacatgtcagtcatcgctcacgtggaccacggc 170

                                  
Query: 237 aagtctacgcttacggattccct 259
           ||||| || || ||||| |||||
Sbjct: 171 aagtccacactgacggactccct 193



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 216     attgctcatgtcgaccacggcaagtc 241
               ||||||||| ||||||||||||||||
Sbjct: 1980600 attgctcatatcgaccacggcaagtc 1980625



to top

>gb|AY078407.1| Spodoptera exigua translation elongation factor 2 mRNA, complete
           cds
          Length = 2983

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||| || || ||||| |||||||||||||||||
Sbjct: 183 aacatgtccgtcatcgctcacgtcgaccacggcaagtc 220



to top

>ref|XM_765828.1| Giardia lamblia ATCC 50803 elongation factor 2
           (GLP_608_18578_21274) partial mRNA
          Length = 2697

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||| || |||||||||||||| ||||| |||||
Sbjct: 61  aacatgtcggtcattgctcatgtcgatcacggaaagtc 98



to top

>ref|XM_662910.1| Cryptosporidium hominis TU502 elongation factor 2 (EF-2)
           (Chro.80341) partial mRNA
          Length = 2499

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaa 238
           ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 58  cgtaatatgtctgttattgctcacgtcgatcatggcaa 95



to top

>gb|AY305512.1| Neogonodactylus oerstedii voucher Neo elongation factor-2 mRNA,
           partial cds
          Length = 2179

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||||||||| ||||||||||| || || ||||||||
Sbjct: 41  aacatgtctgtgattgctcatgtagatcatggcaagtc 78



to top

>gb|AY305503.2| Metajapyx subterraneus voucher Jap elongation factor-2 mRNA,
           partial cds
          Length = 2179

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 239
           ||||||||||| || || || || |||||||| || ||||| || || ||||||||||||
Sbjct: 17  atggacaagaagaagaacatccggaacatgtccgtgattgcccacgtggaccacggcaag 76

             
Query: 240 tc 241
           ||
Sbjct: 77  tc 78



to top

>gb|AY305487.1| Acanthocyclops vernalis voucher A369 elongation factor-2 mRNA,
           partial cds
          Length = 2179

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/38 (86%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||| || || ||||| ||||| |||||||||||
Sbjct: 41  aacatgtcygtcatygctcacgtcgatcacggcaagtc 78



to top

>gb|AY310264.1| Ophyiulus pilosus voucher Jul elongation factor 2 mRNA, partial cds
          Length = 2185

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 239
           ||||||||||| || || || ||||||||||| || ||||| || || |||||||| || 
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtgattgcccacgtagaccacggtaaa 76

                             
Query: 240 tctacgcttacggattcc 257
           || || || |||||||||
Sbjct: 77  tcaacactgacggattcc 94



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 214     ttattgctcatgtcgaccacggcaagtctacgct 247
               |||| |||||| |||||||||||||||| |||||
Sbjct: 1044229 ttatcgctcatatcgaccacggcaagtccacgct 1044262



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 214    ttattgctcatgtcgaccacggcaagtctacgct 247
              |||| |||||| |||||||||||||||| |||||
Sbjct: 901197 ttatcgctcatatcgaccacggcaagtccacgct 901230



to top

>gb|AF240823.1| Mastigoproctus giganteus elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 195 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 254
           ||||| || ||||||||||| ||||| ||||| ||||| || ||||| || ||||| |||
Sbjct: 32  aatatccgcaacatgtctgtaattgcacatgtggaccatgggaagtcaacacttacagat 91

             
Query: 255 tc 256
           ||
Sbjct: 92  tc 93



to top

>ref|XM_627193.1| Cryptosporidium parvum Iowa II Eft2p GTpase; translation elongation
           factor 2 (EF-2) (cgd8_2930), partial mRNA
          Length = 2511

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaa 238
           ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 70  cgtaatatgtctgttattgctcacgtcgatcatggcaa 107



to top

>gb|DQ357217.1| Leishmania braziliensis elongation factor 2 (EF-2) gene, complete
           cds
          Length = 2538

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtc 241
           |||||||| || ||||| || |||||||||||||||||
Sbjct: 61  aacatgtccgtgattgcccacgtcgaccacggcaagtc 98



to top

>dbj|AK195851.1| Mus musculus cDNA, clone:Y1G0119N10, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 222 catgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 22  catgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AK189260.1| Mus musculus cDNA, clone:Y0G0148H14, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 425

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 222 catgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 22  catgtggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 222     catgtcgaccacggcaagtctacgct 247
               |||||||||||||||||||| |||||
Sbjct: 1609962 catgtcgaccacggcaagtcgacgct 1609937



