ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl12h11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF098504.1| Caenorhabditis elegans cosmid T27C10, complete se... 46 0.073
2gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 42 1.1
3gb|AY860611.1| Citrobacter sp. MY-5 guanosine pentaphosphatase-l... 42 1.1
4emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chr... 42 1.1
5gb|AC116557.30| Mus musculus strain C57BL/6J clone rp23-239f10 m... 42 1.1
6gb|AC122465.4| Mus musculus BAC clone RP24-304I22 from chromosom... 42 1.1
7gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 42 1.1
8emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on ch... 42 1.1
9dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 42 1.1
10emb|BX322620.13| Zebrafish DNA sequence from clone DKEY-49L3 in ... 42 1.1
11emb|BX247872.12| Zebrafish DNA sequence from clone CH211-223M9, ... 42 1.1
12gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 42 1.1
13gb|M87049.1|ECOUW85 E. coli genomic sequence of the region from ... 42 1.1
14gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 42 1.1
15gb|M83316.1|ECOGPPA E.coli RNA helicase-like gene, 3' end; pppGp... 42 1.1
16dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 42 1.1
17gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 42 1.1
18gb|AE017130.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 4.5
19gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 40 4.5
20gb|AC102658.9| Mus musculus chromosome 1, clone RP23-82B23, comp... 40 4.5
21gb|AY500826.1| Neocallimastix frontalis pyruvate formate lyase a... 40 4.5
22gb|AC146451.3| Pan troglodytes BAC clone RP43-1L21 from 7, compl... 40 4.5
23gb|AE009952.1| Yersinia pestis KIM, complete genome 40 4.5
24gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, co... 40 4.5
25gb|AC116420.8| Mus musculus chromosome 1, clone RP24-141B16, com... 40 4.5
26gb|AC163899.3| Mus musculus chromosome 1, clone RP24-383F13, com... 40 4.5
27emb|Z82203.1|HS360E18 Human DNA sequence from clone RP3-360E18 o... 40 4.5
28emb|AL391235.4| Human DNA sequence from clone RP11-320L5 on chro... 40 4.5
29emb|AL356096.11| Human DNA sequence from clone RP11-366K1 on chr... 40 4.5
30emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C2... 40 4.5
31emb|CR628337.1| Legionella pneumophila str. Lens complete genome 40 4.5
32emb|CR628336.1| Legionella pneumophila str. Paris complete genome 40 4.5
33emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 4.5
34emb|AJ414147.1| Yersinia pestis strain CO92 complete genome; seg... 40 4.5
35gb|AC161602.4| Mus musculus BAC clone RP23-336I5 from chromosome... 40 4.5
36gb|AC008835.6| Homo sapiens chromosome 5 clone CTD-2148E3, compl... 40 4.5
37emb|BX323555.10| Zebrafish DNA sequence from clone DKEY-163M14 i... 40 4.5
38gb|AC152946.1| Mus musculus 10 BAC RP23-40N7 (Roswell Park Cance... 40 4.5
39dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
40emb|BX815178.1|CNS0ABFL Arabidopsis thaliana Full-length cDNA Co... 40 4.5
41emb|BX815094.1|CNS0ABK2 Arabidopsis thaliana Full-length cDNA Co... 40 4.5
42gb|AC097480.3| Homo sapiens BAC clone RP11-123O22 from 4, comple... 40 4.5
43gb|AC016543.6|AC016543 Homo sapiens chromosome 14q24.3 clone RP1... 40 4.5
44dbj|AP003861.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.5
45gb|AF066913.1|AF066913 Ancistrocerus nigricornis 16S ribosomal R... 40 4.5
46gb|AC117681.20| Mus musculus chromosome 1, clone RP23-436A22, co... 40 4.5
47gb|AC138620.4| Mus musculus BAC clone RP23-250E1 from 6, complet... 40 4.5
48emb|CT005243.3| Pan troglodytes chromosome X clone RP43-008I08 m... 40 4.5
49dbj|AP001577.3| Homo sapiens genomic DNA, chromosome 6q25.2, clo... 40 4.5 
>gb|AF098504.1| Caenorhabditis elegans cosmid T27C10, complete sequence
          Length = 32556

