>gb|AF466199.1| Sorghum bicolor putative receptor protein kinase,
            aminoalcoholphosphotransferase, putative
            growth-regulating factor 1, putative GAG-POL precursor,
            putative GAG-POL precursor, putative RIRE2 orf3, putative
            anthocyanin regulatory C1, putative protein T30F21.6,
            putative copia polyprotein, putative copia polyprotein,
            putative protein NP_196765.1, and gb protein genes,
            complete cds; and putative zinc finger protein gene,
            partial cds
          Length = 144159

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 40   gccatacggctactcgctgtcactgag 66
            ||||||| |||||||||||||||||||
Sbjct: 8688 gccatacagctactcgctgtcactgag 8662

>emb|AJ719344.1| Gallus gallus mRNA for hypothetical protein, clone 1i13
          Length = 684

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 56  ctgtcactgagccggcagcag 76
           |||||||||||||||||||||
Sbjct: 85  ctgtcactgagccggcagcag 105

>emb|AL159992.13| Human DNA sequence from clone RP11-166H7 on chromosome 9q34.13-34.3
             Contains the 5' end of the OLFM1 gene for olfactomedin 1
             and a CpG island, complete sequence
          Length = 73073

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 101   ccagccagccagagcggagcc 121
             |||||||||||||||||||||
Sbjct: 31641 ccagccagccagagcggagcc 31621

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 242     ctctctcggcgtctcccccg 261
               ||||||||||||||||||||
Sbjct: 2331910 ctctctcggcgtctcccccg 2331929

>gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, complete sequence
          Length = 224088

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     tgtcactgagccggcagcag 76
              ||||||||||||||||||||
Sbjct: 196705 tgtcactgagccggcagcag 196686


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,032,925
Number of Sequences: 3902068
Number of extensions: 2032925
Number of successful extensions: 40435
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40406
Number of HSP's gapped (non-prelim): 29
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)