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 336     gagcgtggtattacaatcaaat 357
               ||||||||||||||||||||||
Sbjct: 4261074 gagcgtggtattacaatcaaat 4261053



to top

>gb|U21667.1|CPU21667 Cryptosporidium parvum elongation factor-2 (EF-2) gene, complete
           cds
          Length = 2723

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaa 238
           ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 148 cgtaatatgtctgttattgctcacgtcgatcatggcaa 185



to top

>ref|NM_122204.2| Arabidopsis thaliana SCPL47; catalytic/ serine carboxypeptidase
           AT5G22980 (SCPL47) mRNA, complete cds
          Length = 1685

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 126 cattcaaaatcagccaagatg 146
           |||||||||||||||||||||
Sbjct: 319 cattcaaaatcagccaagatg 339



to top

>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 226     tcgaccacggcaagtctacgcttacggat 254
               |||||||||||||||| |||||| |||||
Sbjct: 2639920 tcgaccacggcaagtcaacgcttgcggat 2639892



to top

>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 186817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 122   ttgacattcaaaatcagccaa 142
             |||||||||||||||||||||
Sbjct: 54125 ttgacattcaaaatcagccaa 54105



to top

>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete
              sequence
          Length = 136150

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 176    aattatggacaagaaaaataa 196
              |||||||||||||||||||||
Sbjct: 115997 aattatggacaagaaaaataa 115977



to top

>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 226     tcgaccacggcaagtctacgcttacggat 254
               |||||||||||||||| |||||| |||||
Sbjct: 2640780 tcgaccacggcaagtcaacgcttgcggat 2640752



to top

>ref|XM_658842.1| Aspergillus nidulans FGSC A4 elongation factor 2 (AN6330.2), mRNA
          Length = 2535

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||||||||| || |||||||| ||||| ||||| |||||
Sbjct: 58  cgtaacatgtcggtcattgctcacgtcgatcacggaaagtc 98



to top

>gb|U28373.1|YSCD9481 Saccharomyces cerevisiae chromosome IV cosmid 9481
          Length = 42133

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 201   cgtaacatgtctgttattgctcatgtcga 229
             ||||||||||| ||||||||||| |||||
Sbjct: 40645 cgtaacatgtccgttattgctcacgtcga 40673



to top

>gb|AC123541.3| Oryctolagus cuniculus clone LB1-184A7, complete sequence
          Length = 190901

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 254   ttcccttgtggcagctgctgg 274
             |||||||||||||||||||||
Sbjct: 53190 ttcccttgtggcagctgctgg 53170



to top

>emb|X94335.1|SC130KBXV S.cerevisiae 130kb DNA fragment from chromosome XV
          Length = 129528

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 201   cgtaacatgtctgttattgctcatgtcga 229
             ||||||||||| ||||||||||| |||||
Sbjct: 98679 cgtaacatgtccgttattgctcacgtcga 98707



to top

>emb|X90518.1|SCXVORFS S.cerevisiae DNA of 51 Kb from chromosome XV right arm
          Length = 50984

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 201   cgtaacatgtctgttattgctcatgtcga 229
             ||||||||||| ||||||||||| |||||
Sbjct: 45552 cgtaacatgtccgttattgctcacgtcga 45580



to top

>emb|X73154.1|DMTENM D.melanogaster ten(m) mRNA for tenascin-like protein
          Length = 11451

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 386  gactcctgaatcacttgagat 406
            |||||||||||||||||||||
Sbjct: 3682 gactcctgaatcacttgagat 3662



to top

>gb|AF240831.1| Tanystylum orbiculare elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 178 ttatggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 226
           |||||||||| |||   ||||| |||||||||||||| ||||| |||||
Sbjct: 15  ttatggacaaaaaacggaatatccgtaacatgtctgtgattgcccatgt 63



to top

>gb|AC009366.8| Drosophila melanogaster 3L BAC RP98-48E10 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 169841

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 386   gactcctgaatcacttgagat 406
             |||||||||||||||||||||
Sbjct: 44350 gactcctgaatcacttgagat 44370



to top

>dbj|AB226013.1| Aspergillus oryzae cDNA, contig sequence: AoEST2869
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 201 cgtaacatgtctgttattgctcatgtcgaccacggcaagtc 241
           ||||||||||| || |||||||| ||||| ||||| |||||
Sbjct: 254 cgtaacatgtccgtcattgctcacgtcgatcacggaaagtc 294



to top

>ref|NM_079491.2| Drosophila melanogaster Tenascin major CG5723-RB (Ten-m), mRNA
          Length = 11447

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 386  gactcctgaatcacttgagat 406
            |||||||||||||||||||||
Sbjct: 3682 gactcctgaatcacttgagat 3662



to top

>gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 148062

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 122   ttgacattcaaaatcagccaa 142
             |||||||||||||||||||||
Sbjct: 25454 ttgacattcaaaatcagccaa 25474