 Score = 46.1 bits (23), Expect = 0.073
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 245  tcctggaaaaataaaataattaa 267
            |||||||||||||||||||||||
Sbjct: 3804 tcctggaaaaataaaataattaa 3782
to top
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 3971855 taatattcaacgccgctttatgatc 3971831
to top
>gb|AY860611.1| Citrobacter sp. MY-5 guanosine pentaphosphatase-like gene, partial
           cds
          Length = 522

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 265 taatcttcaacgccgctttatgatc 289
           |||| ||||||||||||||||||||
Sbjct: 24  taatattcaacgccgctttatgatc 48
to top
>emb|CT010431.7| Mouse DNA sequence from clone RP23-453M21 on chromosome 13, complete
             sequence
          Length = 204148

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 251   aaaaataaaataattaatcttcaac 275
             ||||||||||||| |||||||||||
Sbjct: 33381 aaaaataaaataaataatcttcaac 33357
to top
>gb|AC116557.30| Mus musculus strain C57BL/6J clone rp23-239f10 map 8, complete sequence
          Length = 232571

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    tcccccttctccctcctcgtg 39
             |||||||||||||||||||||
Sbjct: 95998 tcccccttctccctcctcgtg 95978
to top
>gb|AC122465.4| Mus musculus BAC clone RP24-304I22 from chromosome 13, complete
            sequence
          Length = 142340

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 251  aaaaataaaataattaatcttcaac 275
            ||||||||||||| |||||||||||
Sbjct: 1124 aaaaataaaataaataatcttcaac 1148
to top
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 3961311 taatattcaacgccgctttatgatc 3961287
to top
>emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on chromosome 11 Contains the
              5' end of the gene for a novel protein (C330012F17Rik,
              C130096N06Rik), a ribosomal protein L37a (Rpl37a)
              pseudogene, a pseudogene similar to part of a novel protein
              (D130064H19Rik), a fibrillarin (Fbl) pseudogene, the 5' end
              of the gene for a novel protein (4931428D14Rik)
              (2300003H10) and three CpG islands, complete sequence
          Length = 199018

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 251    aaaaataaaataattaatctt 271
              |||||||||||||||||||||
Sbjct: 131010 aaaaataaaataattaatctt 130990
to top
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 3673393 taatattcaacgccgctttatgatc 3673417
to top
>emb|BX322620.13| Zebrafish DNA sequence from clone DKEY-49L3 in linkage group 13,
            complete sequence
          Length = 192504

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 246  cctggaaaaataaaataatta 266
            |||||||||||||||||||||
Sbjct: 3972 cctggaaaaataaaataatta 3952
to top
>emb|BX247872.12| Zebrafish DNA sequence from clone CH211-223M9, complete sequence
          Length = 199873

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 246    cctggaaaaataaaataatta 266
              |||||||||||||||||||||
Sbjct: 187434 cctggaaaaataaaataatta 187454
to top
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 3801439 taatattcaacgccgctttatgatc 3801463
to top
>gb|M87049.1|ECOUW85 E. coli genomic sequence of the region from 84.5 to 86.5 minutes
          Length = 91414

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 265   taatcttcaacgccgctttatgatc 289
             |||| ||||||||||||||||||||
Sbjct: 16416 taatattcaacgccgctttatgatc 16392
to top
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 4825679 taatattcaacgccgctttatgatc 4825655
to top
>gb|M83316.1|ECOGPPA E.coli RNA helicase-like gene, 3' end; pppGpp phosphohydrolase gene,
            complete cds
          Length = 1748

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 265  taatcttcaacgccgctttatgatc 289
            |||| ||||||||||||||||||||
Sbjct: 1361 taatattcaacgccgctttatgatc 1385
to top
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 4756694 taatattcaacgccgctttatgatc 4756670
to top
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 265     taatcttcaacgccgctttatgatc 289
               |||| ||||||||||||||||||||
Sbjct: 3699862 taatattcaacgccgctttatgatc 3699886
to top
>gb|AE017130.1| Yersinia pestis biovar Medievalis str. 91001 section 4 of 16 of the
              complete genome
          Length = 290510

