ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl16e05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY340168.1| Acanthophis pyrrhus isolate 1133 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 648 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 174 aatcgccgcaatatccatcca 194
>gb|AY340167.1| Acanthophis cf. laevis isolate 276 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 648 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 174 aatcgccgcaatatccatcca 194
>gb|AY340166.1| Acanthophis cf. laevis isolate 1252 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 648 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 174 aatcgccgcaatatccatcca 194
>gb|AY340165.1| Acanthophis cf. laevis isolate 1140 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 598 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 125 aatcgccgcaatatccatcca 145
>gb|AY340163.1| Acanthophis antarcticus isolate 1192 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 638 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 164 aatcgccgcaatatccatcca 184
>gb|AY340162.1| Acanthophis antarcticus isolate 1137 NADH dehydrogenase subunit 4 (ND4) gene, partial cds; mitochondrial gene for mitochondrial product Length = 648 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 aatcgccgcaatatccatcca 107 ||||||||||||||||||||| Sbjct: 174 aatcgccgcaatatccatcca 194 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,870,279 Number of Sequences: 3902068 Number of extensions: 2870279 Number of successful extensions: 44574 Number of sequences better than 10.0: 6 Number of HSP's better than 10.0 without gapping: 6 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 44568 Number of HSP's gapped (non-prelim): 6 length of query: 409 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 387 effective length of database: 17,147,199,772 effective search space: 6635966311764 effective search space used: 6635966311764 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