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 254     ttcccttgtggcagctgctgg 274
               |||||||||||||||||||||
Sbjct: 1752044 ttcccttgtggcagctgctgg 1752024



to top

>gb|AY144817.1| Saccharomyces bayanus EFT2 gene, partial cds
          Length = 1249

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| ||||||||||| |||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcga 86



to top

>gb|AF107289.1|AF107289 Candida tropicalis elongation factor 2 (EFT2) gene, partial cds
          Length = 2441

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           |||||||||||||| |||||||| |||||
Sbjct: 12  cgtaacatgtctgtcattgctcacgtcga 40



to top

>dbj|AK181471.1| Mus musculus cDNA, clone:Y0G0118E08, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || || ||| | |||||||||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatntggaccacggcaagtccacgctgaccgactcccttgtg 63



to top

>emb|Z75041.1|SCYOR133W S.cerevisiae chromosome XV reading frame ORF YOR133w
          Length = 3733

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| ||||||||||| |||||
Sbjct: 325 cgtaacatgtccgttattgctcacgtcga 353



to top

>gb|AE003597.4| Drosophila melanogaster chromosome 3L, section 78 of 83 of the complete
              sequence
          Length = 365612

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 386    gactcctgaatcacttgagat 406
              |||||||||||||||||||||
Sbjct: 177242 gactcctgaatcacttgagat 177262



to top

>gb|DQ332255.1| Synthetic construct Saccharomyces cerevisiae clone FLH202724.01X
           EFT1 gene, complete sequence
          Length = 2529

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| ||||||||||| |||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcga 86



to top

>gb|AF008227.1|DMODZ7 Drosophila melanogaster odd Oz product (odz) gene, exons 3, 4, 5, 6,
            7, and complete cds
          Length = 14045

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 386  gactcctgaatcacttgagat 406
            |||||||||||||||||||||
Sbjct: 7227 gactcctgaatcacttgagat 7207



to top

>gb|AF008228.1|AF008228 Drosophila melanogaster odd Oz protein (odz) mRNA, complete cds
          Length = 10471

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 386  gactcctgaatcacttgagat 406
            |||||||||||||||||||||
Sbjct: 3653 gactcctgaatcacttgagat 3633



to top

>gb|U32274.1|SCD9509 Saccharomyces cerevisiae chromosome IV cosmids 9481, 9509, 9926,
            9461, and lambda 3641
          Length = 55359

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 201  cgtaacatgtctgttattgctcatgtcga 229
            ||||||||||| ||||||||||| |||||
Sbjct: 6027 cgtaacatgtccgttattgctcacgtcga 6055



to top

>emb|BX928742.15| Zebrafish DNA sequence from clone CH211-261F3 in linkage group 2,
            complete sequence
          Length = 144719

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 206  catgtctgttattgctcatgt 226
            |||||||||||||||||||||
Sbjct: 8485 catgtctgttattgctcatgt 8505



to top

>gb|M59370.1|YSCEFT2 S.cerevisiae translation elongation factor 2 (EFT2) gene, complete
           cds
          Length = 2932

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| ||||||||||| |||||
Sbjct: 458 cgtaacatgtccgttattgctcacgtcga 486



to top

>gb|M59369.1|YSCEFT1 S.cerevisiae translation elongation factor 2 (EFT1) gene, complete
           cds
          Length = 2932

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 201 cgtaacatgtctgttattgctcatgtcga 229
           ||||||||||| ||||||||||| |||||
Sbjct: 458 cgtaacatgtccgttattgctcacgtcga 486



to top

>ref|XM_631959.1| Dictyostelium discoideum elongation factor 2 (DDB0216236), partial
           mRNA
          Length = 2562

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 207 atgtctgttattgctcatgt 226
           ||||||||||||||||||||
Sbjct: 64  atgtctgttattgctcatgt 83



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 216     attgctcatgtcgaccacggcaagtctacgct 247
               ||||| ||| |||||||||||||||| |||||
Sbjct: 1531571 attgcccatatcgaccacggcaagtcgacgct 1531540



to top

>ref|NM_017245.2| Rattus norvegicus eukaryotic translation elongation factor 2
           (Eef2), mRNA
          Length = 2944

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 263
           |||||||| || || ||||| || |||||||||||||| ||| | || || |||||||||
Sbjct: 124 aacatgtcagtcatcgctcacgtggaccacggcaagtccacgttgaccgactcccttgtg 183



to top

>gb|AC162284.11| Mus musculus chromosome 8, clone RP23-256C11, complete sequence
          Length = 162981

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 42     cgggagcgccgccgcttccccacc 65
              ||||||||||||||| ||||||||
Sbjct: 125684 cgggagcgccgccgcctccccacc 125707



to top

>ref|NM_025396.1| Mus musculus 6-phosphogluconolactonase (Pgls), mRNA
          Length = 885

