>gb|AC110544.13| Mus musculus chromosome 3, clone RP23-112A11, complete sequence
          Length = 201027

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    gtgctgagaatgatgacagc 43
             ||||||||||||||||||||
Sbjct: 34247 gtgctgagaatgatgacagc 34228

>ref|XM_220756.3| PREDICTED: Rattus norvegicus similar to prohibitin (LOC287559),
           mRNA
          Length = 846

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  gatgacagctctatgcccag 54
           ||||||||||||||||||||
Sbjct: 114 gatgacagctctatgcccag 95

>gb|AC124680.10| Mus musculus chromosome 14, clone RP23-383A19, complete sequence
          Length = 202809

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     aggtgctgagaatgatgac 40
              |||||||||||||||||||
Sbjct: 171458 aggtgctgagaatgatgac 171440

>emb|AL442064.10| Human DNA sequence from clone RP11-272D1 on chromosome 9 Contains the
             3' end of the EDG2 gene for endothelial differentiation,
             lysophosphatidic acid G-protein-coupled receptor, 2,
             complete sequence
          Length = 169905

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    gcctgtacaggaaggtgct 28
             |||||||||||||||||||
Sbjct: 58851 gcctgtacaggaaggtgct 58833

>emb|AL157881.14| Human DNA sequence from clone RP11-104M22 on chromosome 9q31.1-32
              Contains the 3' end of the MUSK gene for muscle, skeletal,
              receptor tyrosine kinase and the 3' end of the EDG2 gene
              for endothelial differentiation, lysophosphatidic acid
              G-protein-coupled receptor, 2, complete sequence
          Length = 162726

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     gcctgtacaggaaggtgct 28
              |||||||||||||||||||
Sbjct: 142225 gcctgtacaggaaggtgct 142207

>emb|AL022720.1|HS357K22 Human DNA sequence from clone RP3-357K22 on chromosome Xq27.1-27.3,
             complete sequence
          Length = 145638

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgtacaggaaggtgctgag 31
             |||||||||||||||||||
Sbjct: 20685 tgtacaggaaggtgctgag 20667

>ref|XM_792726.1| PREDICTED: Strongylocentrotus purpuratus similar to potassium
           channel tetramerisation domain containing 10
           (LOC593241), mRNA
          Length = 1206

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 1   tctgccagagcctgtacaggaag 23
           |||||||||| ||||||||||||
Sbjct: 582 tctgccagagtctgtacaggaag 604

>emb|AL731726.11| Mouse DNA sequence from clone RP23-97P13 on chromosome 11 Contains a
             novel gene and a CpG island, complete sequence
          Length = 47745

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    tacaggaaggtgctgagaa 33
             |||||||||||||||||||
Sbjct: 34096 tacaggaaggtgctgagaa 34114

>dbj|AK148915.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
           full-length enriched library, clone:7120462I01
           product:unclassifiable, full insert sequence
          Length = 1579

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 1   tctgccagagcctgtacag 19
           |||||||||||||||||||
Sbjct: 940 tctgccagagcctgtacag 958

>dbj|AK148833.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120453C11
            product:hypothetical protein, full insert sequence
          Length = 4012

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    tctgccagagcctgtacag 19
            |||||||||||||||||||
Sbjct: 3509 tctgccagagcctgtacag 3527

>gb|AC105926.5| Homo sapiens BAC clone RP11-801F10 from 2, complete sequence
          Length = 93438

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    acaggaaggtgctgagaat 34
             |||||||||||||||||||
Sbjct: 84678 acaggaaggtgctgagaat 84696

>gb|AC164978.2| Mus musculus BAC clone RP23-342O10 from chromosome 14, complete sequence
          Length = 206840

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1      tctgccagagcctgtacag 19
              |||||||||||||||||||
Sbjct: 186658 tctgccagagcctgtacag 186676

>gb|AC173482.1| Mus musculus BAC clone RP23-383F20 from chromosome 14, complete
            sequence
          Length = 216037

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 22   aggtgctgagaatgatgac 40
            |||||||||||||||||||
Sbjct: 4146 aggtgctgagaatgatgac 4128

>gb|AC150746.2| Mus musculus BAC clone RP23-364B18 from 6, complete sequence
          Length = 215490

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 37     tgacagctctatgcccagt 55
              |||||||||||||||||||
Sbjct: 199593 tgacagctctatgcccagt 199611

>gb|AC127320.4| Mus musculus BAC clone RP23-230O23 from chromosome 6, complete sequence
          Length = 197402

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    tgacagctctatgcccagt 55
             |||||||||||||||||||
Sbjct: 46496 tgacagctctatgcccagt 46514


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 716,398
Number of Sequences: 3902068
Number of extensions: 716398
Number of successful extensions: 88969
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88943
Number of HSP's gapped (non-prelim): 26
length of query: 84
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 63
effective length of database: 17,151,101,840
effective search space: 1080519415920
effective search space used: 1080519415920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)