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    agaagaagactttattgatc 185
              ||||||||||||||||||||
Sbjct: 119573 agaagaagactttattgatc 119554
to top
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 249     ggaaaaataaaataattaat 268
               ||||||||||||||||||||
Sbjct: 2372077 ggaaaaataaaataattaat 2372096
to top
>gb|AC102658.9| Mus musculus chromosome 1, clone RP23-82B23, complete sequence
          Length = 186097

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     tcccccttctccctcctcgt 38
              ||||||||||||||||||||
Sbjct: 114166 tcccccttctccctcctcgt 114147
to top
>gb|AY500826.1| Neocallimastix frontalis pyruvate formate lyase activating enzyme
           mRNA, complete cds
          Length = 1216

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 252 aaaataaaataattaatctt 271
           ||||||||||||||||||||
Sbjct: 63  aaaataaaataattaatctt 82
to top
>gb|AC146451.3| Pan troglodytes BAC clone RP43-1L21 from 7, complete sequence
          Length = 161524

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tggaaaaataaaataattaa 267
             ||||||||||||||||||||
Sbjct: 64406 tggaaaaataaaataattaa 64425
to top
>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 166     agaagaagactttattgatc 185
               ||||||||||||||||||||
Sbjct: 3275295 agaagaagactttattgatc 3275276
to top
>gb|AC100727.10| Mus musculus chromosome 1, clone RP24-278K16, complete sequence
          Length = 170056

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    aaaataaaataattaatctt 271
              ||||||||||||||||||||
Sbjct: 119278 aaaataaaataattaatctt 119259
to top
>gb|AC116420.8| Mus musculus chromosome 1, clone RP24-141B16, complete sequence
          Length = 191497

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   tcccccttctccctcctcgt 38
            ||||||||||||||||||||
Sbjct: 5732 tcccccttctccctcctcgt 5713
to top
>gb|AC163899.3| Mus musculus chromosome 1, clone RP24-383F13, complete sequence
          Length = 227890

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     tcccccttctccctcctcgt 38
              ||||||||||||||||||||
Sbjct: 170191 tcccccttctccctcctcgt 170172
to top
>emb|Z82203.1|HS360E18 Human DNA sequence from clone RP3-360E18 on chromosome Xq12-13 Contains
             part of the OPHN1 gene for oligophrenin 1 and three CpG
             islands, complete sequence
          Length = 131903

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 250   gaaaaataaaataattaatcttca 273
             ||||||||||||| ||||||||||
Sbjct: 10290 gaaaaataaaatatttaatcttca 10267
to top
>emb|AL391235.4| Human DNA sequence from clone RP11-320L5 on chromosome 1 Contains the
             5' end of the VAV3 gene for vav 3 oncogene, the 5' end of
             a novel gene and a CpG island, complete sequence
          Length = 74581

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 305   catctctctcacccagctgc 324
             ||||||||||||||||||||
Sbjct: 38020 catctctctcacccagctgc 38039
to top
>emb|AL356096.11| Human DNA sequence from clone RP11-366K1 on chromosome 13 Contains a
             novel gene and a CpG island, complete sequence
          Length = 190101

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 246   cctggaaaaataaaataatt 265
             ||||||||||||||||||||
Sbjct: 40475 cctggaaaaataaaataatt 40494
to top
>emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C23 on chromosome 20 Contains part
             of the C20orf23 gene for a novel protein similar to KIF1
             type and other kinesin-like proteins, complete sequence
          Length = 81487

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   gaaaaataaaataattaatc 269
             ||||||||||||||||||||
Sbjct: 19510 gaaaaataaaataattaatc 19529
to top
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 249     ggaaaaataaaataattaat 268
               ||||||||||||||||||||
Sbjct: 2308295 ggaaaaataaaataattaat 2308314
to top
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 249     ggaaaaataaaataattaat 268
               ||||||||||||||||||||
Sbjct: 2337377 ggaaaaataaaataattaat 2337396
to top
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 166     agaagaagactttattgatc 185
               ||||||||||||||||||||
Sbjct: 1499432 agaagaagactttattgatc 1499451
to top
>emb|AJ414147.1| Yersinia pestis strain CO92 complete genome; segment 7/20
          Length = 199050

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   agaagaagactttattgatc 185
             ||||||||||||||||||||
Sbjct: 43447 agaagaagactttattgatc 43466
to top
>gb|AC161602.4| Mus musculus BAC clone RP23-336I5 from chromosome 6, complete sequence
          Length = 224158