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 42 cgggagcgccgccgcttccccacc 65
          ||||||||||||||| ||||||||
Sbjct: 8  cgggagcgccgccgcctccccacc 31



to top

>gb|BC059523.1| Danio rerio wu:fj53d02, mRNA (cDNA clone IMAGE:4200691), partial
           cds
          Length = 1068

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 204 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 259
           ||||||||||| || || ||||| ||||||||||| || || || || ||||||||
Sbjct: 121 aacatgtctgtgatcgcccatgtggaccacggcaaatccactctcactgattccct 176



to top

>emb|CR962126.1| Medicago truncatula chromosome 5 clone mth2-143k7, COMPLETE SEQUENCE
          Length = 117577

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 193   ataatattcgtaacatgtctgtta 216
             ||||||||| ||||||||||||||
Sbjct: 41879 ataatattcttaacatgtctgtta 41856



to top

>gb|AC125339.4| Mus musculus BAC clone RP24-356P17 from chromosome 17, complete
             sequence
          Length = 156282

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   ttgacattcaaaatcagcca 141
             ||||||||||||||||||||
Sbjct: 15329 ttgacattcaaaatcagcca 15310



to top

>gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, complete sequence
          Length = 218747

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    ttcccttgtggcagctgctg 273
              ||||||||||||||||||||
Sbjct: 126203 ttcccttgtggcagctgctg 126184



to top

>ref|XM_720710.1| Plasmodium yoelii yoelii str. 17XNL elongation factor 2 (PY05356)
           partial mRNA
          Length = 2499

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 204 aacatgtctgttattgctcatgtcgaccacgg 235
           |||||||| ||||| || ||||||||||||||
Sbjct: 61  aacatgtccgttatagcacatgtcgaccacgg 92



to top

>gb|AE004124.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 32
            of 251 of the complete chromosome
          Length = 11069

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 336  gagcgtggtattacaatcaa 355
            ||||||||||||||||||||
Sbjct: 6440 gagcgtggtattacaatcaa 6459



to top

>gb|AE004120.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 28
            of 251 of the complete chromosome
          Length = 9995

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 336  gagcgtggtattacaatcaa 355
            ||||||||||||||||||||
Sbjct: 6385 gagcgtggtattacaatcaa 6404



to top

>ref|XM_736543.1| Plasmodium chabaudi chabaudi elongation factor 2 (PC000371.03.0)
           partial mRNA
          Length = 1116

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 204 aacatgtctgttattgctcatgtcgaccacgg 235
           |||||||| ||||| || ||||||||||||||
Sbjct: 61  aacatgtccgttatagcacatgtcgaccacgg 92



to top

>ref|XM_667054.1| Plasmodium berghei strain ANKA hypothetical protein (PB301482.00.0)
           partial mRNA
          Length = 195

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 204 aacatgtctgttattgctcatgtcgaccacgg 235
           |||||||| ||||| || ||||||||||||||
Sbjct: 61  aacatgtccgttatagcacatgtcgaccacgg 92



to top

>ref|XM_673005.1| Plasmodium berghei strain ANKA elongation factor 2 (PB000800.00.0)
           partial mRNA
          Length = 2499

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 204 aacatgtctgttattgctcatgtcgaccacgg 235
           |||||||| ||||| || ||||||||||||||
Sbjct: 61  aacatgtccgttatagcacatgtcgaccacgg 92



to top

>gb|AC154449.2| Mus musculus BAC clone RP24-168F5 from chromosome 16, complete sequence
          Length = 137395

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   gaactatattcccagcttga 125
             ||||||||||||||||||||
Sbjct: 78075 gaactatattcccagcttga 78094



to top

>gb|AC137994.19| Medicago truncatula clone mth2-23f15, complete sequence
          Length = 131563

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   ttatggacaagaaaaataat 197
             ||||||||||||||||||||
Sbjct: 76542 ttatggacaagaaaaataat 76561



to top

>gb|AY305488.1| Abacion magnum voucher Ama2 elongation factor-2 mRNA, partial cds
          Length = 2185

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 180 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacgg 235
           ||||||||||| || || || ||||| ||||| |||||||| ||||| || |||||
Sbjct: 17  atggacaagaagaagaacatccgtaatatgtccgttattgcccatgttgatcacgg 72


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,279,053
Number of Sequences: 3902068
Number of extensions: 5279053
Number of successful extensions: 93269
Number of sequences better than 10.0: 282
Number of HSP's better than 10.0 without gapping: 282
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92565
Number of HSP's gapped (non-prelim): 702
length of query: 439
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 417
effective length of database: 17,147,199,772
effective search space: 7150382304924
effective search space used: 7150382304924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top