>emb|AL929554.20| Human DNA sequence from clone RP11-350O14 on chromosome 9 Contains the
3' end of the MAN1B1 gene for mannosidase alpha class 1B
member 1, the DPP7 gene for dipeptidylpeptidase 7, the
GRIN1 gene for glutamate receptor ionotropic N-methyl
D-aspartate 1, a novel gene, the gene for
anaphase-promoting complex subunit 2 (ANAPC2), the SSNA1
gene for Sjogren's syndrome nuclear autoantigen 1, three
novel genes (FLJ90254), a novel pseudogene, the 5' end of
the gene for NADPH-dependent FMN and FAD containing
oxidoreductase (NR1) and thirteen CpG islands, complete
sequence
Length = 119883
Score = 40.1 bits (20), Expect = 4.8
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 223 ggcagtgttaccaaggactg 242
||||||||||||||||||||
Sbjct: 56488 ggcagtgttaccaaggactg 56469
>emb|AL606521.24| Mouse DNA sequence from clone RP23-280J3 on chromosome 11 Contains the 5'
end of the Mtmr3 gene for myotubularin related protein 3,
two novel genes, the gene for a novel protein similar to
human ASC-1 complex subunit P100, the gene for a novel
protein similar to human ubiquinol-cytochrome C reductase
complex 7.2 kDa protein UQCR10, the Cabp7 gene for calcium
binding protein 7, the 3' end of the Nf2 gene for
neurofibromatosis 2 and two CpG islands, complete sequence
Length = 233997
Score = 40.1 bits (20), Expect = 4.8
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 30 ccccagtcctctcctcctct 49
||||||||||||||||||||
Sbjct: 193029 ccccagtcctctcctcctct 193048
>emb|Z32772.1|HSNMDAR1A H.sapiens gene for N-methyl-D-aspartate receptor R1, exon1, exon2
Length = 7282
Score = 40.1 bits (20), Expect = 4.8
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 223 ggcagtgttaccaaggactg 242
||||||||||||||||||||
Sbjct: 5594 ggcagtgttaccaaggactg 5575
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,423,788
Number of Sequences: 3902068
Number of extensions: 3423788
Number of successful extensions: 77473
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77275
Number of HSP's gapped (non-prelim): 198
length of query: 360
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 338
effective length of database: 17,147,199,772
effective search space: 5795753522936
effective search space used: 5795753522936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)