>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                            
Query: 290      cagcaccgagtctgatggggcacagcgcatggccaagttcctctgcagcttcggaggcag 349
                |||| ||||| ||||||| || |  |||||||||||||||||||||||||| ||||| ||
Sbjct: 33406020 cagcgccgaggctgatggagcccctcgcatggccaagttcctctgcagctttggaggaag 33406079

                               
Query: 350      catccttccccgccc 364
                |||||| ||||||||
Sbjct: 33406080 catcctgccccgccc 33406094

>dbj|AP004057.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1316_E06
          Length = 110197

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                         
Query: 290   cagcaccgagtctgatggggcacagcgcatggccaagttcctctgcagcttcggaggcag 349
             |||| ||||| ||||||| || |  |||||||||||||||||||||||||| ||||| ||
Sbjct: 36639 cagcgccgaggctgatggagcccctcgcatggccaagttcctctgcagctttggaggaag 36698

                            
Query: 350   catccttccccgccc 364
             |||||| ||||||||
Sbjct: 36699 catcctgccccgccc 36713

>ref|XM_537001.2| PREDICTED: Canis familiaris similar to CG17065-PA (LOC479876), mRNA
          Length = 1321

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 75  cgcccggagcccagccgcccaagtcggctgcccgctc 111
           ||||||||||||||| ||||||| | ||| |||||||
Sbjct: 60  cgcccggagcccagcagcccaagcccgctacccgctc 24

>ref|XM_613401.2| PREDICTED: Bos taurus similar to phosphatidylinositol transfer
           protein, membrane-associated (LOC533859), mRNA
          Length = 4181

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 308 ggcacagcgcatggccaagt 327
           ||||||||||||||||||||
Sbjct: 957 ggcacagcgcatggccaagt 976

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 87      agccgcccaagtcggctgcc 106
               ||||||||||||||||||||
Sbjct: 3681953 agccgcccaagtcggctgcc 3681972

>ref|XM_748856.1| Aspergillus fumigatus Af293 class V chitinase (Afu5g06840) partial
           mRNA
          Length = 3462

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 209 tagctctgtcgccgatccaa 228
           ||||||||||||||||||||
Sbjct: 201 tagctctgtcgccgatccaa 220

>emb|BX061226.1|CNS09JEM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 275 tgctgccgctgcggccagcaccga 298
           |||||||||||| |||||||||||
Sbjct: 519 tgctgccgctgctgccagcaccga 542

>emb|BX059726.1|CNS09I8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 275 tgctgccgctgcggccagcaccga 298
           |||||||||||| |||||||||||
Sbjct: 527 tgctgccgctgctgccagcaccga 550

>emb|BX059725.1|CNS09I8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 275 tgctgccgctgcggccagcaccga 298
           |||||||||||| |||||||||||
Sbjct: 695 tgctgccgctgctgccagcaccga 672

>emb|X78384.1|DMADH D.melanogaster Adh and Adh-dup genes
          Length = 4761

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  gcatggccaagttcctctgc 335
            ||||||||||||||||||||
Sbjct: 3163 gcatggccaagttcctctgc 3182

>gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, complete sequence
          Length = 179868

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 159   taacaagagcagctgattggaact 182
             |||||||||||| |||||||||||
Sbjct: 78599 taacaagagcagttgattggaact 78622

>ref|XM_318701.2| Anopheles gambiae str. PEST ENSANGP00000023724
           (ENSANGG00000007791), partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 275 tgctgccgctgcggccagcaccga 298
           |||||||||||| |||||||||||
Sbjct: 937 tgctgccgctgctgccagcaccga 914

>ref|XM_318699.2| Anopheles gambiae str. PEST ENSANGP00000010280
           (ENSANGG00000007791), partial mRNA
          Length = 2127

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 275 tgctgccgctgcggccagcaccga 298
           |||||||||||| |||||||||||
Sbjct: 754 tgctgccgctgctgccagcaccga 731

>gb|AC004592.1|AC004592 Homo sapiens PAC clone RP1-244J5 from 5q31, complete sequence
          Length = 130513

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 159   taacaagagcagctgattggaact 182
             |||||||||||| |||||||||||
Sbjct: 85151 taacaagagcagttgattggaact 85128

>gb|M19547.1|DROADHCC D.melanogaster (strain Af-S) alcohol dehydrogenase gene (allele
            Adh-S), complete cds
          Length = 7119

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 316  gcatggccaagttcctctgc 335
            ||||||||||||||||||||
Sbjct: 6691 gcatggccaagttcctctgc 6710


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,124,187
Number of Sequences: 3902068
Number of extensions: 2124187
Number of successful extensions: 37559
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37473
Number of HSP's gapped (non-prelim): 86
length of query: 378
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 356
effective length of database: 17,147,199,772
effective search space: 6104403118832
effective search space used: 6104403118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)