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    aaaataaaataattaatctt 271
              ||||||||||||||||||||
Sbjct: 194843 aaaataaaataattaatctt 194824
to top
>gb|AC008835.6| Homo sapiens chromosome 5 clone CTD-2148E3, complete sequence
          Length = 129046

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   tggaaaaataaaataattaa 267
             ||||||||||||||||||||
Sbjct: 60312 tggaaaaataaaataattaa 60293
to top
>emb|BX323555.10| Zebrafish DNA sequence from clone DKEY-163M14 in linkage group 21,
              complete sequence
          Length = 180416

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    ccgcttttacctcttcttgc 156
              ||||||||||||||||||||
Sbjct: 127094 ccgcttttacctcttcttgc 127075
to top
>gb|AC152946.1| Mus musculus 10 BAC RP23-40N7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 224018

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   tcctggaaaaataaaataat 264
             ||||||||||||||||||||
Sbjct: 50282 tcctggaaaaataaaataat 50263
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 252     aaaataaaataattaatctt 271
               ||||||||||||||||||||
Sbjct: 4503132 aaaataaaataattaatctt 4503113
to top
>emb|BX815178.1|CNS0ABFL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZE01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1268

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 119 tccttcgtcgcagaggcgccgctt 142
           |||||||||||||||||| |||||
Sbjct: 347 tccttcgtcgcagaggcgtcgctt 370
to top
>emb|BX815094.1|CNS0ABK2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS31ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1442

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 119 tccttcgtcgcagaggcgccgctt 142
           |||||||||||||||||| |||||
Sbjct: 358 tccttcgtcgcagaggcgtcgctt 381
to top
>gb|AC097480.3| Homo sapiens BAC clone RP11-123O22 from 4, complete sequence
          Length = 168994

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   tggaaaaataaaataattaa 267
             ||||||||||||||||||||
Sbjct: 20598 tggaaaaataaaataattaa 20579
to top
>gb|AC016543.6|AC016543 Homo sapiens chromosome 14q24.3 clone RP11-516J2 containing hERRB2
             gene, partial cds, complete sequence
          Length = 196784

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   tggaaaaataaaataattaa 267
             ||||||||||||||||||||
Sbjct: 49821 tggaaaaataaaataattaa 49802
to top
>dbj|AP003861.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1046_F10
          Length = 118472

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   aaaataaaataattaatctt 271
             ||||||||||||||||||||
Sbjct: 81851 aaaataaaataattaatctt 81832
to top
>gb|AF066913.1|AF066913 Ancistrocerus nigricornis 16S ribosomal RNA gene, mitochondrial
           gene for mitochondrial rRNA, partial sequence
          Length = 300

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 252 aaaataaaataattaatctt 271
           ||||||||||||||||||||
Sbjct: 189 aaaataaaataattaatctt 170
to top
>gb|AC117681.20| Mus musculus chromosome 1, clone RP23-436A22, complete sequence
          Length = 198868

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    ataaaataattaatcttcaa 274
              ||||||||||||||||||||
Sbjct: 116022 ataaaataattaatcttcaa 116003
to top
>gb|AC138620.4| Mus musculus BAC clone RP23-250E1 from 6, complete sequence
          Length = 209846

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 252    aaaataaaataattaatctt 271
              ||||||||||||||||||||
Sbjct: 129699 aaaataaaataattaatctt 129718
to top
>emb|CT005243.3| Pan troglodytes chromosome X clone RP43-008I08 map Xq28, complete
              sequence
          Length = 180222

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 250    gaaaaataaaataattaatcttca 273
              ||||||||||||| ||||||||||
Sbjct: 137057 gaaaaataaaatatttaatcttca 137080
to top
>dbj|AP001577.3| Homo sapiens genomic DNA, chromosome 6q25.2, clone:KB611H5
          Length = 144828

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   aaaaataaaataattaatct 270
             ||||||||||||||||||||
Sbjct: 69949 aaaaataaaataattaatct 69968


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,256,549
Number of Sequences: 3902068
Number of extensions: 4256549
Number of successful extensions: 115662
Number of sequences better than 10.0: 49
Number of HSP's better than 10.0 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 115368
Number of HSP's gapped (non-prelim): 294
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top